SgRNA, CRISPR / FpCas9 gene editing system and application thereof

Abstract

The invention discloses an sgRNA and CRISPR / FpCas9 gene editing system and application thereof, and belongs to the technical field of bioengineering. The sgRNA comprises a Spacer sequence and an sgRNA scaffold sequence, the Spacer sequence and a target DNA sequence are complementarily paired, a PAM site 5 '-ANA-3' is arranged at the 3'end adjacent to the target DNA sequence, the sgRNA scaffold comprises a first segment and a second segment which are connected through GAAA, the first segment is selected from a first sequence shown in SEQ ID NO.22 or a truncated sequence thereof, and the second segment is selected from a second sequence shown in SEQ ID NO.3 or a truncated sequence thereof. The gene editing system disclosed by the invention comprises FpCas9 protein and sgRNA, and can recognize a sequence 5 '-ANA-3', so that the targeting range of gene editing operation is enlarged, and the limitation of SpCas9 is overcome.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and specifically relates to a sgRNA, CRISPR / FpCas9 gene editing system and applications thereof. Background Art

[0002] CRISPR / Cas9 is a revolutionary gene editing technology that originates from the immune system of bacteria. This system can recognize and cut specific DNA sequences, thereby achieving precise editing of the genome. The CRISPR / Cas9 system is mainly composed of Cas9 enzyme and single guide RNA (sgRNA). Cas9 is responsible for cutting double-stranded DNA, while sgRNA is responsible for guiding Cas9 to a specific gene location. When sgRNA is paired with the target DNA sequence, the Cas9 enzyme will cut the DNA near a specific sequence (PAM), resulting in double-strand breaks, which can be used by the cell's repair mechanism to achieve gene knockout, insertion or replacement. spCas9 is a Cas9 enzyme in the CRISPR-Cas9 system, derived from Streptococcus pyogenes, and is currently one of the most widely used gene editing tools.

[0003] The currently commonly used commercial CRISPR / Cas9 system is derived from Streptococcus pyogenes ( Streptococcus pyogene The type II CRISPR system (Cas, SpCas9) has become the most widely used gene editing system due to its high cutting efficiency under appropriate conditions. This system targets the target fragment by recognizing the PAM sequence of NGG. However, this system has the following disadvantages: (1) This system targets the target fragment by recognizing the PAM sequence of NGG. However, this PAM requirement also limits the application of SpCas9. Some target sites may not be recognized and edited by SpCas9 due to the presence of less GG. (2) The optimal working temperature of this system is 37°C. This temperature condition is to ensure the activity and efficiency of the enzyme, so as to achieve the best effect in the genome editing process. However, this temperature requirement may not be applicable in the gene editing process of some organisms. For example, its application in cold-water fish is greatly limited. During the incubation process of cold-water fish, the incubation temperature is usually much lower than 37°C, about 10°C to 20°C, depending on the specific cold-water fish species and the incubation environment. This low temperature environment greatly reduces the activity and editing efficiency of the SpCas9 enzyme, thereby seriously affecting the effect of gene editing.

[0004] Therefore, based on the shortcomings of the existing type II CRISPR / Cas9 system, it is urgent to develop a new CRISPR / Cas gene editing system suitable for low-temperature environments. Summary of the invention

[0005] In order to address the deficiencies in the prior art, the present invention aims to provide a sgRNA, CRISPR / FpCas9 gene editing system and applications thereof.

[0006] The specific technical solutions of the present invention are as follows: The present invention provides an sgRNA, wherein the sgRNA comprises a Spacer sequence and an sgRNA scaffold sequence from the 5' end to the 3' end, wherein the Spacer sequence is complementary to a target DNA sequence, and a PAM site is provided adjacent to the 3' end of the target DNA sequence, wherein the PAM site is 5'-ANA-3', wherein N represents any one of A, G, C, and T, and wherein the sgRNA scaffold sequence comprises a first segment and a second segment from the 5' end to the 3' end, wherein the first segment and the second segment are connected by GAAA, wherein the first segment is selected from a first sequence as shown in SEQ ID NO. 22 or a truncated sequence of the first sequence, wherein the truncated sequence of the first sequence comprises a core sequence of the first sequence as shown in SEQ ID NO. 23, wherein the second segment is selected from a second sequence as shown in SEQ ID NO. 3 or a truncated sequence of the second sequence, wherein the truncated sequence of the second sequence comprises a core sequence of the second sequence as shown in SEQ ID NO. 9.

[0007] Furthermore, the length of the Spacer sequence is 20-30 nt, preferably 20-24 nt.

[0008] Further, the truncated sequence of the first sequence is selected from the sequence shown in SEQ ID NO. 23, SEQ ID NO. 24 or SEQ ID NO. 25; And / or, the truncated sequence of the second sequence is selected from the sequence shown in SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 or SEQ ID NO. 9; Preferably, the sgRNA scaffold sequence is as shown in SEQ ID NO. 15.

[0009] The present invention also provides a CRISPR / FpCas9 gene editing system, which includes an FpCas9 protein and the sgRNA, the amino acid sequence of the FpCas9 protein is shown in SEQ ID NO. 1, the PAM site recognized by the FpCas9 protein is 5'-ANA-3', and N represents any one of A, G, C, and T.

[0010] Furthermore, the cutting temperature of the CRISPR / FpCas9 gene editing system is 5-25°C.

[0011] The present invention also provides a polynucleotide, which is any one of the following polynucleotides: (1) a polynucleotide encoding the sgRNA; (2) a polynucleotide encoding the sgRNA and the FpCas9 protein; (3) A polynucleotide encoding the sgRNA, and a composition of a polynucleotide encoding the FpCas9 protein.

[0012] The present invention also provides an expression vector, which is any one of the following expression vectors: (1) an expression vector containing a polynucleotide encoding the sgRNA; (2) an expression vector containing a polynucleotide encoding the sgRNA and the FpCas9 protein; (3) A composition comprising an expression vector containing a polynucleotide encoding the sgRNA and an expression vector containing a polynucleotide encoding the FpCas9 protein.

[0013] The present invention also provides a cell, which comprises the expression vector.

[0014] The present invention also provides the application of the CRISPR / FpCas9 gene editing system in gene editing.

[0015] The present invention also provides the use of the expression vector in constructing a CRISPR / FpCas9 gene editing system.

[0016] The present invention also provides a gene editing method, constructing the CRISPR / FpCas9 gene editing system, wherein the sgRNA guides the FpCas9 protein to bind to the target DNA sequence to achieve gene editing; Preferably, the CRISPR / FpCas9 gene editing system is constructed using the expression vector; Preferably, the cutting temperature of the CRISPR / FpCas9 gene editing system is 5-25°C.

[0017] The beneficial effects of the present invention are: (1) The type II CRISPR / FpCas9 gene editing system provided by the present invention can recognize a specific PAM sequence (ANA) and can perform gene editing functions in prokaryotic environments or eukaryotic cells under the guidance of sgRNA, thereby increasing the targetable range of gene editing operations and overcoming the limitations of SpCas9.

[0018] (2) The FpCas9 involved in the present invention has significantly better cutting activity at 5-25°C than SpCas9, and is suitable for gene editing operations in low temperature environments.

[0019] (3) The present invention further truncated the predicted full-length sequences of tracrRNA and crRNA, and designed a loop to make the two of them into a single-stranded RNA. During use, only one sgRNA needs to be transcribed in vitro to guide FpCas9 to perform targeting work. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 . Flavobacterium psychrophilum CRISPR system; Figure 2 . Bioinformatics analysis of FpCas9; Figure 3 . Schematic diagram of FpCas9 in vitro enzyme cleavage; Figure 4 . CRISPR / FpCas9 in vitro enzyme activity test results; Figure 5 . Identification results of CRISPR / FpCas9-adapted tracrRNA core sequences; Figure 6 . CRISPR / FpCas9 compatible crRNA core sequence identification results; Figure 7 . CRISPR / FpCas9-adapted sgRNA; Figure 8 . Optimal spacer length for CRISPR / FpCas9 targeted cleavage; Fig. 9 . PAM detection results of CRISPR / FpCas9; Fig.10 . Comparison of in vitro enzyme cleavage efficiency of CRISPR / FpCas9 (A) and CRISPR / SpCas9 (B) for the same target at different temperatures. DETAILED DESCRIPTION

[0021] In order to understand the present invention more clearly, the present invention is further described with reference to the following examples and accompanying drawings. The examples are only used for explanation and are not intended to limit the present invention in any way. In the examples, each raw material reagent is commercially available, and the experimental methods without specifying specific conditions are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0022] Example 1 1. Analysis of CRISPR / FpCas9 gene editing system CRISPRCas Finder software was used to identify psychrophilic Flavobacterium ( Flavobacterium psychrophilum ) performed metagenomic annotation and found the II-C type CRISPR / FpCas9 system in psychrophilic Flavobacterium ( Figure 1 ), and bioinformatics analysis of the FpCas9 protein revealed that it has typical HNH and RuvC cleavage domains ( Figure 2 ), the amino acid sequence of FpCas9 protein is shown in SEQ ID NO. 1.

[0023] The FpCas9 protein was synthesized in vitro, and the full-length sequences of tracrRNA and crRNA were transcribed and identified. The tracrRNA and crRNA were annealed and co-incubated to form a dimer, thereby guiding FpCas9 to perform enzyme cleavage on exogenous double-stranded DNA to verify its enzymatic activity.

[0024] crRNA (SEQ ID NO. 2): GCAAAAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUCAAAAUUGUA (the underlined region is the target recognition sequence) tracrRNA (SEQ ID NO. 3): UUGUAGUAUUGUACUACAAUUUUGAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUUUAAAGCGGCCUCUAAAGGGUCGCUUUUUUAUUUAG The exogenous double-stranded DNA (dsDNA) selected in this embodiment is a sequence in the psychrophilic Flavobacterium phage FPSV-D15, and its sequence is (SEQ ID NO. 4):ATCAATTAAATATTAACTATGAAATGTTATAAAAGATAAATGAGCTATTACTACTACAAACGTTTCAAAGACCCATACTGGTGGCTCGTTGTTCTAATATCATTTGCAATAATGATTATAGTTTCACTATTTAACAACTAAATATAATTATATGAATCCAATTTATCATGGAGATAAAGACACTAAATCTTTTTATGAAGAAATAGAAAAACTTACAGACA GAGAATTACAAGAGCGTCAAGCTTTTATTTAAGAACTATTGCGAGAAGCAACCATAGCATAAAGCTAAATTTGCAATTTTGGTACTATTTTGCAATAGCAATTGGAGCAATAGCTTTTATTGTTATGGCAAATAAGTAAATTAATGATTCATTCTTATTTTAAAGATGTGCAAATGCACATCTTTTTTTTTGCTAATTAAAATTATTTTGTACTTTCGCCTC GCAAAAATATTATTACTAGGAGCAATCCTGAAAAACTTTTTTTTAAGTTAACATAAGCGAACCCTTGTTCACGTTGTAGGTGCTAGTGATAGCCCTGATCTCATTCCTAGTAATGTTTTTGCACAACCGAAGATGAGGGTTTCGTGTATATAATATTTTCAGACATGCAAAAAGAAAATGAACAACAGGACTCTAAGTTACTCAACTTAGTTCCTAACCTATTAACTGGATTAAAAACATCAGATGCCAACAGGTATCACGAAATTGCACAATTTATGAAAACAGCTTTTATAGAGCTGTCAGACCACGAACTATTCGATGACCCATCGTATCGCAGGC (the underlined region is the crRNA targeting recognition sequence) The steps for FpCas9 to verify the enzyme digestion of exogenous double-stranded DNA are as follows: crRNA and tracrRNA need to be annealed before use to obtain a complex with a stable secondary structure. CrRNA and tracrRNA were diluted to 5μM, mixed in a 1:1 ratio, and annealing buffer was added to the mixture to a final concentration of 10mM Tris, pH8.0, 100mM NaCl, and then placed in a 95℃ metal bath for denaturation for 3 minutes. The metal bath was immediately closed and allowed to cool naturally to room temperature. The in vitro enzyme digestion reaction used the following system (20μL): 2μL 10×FastDigest Buffer, 2μL Cas9 (5μM), 2μL crRNA and tracrRNA complex (5μM), 12μL enzyme-free water, incubated at 18℃ for 15min in vitro to form an RNP complex, and then 2μL dsDNA (250nM) was added and incubated at 18℃ for 15min. After the reaction was completed, 0.5μL proteinase K was added and the reaction was terminated by incubation at 55℃ for 10min. After the reaction, the enzyme activity of FpCas9 on dsDNA was verified by 1% agarose gel electrophoresis and imaging observation under UV gel imaging. The enzyme cleavage results showed that FpCas9 has the ability to cut exogenous dsDNA ( Figure 3 , Figure 4 ).

[0025] 2. Design of sgRNA adapter for CRISPR / FpCas9 gene editing system (1) Screening of CRISPR / FpCas9-compatible tracrRNA core sequences According to the RNA secondary structure prediction results, tracrRNA sequences of different lengths and full-length crRNA sequences were transcribed in vitro to detect the effects of tracrRNA sequences of different lengths on FpCas9 enzyme activity. The tracrRNA sequences are: tracrRNA(1-99) (SEQ ID NO. 3): UUGUAGUAUUGUACUACAAUUUUGAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUUUAAAGCGGCCUCUAAAGGGUCGCUUUUUUAUUUAG tracrRNA(15-99) (SEQ ID NO. 5): UACAAUUUUGAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUUUAAAGCGGCCUCUAAAGGGUCGCUUUUUUAUUUAG tracrRNA(25-99) (SEQ ID NO. 6): AAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUUUAAAGCGGCCUCUAAAGGGUCGCUUUUUUAUUUAG tracrRNA(27-99) (SEQ ID NO. 7): GCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUUUAAAGCGGCCUCUAAAGGGUCGCUUUUUUAUUUAG tracrRNA(25-93) (SEQ ID NO. 8): AAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUUUAAAGCGGCCUCUAAAGGGUCGCUUUUUU tracrRNA(25-64) (SEQ ID NO. 9): AAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU tracrRNA(25-52) (SEQ ID NO. 10): AAGCAAUUCACAAUAAGGAUUAUUCCGU Full-length crRNA sequence (SEQ ID NO. 2): GCAAAAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUCAAAAUUGUA (the underlined region is the target recognition sequence) The full-length crRNA and tracrRNA of different lengths were diluted to 5 μM, mixed in a 1:1 ratio, and annealing buffer was added to the final concentration of 10 mM Tris, pH 8.0, 100 mM NaCl. Then, the mixture was placed in a 95°C metal bath for denaturation for 3 minutes, and the metal bath was immediately closed to allow it to cool naturally to room temperature. The in vitro enzyme digestion reaction used the following system (20 μL): 2 μL 10×FastDigest Buffer, 2 μL Cas9 (5 μM), 2 μL crRNA and tracrRNA complex (5 μM), 12 μL enzyme-free water, and incubated at 18°C ​​for 15 minutes to form an RNP complex. Then, 2 μL dsDNA (250 nM) was added and incubated at 18°C ​​for 15 minutes for enzyme digestion. After the reaction was completed, 0.5 μL proteinase K was added and the reaction was terminated by incubation at 55°C for 10 minutes. After the reaction was completed, 0.5 μL proteinase K was added and the reaction was terminated by incubation at 55°C for 10 minutes. After the reaction, 1% agarose gel electrophoresis was performed and imaging was performed under a UV gel irradiator to observe the effect of different lengths of tracrRNA on FpCas9 enzyme cleavage activity. The identification results showed that the tracrRNA core fragment was tracrRNA (25-64) ( Figure 5 ).

[0026] (2) Screening of CRISPR / FpCas9 compatible crRNA core sequences The full-length tracrRNA sequences of different lengths were transcribed in vitro to detect the effects of crRNA sequences of different lengths on the activity of FpCas9 enzyme. The crRNA sequences are: crRNA(1-55) (SEQ ID NO. 11): GCAAAAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUCAAAAUUGUA (the underlined region is the target recognition sequence) crRNA(1-50) (SEQ ID NO. 12): GCAAAAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUCAAA (the underlined region is the target recognition sequence) crRNA(1-45) (SEQ ID NO. 13): GCAAAAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUU (the underlined region is the target recognition sequence) crRNA(1-44) (SEQ ID NO. 14): GCAAAAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUU (the underlined region is the target recognition sequence) Full-length tracrRNA sequence (SEQ ID NO. 3): UUGUAGUAUUGUACUACAAUUUUGAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUUUAAAGCGGCCUCUAAAGGGUCGCUUUUUUUAUUUAG The crRNAs of different lengths and full-length tracrRNA were diluted to 5 μM, mixed in a 1:1 ratio, and annealing buffer was added to the final concentration of 10 mM Tris, pH 8.0, 100 mM NaCl. Then, the mixture was placed in a 95°C metal bath for denaturation for 3 minutes, and the metal bath was immediately closed to allow it to cool naturally to room temperature. The in vitro enzyme digestion reaction used the following system (20 μL): 2 μL 10×FastDigest Buffer, 2 μL Cas9 (5 μM), 2 μL crRNA and tracrRNA complex (5 μM), 12 μL enzyme-free water, and incubated at 18°C ​​for 15 minutes to form an RNP complex. Then, 2 μL dsDNA (250 nM) was added and incubated at 18°C ​​for 15 minutes for enzyme digestion. After the reaction was completed, 0.5 μL proteinase K was added and the reaction was terminated by incubation at 55°C for 10 minutes. After the reaction was completed, 0.5 μL proteinase K was added and the reaction was terminated by incubation at 55°C for 10 minutes. After the reaction, 1% agarose gel electrophoresis was used to detect the effect of different lengths of crRNA on FpCas9 enzyme cleavage activity. The identification results showed that the core fragment of crRNA was crRNA (1-45) ( Figure 6 ).

[0027] (3) Design of CRISPR / FpCas9-compatible sgRNA By designing a loop (GAAA), the core fragments of tracrRNA and crRNA were connected to obtain sgRNA suitable for FpCas9 protein. The secondary structure was simulated by online software. The results are as follows Figure 7 shown.

[0028] sgRNA scaffold sequence (SEQ ID NO. 15): GUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU In vitro transcription of sgRNAs with different lengths of spacer sequences (18-30 nt) was performed to verify the optimal length of the spacer sequence for CRISPR / FpCas9 to perform targeted cutting. The sequences of each sgRNA are as follows: 18-sgRNA (SEQ ID NO. 16): UUACUAGGAGCAAUCCUGGUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU (the underlined region is the target recognition sequence) 20-sgRNA (SEQ ID NO. 17): UAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU (the underlined region is the target recognition sequence) 22-sgRNA (SEQ ID NO. 18): AUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU (the underlined region is the target recognition sequence) 24-sgRNA (SEQ ID NO. 19): AUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU (the underlined region is the target recognition sequence) 26-sgRNA (SEQ ID NO. 20): AAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU (the underlined region is the target recognition sequence) 30-sgRNA (SEQ ID NO. 21): GCAAAAAUAUUAUUACUAGGAGCAAUCCUG GUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU (the underlined region is the target recognition sequence) The in vitro enzyme digestion reaction used the following system (20μL): 2μL 10×FastDigest Buffer, 2μL Cas9 (5μM), 2μL sgRNA (5μM), 12μL enzyme-free water, incubated at 18°C ​​for 15min in vitro to form an RNP complex, and then added 2μL dsDNA (250nM), and incubated at 18°C ​​for 15min for enzyme digestion. After the reaction was completed, 0.5μL proteinase K was added and incubated at 55°C for 10min to terminate the reaction. After the reaction, the reaction was detected by 1% agarose gel electrophoresis, and imaging was performed under a UV gel irradiator to observe the effect of different spacer sequence lengths on FpCas9 enzyme digestion activity. The identification results showed that the optimal recognition length of FpCas9 was 20-24nt ( Figure 8 ).

[0029] 3. PAM detection of CRISPR / FpCas9 In vitro PAM depletion experiments were performed, and a 6nt PAM library was constructed and then subjected to in vitro restriction digestion. The depletion value (PPDV) of each PAM sequence after depletion was calculated. For PAM sequence visualization, Weblogo3 was used to sort the top 10% of depleted PAM sequences (ranked by depletion rate, in contrast to PPDVs). The results showed that the PAM of FpCas9 was ANA ( Fig. 9 ).

[0030] 4. CRISPR / FpCas9 gene editing system The present embodiment provides a CRISPR / FpCas9 gene editing system, including an FpCas9 protein and an sgRNA, the amino acid sequence of the FpCas9 protein is shown in SEQ ID NO. 1, the PAM site recognized by the FpCas9 protein is 5'-ANA-3', and N represents any one of A, G, C, and T. The sgRNA includes a Spacer sequence and an sgRNA scaffold sequence from the 5' end to the 3' end, the Spacer sequence is complementary to the target DNA sequence, and the 3' end adjacent to the target DNA sequence has a PAM site. The sgRNA scaffold sequence includes a first segment and a second segment from the 5' end to the 3' end, and the first segment and the second segment are connected by GAAA. The first segment is selected from the first sequence shown in SEQ ID NO. 22 or a truncated sequence of the first sequence, and the truncated sequence of the first sequence includes the core sequence of the first sequence shown in SEQ ID NO. 23. The second segment is selected from the second sequence or a truncated sequence of the second sequence, the truncated sequence of the second sequence comprises the core sequence of the second sequence, the second sequence is the full-length sequence of tracrRNA shown in SEQ ID NO. 3, and the core sequence of the second sequence is the sequence shown in SEQ ID NO. 9.

[0031] In a specific embodiment, the truncated sequence of the first sequence is selected from the sequence shown in SEQ ID NO. 24 or SEQ ID NO.25.

[0032] In a specific embodiment, the truncated sequence of the second sequence is selected from the truncated sequence of tracrRNA shown in SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 or SEQ ID NO. 9.

[0033] As a preferred embodiment, the sgRNA scaffold sequence of the present invention is shown in SEQ ID NO. 15.

[0034] First sequence (SEQ ID NO. 22): GUUGUGAAUUGCUUUCAAAAUUGUA Core sequence of the first sequence (SEQ ID NO. 23): GUUGUGAAUUGCUUU Truncated sequence of the first sequence SEQ ID NO. 24: GUUGUGAAUUGCUUUCAAAA Truncated sequence of the first sequence SEQ ID NO. 25: GUUGUGAAUUGCUUU Example 2: In vitro enzyme digestion test of exogenous dsDNA by CRISPR / FpCas9 gene editing system at different temperatures This example conducts an in vitro enzyme digestion test of exogenous dsDNA using the CRISPR / FpCas9 gene editing system of the present invention at different temperatures.

[0035] In this example, the target double-stranded DNA is selected as zebrafish Caspy2Gene, whose sequence is (SEQ ID NO. 26): GGCTTTAGGTTGGGGTTAGTGTAAGTTGGCATGTACTTGCAAAGTTTCTTATAGTCTGTTAAATGTCATCAGTATCAGCAGATATTAAGCCGACAGTCTACTAATACTCAAATGGACCAACACAATAAAGTGATATCATTTTTTGAGCTGGCAGATTCATCAGTAATCCGCCAGCTCTGCACACTGCGAGGCAATCTTAAGGGTTCTGATTCGGTTTATTTAATGTAATCTTGTGTAATTCTGATTTGTTTCTGTATAGATTTACACACCGAGGAGCGGGACTCAAAGGAAAGGCTTGGCTCTGTTGATCACCAACATACAATTCGCCAATACACAACACAACCGAAACGGAGCGGACAGAGACGAGGAGAACGCGGAGTGGCTGCTGAGATCTCTGGGCTTCGCAGTTATAAAATACAGAAATCTCAGTGGAAAAGTGCGTAAGATTTATAAATCTCCCTGATAAAAGAGGGAATGAATGAATGTTTGTTGTTAACTCCCCCTTTTAAAGTGGGCTGTTTGCTATACCAAGCATTATTAAAATATTATATTAATTTTCAGGACATCAGGAGAGCAGTCGAGAATTTCTCTAAACGTCGTGAACATGAAGACGCAGACAGCACCTTTATCGTCATCATGTCTCACGGGACTAGAATTGACAATAAAGATGCCATTGTAGGTGTCAGTGACGACGTCTACTTTATTGAAGAAACTTTCTCCCATCTGAACTCTGTGAACTG FpCas9 sgRNA sequence (PAM - ANA) (SEQ ID NO. 27): TCGCAGTTATAAAATACAGAAATCTCA GTG GUUGUGAAUUGCUUUGAAAAAGCAAUUCACAAUAAGGAUUAUUCCGUUGUGAAAACAUU (underlined region is the target recognition sequence) SpCas9 sgRNA sequence (PAM - NGG) (SEQ ID NO. 28): ACAACACAACCGAAACGGAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUCACAA (the underlined region is the target recognition sequence) PCR amplification of Caspy2 double-stranded DNA was performed using primers PCR-Caspy2-F (SEQ ID NO. 29): GGCTTTAGGTTGGGGTTAGT, PCR-Caspy2-R (SEQID NO. 30): CAGTTCACAGAGTTCAGATGGG. The in vitro cleavage reaction used the following system: 2μL 10×FastDigest Buffer, 12μL enzyme-free water, 2μL sgRNA (5μM), 2μL Cas9 (5μM), incubated at 18℃ for 15min to form an RNP complex, and then 2μL dsDNA (250nM) was added and subjected to enzyme cleavage at different temperatures for 15min. The cleavage activity of commercial SpCas9 was tested at different temperatures (5℃, 10℃, 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃) for 15min, and the results showed that the in vitro cleavage range of SpCas9 was 5-45℃. Then, the cleavage activity of FpCas9 on the same target was tested at different temperatures (5°C, 10°C, 15°C, 18°C, 20°C, 25°C, 30°C, 35°C, 40°C) for 15 minutes. The results showed that the CRISPR / FpCas9 system had a good cleavage effect at 5-35°C, and was significantly better than the commercial SpCas9 at 5-25°C. Fig.10 ).

[0036] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A sgRNA, characterized in that: It includes a Spacer sequence and an sgRNA scaffold sequence from the 5' end to the 3' end, the Spacer sequence is complementary to the target DNA sequence, and there is a PAM site adjacent to the 3' end of the target DNA sequence, the PAM site is 5'-ANA-3', N represents any one of A, G, C, and T, and the sgRNA scaffold sequence includes a first segment and a second segment from the 5' end to the 3' end, the first segment and the second segment are connected by GAAA, the first segment is selected from the first sequence shown in SEQ ID NO. 22 or a truncated sequence of the first sequence, the truncated sequence of the first sequence includes the core sequence of the first sequence shown in SEQ ID NO. 23, the second segment is selected from the second sequence shown in SEQ ID NO. 3 or a truncated sequence of the second sequence, and the truncated sequence of the second sequence includes the core sequence of the second sequence shown in SEQ ID NO.

9.

2. The sgRNA according to claim 1, characterized in that The length of the Spacer sequence is 20-30 nt.

3. The sgRNA according to claim 1, characterized in that The truncated sequence of the first sequence is selected from the sequence shown in SEQ ID NO. 23, SEQ ID NO. 24 or SEQ ID NO. 25; And / or, the truncated sequence of the second sequence is selected from the sequence shown in SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 or SEQ ID NO.

9.

4. The sgRNA according to claim 1, characterized in that The sgRNA scaffold sequence is shown in SEQ ID NO.

15.

5. A CRISPR / FpCas9 gene editing system, characterized in that: It includes an FpCas9 protein and the sgRNA according to claim 1, the amino acid sequence of the FpCas9 protein is shown in SEQ ID NO. 1, the PAM site recognized by the FpCas9 protein is 5'-ANA-3', and N represents any one of A, G, C, and T.

6. The CRISPR / FpCas9 gene editing system according to claim 5, characterized in that The cutting temperature of the CRISPR / FpCas9 gene editing system is 5-25°C.

7. A polynucleotide, characterized in that It is any of the following polynucleotides: (1) a polynucleotide encoding the sgRNA according to claim 1; (2) a polynucleotide encoding the sgRNA of claim 1 and the FpCas9 protein of claim 5; (3) A composition comprising a polynucleotide encoding the sgRNA of claim 1 and a polynucleotide encoding the FpCas9 protein of claim 5.

8. An expression vector, characterized in that It is any of the following expression vectors: (1) an expression vector containing a polynucleotide encoding the sgRNA according to claim 1; (2) an expression vector containing a polynucleotide encoding the sgRNA of claim 1 and the FpCas9 protein of claim 5; (3) A composition comprising an expression vector containing a polynucleotide encoding the sgRNA according to claim 1, and an expression vector containing a polynucleotide encoding the FpCas9 protein according to claim 5.

9. Use of the CRISPR / FpCas9 gene editing system according to claim 5 in gene editing.

10. A method for gene editing, characterized in that: The CRISPR / FpCas9 gene editing system of claim 5 is constructed, wherein the sgRNA guides the FpCas9 protein to bind to the target DNA sequence to achieve gene editing; the cutting temperature of the CRISPR / FpCas9 gene editing system is 5-25°C.

11. The method according to claim 10, characterized in that The expression vector described in claim 8 is used to construct the CRISPR / FpCas9 gene editing system described in claim 5.

Images