Method for producing useful substance, animal cell, method for producing animal cell, and kit

Abstract

The present invention addresses the problem of providing: a method for producing useful substances in animal cells, the method increasing the expression of a target gene; animal cells in which the expression of the target gene is increased; a method for producing such animal cells; and a kit for expressing the target gene in animal cells. The present invention provides a method for producing useful substances, the method comprising: introducing into animal cells (A) a nucleic acid containing (a) an exogenous target gene encoding the useful substance, (b) an exogenous constitutive promoter, and (c) a recognition sequence to which a binding substance can bind, and (B) a complex of three or more transcriptional activators and a binding substance, or a nucleic acid encoding the complex; and culturing the resulting animal cells.

Description

Method for producing useful substances, animal cells, method for producing animal cells, and kit

[0001] The present invention relates to a method for producing a useful substance using an animal cell having an exogenous gene of interest encoding the useful substance. The present invention further relates to an animal cell having an exogenous gene of interest encoding the useful substance, a method for producing the animal cell, and a kit for expressing the gene of interest in the animal cell.

[0002] Introducing an exogenous gene of interest encoding a useful substance into animal cells and expressing the gene in the animal cells to produce the useful substance is widely practiced in the production of antibody drugs, gene therapy drugs, etc. When expressing an exogenous gene of interest in animal cells, high expression of the gene of interest is achieved by operably linking an exogenous constitutive promoter to the gene of interest and expressing the gene of interest.

[0003] Patent Document 1 describes a hybrid promoter that combines a CMV (cytomegalovirus) enhancer with a mammalian β-actin promoter, or a posttranscriptional regulatory region (WPRE) of the Woodchuck Hepatitis Virus genome sequence with a mammalian β-actin promoter. Patent Document 1 further describes that the activity of this β-actin promoter is enhanced by simultaneous expression of Ras, an oncogene product that acts as a transactivator.

[0004] A known technique for activating promoters with low activity within cells is transactivation technology, which uses artificial transcription factors to activate promoters. A representative example of this transactivation technology is the Tet system.

[0005] Patent document 2 describes a nucleic acid encoding an inhibitor fusion protein comprising (a) a first polypeptide that is a tet repressor that binds to a tet operator sequence in the absence of tetracycline or a tetracycline analog but not in the presence of tetracycline or a tetracycline analog, and (b) a heterologous second polypeptide that inhibits transcription in eukaryotic cells, and describes the use of a transcription activator and an inhibitor fusion protein in combination to regulate the expression of one or more tet operator-linked genes.

[0006] Patent Document 3 describes an inducible transcription control sequence for regulating gene expression. Specifically, Patent Document 3 describes a transcription control sequence that includes at least two tet operator sequence motifs that enable binding of a tetracycline-dependent transcription regulator, and a minimal promoter that combines a TATA box with a general transcription factor binding site at its 5' end.

[0007] JP 2012-70744 A Japanese Patent No. 4820344 A Japanese Patent No. 5576382 A

[0008] An object of the present invention is to provide a method for producing a useful substance in an animal cell containing a target gene and an exogenous constitutive promoter operably linked to the target gene, which method can further increase the expression level of the target gene.Further object of the present invention is to provide an animal cell containing a target gene and an exogenous constitutive promoter operably linked to the target gene, wherein the expression level of the target gene is increased; a method for producing the animal cell; and a kit for expressing the target gene in the animal cell.

[0009] As a result of extensive research aimed at solving the above problems, the present inventors have found that the above problems can be solved by introducing into animal cells (A) a nucleic acid comprising a gene of interest, an exogenous constitutive promoter, and a recognition sequence, and (B) a complex of three or more transcriptional activators and binding substances, or a nucleic acid encoding said complex. The present invention was completed based on the above findings.

[0010] The present invention provides the following: <1> A method for producing a useful substance, comprising introducing into an animal cell: (A) (a) an exogenous gene of interest encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the gene of interest, and (c) a nucleic acid present within or near the sequence of the constitutive promoter and comprising a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid encoding the complex; and culturing the resulting animal cell. <2> The production method according to <1>, wherein the transcriptional activator is one or more of VP16, P65, Rta, HSF1, activation domains thereof, or variants thereof. <3> The production method according to <1> or <2>, wherein the constitutive promoter is a promoter of a housekeeping gene or a gene whose expression level is in the top 10% of the cells. <4> The production method according to any one of <1> to <3>, wherein the constitutive promoter is a promoter selected from promoters that drive a gene selected from Ef1α, Gapdh, Actb, UbC, a ribosomal component gene, or an Nfkb complex component gene. <5> The production method according to any one of <1> to <4>, wherein the constitutive promoter is a promoter having the nucleotide sequence set forth in SEQ ID NO: 4, or a promoter that has 80% or more sequence identity within any 300 nucleotides of the nucleotide sequence set forth in SEQ ID NO: 4 and has promoter activity equivalent to or greater than that of the promoter of the nucleotide sequence set forth in SEQ ID NO: 4. <6> The production method according to any one of <1> to <5>, wherein the binding substance is selected from the group consisting of sequence-specific nucleases, restriction enzymes, transcriptional regulators, sequence-specific recombinases, RNA-induced nuclease complexes, and variants thereof that have reduced or deleted functions other than DNA binding activity. <7> The method according to any one of <1> to <6>, wherein the binding substance is Gal4, Cre recombinase, or rtTA / tTA. <8> The method according to any one of <1> to <7>, wherein the recognition sequence has a sequence length of 10 bp or more. <9> The method according to any one of <1> to <8>, wherein the recognition sequence has 1 to 10 recognition sequences.<10> The production method according to any one of <1> to <9>, wherein the binding substance is Cre recombinase and the recognition sequence is loxP or a modified version thereof. <11> The production method according to any one of <1> to <10>, wherein the target gene is a gene encoding an antibody or a gene capable of expressing a recombinant viral vector containing a therapeutic gene. <12> The production method according to any one of <1> to <11>, wherein the target gene includes two or more genes, each of which is operably linked to an exogenous constitutive promoter, and wherein a recognition sequence is present within or near the sequence of at least one of the constitutive promoters. <13> The production method according to <12>, wherein a recognition sequence is present within or near two or more sequences of the constitutive promoter. <14> The production method according to any one of <1> to <13>, wherein the culturing of animal cells is carried out in a bioreactor. <15> An animal cell having (A) (a) an exogenous gene of interest encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the gene of interest, and (c) a nucleic acid present within or near the sequence of the constitutive promoter and comprising a recognition sequence to which a binding substance can bind, and (B) a complex of three or more transcription activators and the binding substances, or a nucleic acid encoding the complex. <16> The animal cell according to <15>, wherein the transcription activator is one or more of VP16, P65, Rta, HSF1, activation domains thereof, or variants thereof. <17> The animal cell according to <15> or <16>, wherein the constitutive promoter is a promoter of a housekeeping gene or a gene whose expression level is in the top 10% in the cell. <18> The animal cell according to any one of <15> to <17>, wherein the constitutive promoter is selected from promoters that drive a gene selected from Ef1α, Gapdh, Actb, UbC, a ribosome component gene, or an Nfkb complex component gene.<19> The animal cell according to any one of <15> to <18>, wherein the constitutive promoter is a promoter having the nucleotide sequence set forth in SEQ ID NO: 4, or a promoter having 80% or more sequence identity with any 300 nucleotides of the nucleotide sequence set forth in SEQ ID NO: 4 and having promoter activity equivalent to or greater than that of the promoter of the nucleotide sequence set forth in SEQ ID NO: 4. <20> The animal cell according to any one of <15> to <19>, wherein the binding substance is selected from the group consisting of sequence-specific nucleases, restriction enzymes, transcriptional regulators, sequence-specific recombinases, RNA-induced nuclease complexes, and variants thereof in which functions other than DNA binding activity are attenuated or deleted. <21> The animal cell according to any one of <15> to <20>, wherein the binding substance is Gal4, Cre recombinase, or rtTA / tTA. <22> The animal cell according to any one of <15> to <21>, wherein the sequence length of the recognition sequence is 10 bp or more. <23> The animal cell according to any one of <15> to <22>, having 1 to 10 recognition sequences as the recognition sequences. <24> The animal cell according to any one of <15> to <23>, wherein the binding substance is Cre recombinase and the recognition sequence is loxP or a modified version thereof. <25> The animal cell according to any one of <15> to <24>, wherein the target gene is a gene encoding an antibody or a gene capable of expressing a recombinant viral vector containing a therapeutic gene. <26> The animal cell according to any one of <15> to <25>, wherein the target gene comprises two or more genes, each of which is operably linked to an exogenous constitutive promoter, and wherein a recognition sequence is present within or near the sequence of at least one of the constitutive promoters. <27> The animal cell according to <26>, wherein a recognition sequence is present within or near two or more sequences of the constitutive promoter.<28> A method for producing an animal cell according to any one of <15> to <27>, comprising introducing into an animal cell: (A) (a) an exogenous gene of interest encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the gene of interest, and (c) a nucleic acid present within or near the sequence of the constitutive promoter and comprising a recognition sequence to which a binding substance can bind, and (B) a complex of three or more transcription activators and the binding substance, or a nucleic acid encoding the complex. <29> A kit for expressing a gene of interest in an animal cell, comprising: (A) (a) an exogenous gene of interest encoding a useful substance or a cloning site for inserting the gene of interest, (b) an exogenous constitutive promoter linked upstream of the gene of interest or the cloning site, and (c) a nucleic acid present within or near the sequence of the constitutive promoter and comprising a recognition sequence to which a binding substance can bind, and (B) a complex of three or more transcription activators and the binding substance, or a nucleic acid encoding the complex. <30> A method for producing a useful substance, comprising: introducing into an animal cell (A) (a) two or more exogenous target genes encoding useful substances, (b) exogenous constitutive promoters operably linked to each of the target genes, and (c) a nucleic acid which is present within or in the vicinity of each of the constitutive promoters linked to each of the target genes and which comprises a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcription activation factors or transcription activation domains with the binding substances, or a nucleic acid encoding the complex, thereby enabling enhanced expression of the one or more target genes or enabling balanced regulation of the expression of the two or more target genes in the animal cell, and culturing the obtained animal cell.

[0011] According to the present invention, in a method for producing a useful substance in an animal cell containing a target gene and an exogenous constitutive promoter operably linked to the target gene, the expression level of the target gene can be increased.

[0012] Figure 1 shows the construction of Plasmid A and Plasmid B. Figure 2 shows the results of measuring protein expression levels (red fluorescence intensity) in Experiment 1. Figure 3 shows a schematic diagram of Plasmids C1-C8. Figure 4 shows the results of measuring the cellular distribution of red fluorescence intensity in Experiment 2. Figure 5 shows the results of measuring protein expression levels in Experiment 2. Figure 6 shows a schematic diagram of Plasmid D, Plasmid E, and Plasmid F. Figure 7 shows the results of measuring the cellular distribution of red fluorescence intensity in Experiment 3. Figure 8 shows a schematic diagram of Plasmid G, Plasmid H, and Plasmid I. Figure 9 shows a schematic diagram of plasmids Plasmid J (G0), (G1), and (G3). Figure 10 shows a schematic diagram of plasmids Plasmid K (R0), (R1), and (R3). Figure 11 shows a schematic diagram of Plasmid L.

[0013] An example of an embodiment of the present disclosure will be described below. However, the present disclosure is not limited to the following embodiment in any way, and can be implemented with appropriate modifications within the scope of the object of the present disclosure. In this specification, a numerical range indicated using "to" means a range that includes the numerical values ​​written before and after "to" as the minimum and maximum values, respectively.

[0014] Nucleic acids are linear polynucleotides formed by polymerization of nucleotides, each of which consists of a purine or pyrimidine base, a sugar, and phosphate, with the phosphates forming diester bonds between the 3' and 5' carbon atoms of the sugar between each nucleotide. Based on the sugar moiety, nucleic acids are broadly classified into deoxyribonucleic acid (DNA), in which the sugar moiety is deoxyribose, and ribonucleic acid (RNA), in which the sugar moiety is ribose. Nucleic acids may be any of genes, DNA (linear DNA or cyclic DNA), RNA, oligonucleotides, and polynucleotides. In this specification, the terms "nucleic acid" are used interchangeably with "gene," "DNA," "RNA," "oligonucleotide," and "polynucleotide."

[0015] The present invention relates to a method for producing a useful substance, comprising introducing into an animal cell: (A) (a) an exogenous target gene encoding a useful substance; (b) an exogenous constitutive promoter operably linked to the target gene; and (c) a nucleic acid that is present within or near the sequence of the constitutive promoter and includes a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid encoding the complex; and culturing the obtained animal cell.

[0016] The present invention further relates to an animal cell having (A) (a) an exogenous gene of interest encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the gene of interest, and (c) a nucleic acid present within or near the sequence of the constitutive promoter and comprising a recognition sequence to which a binding substance can bind, and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid encoding the complex.

[0017] <Constitutive Promoter> In the present invention, an exogenous constitutive promoter is used that is operably linked to the gene of interest.

[0018] "Exogenous" means introduced into a cell from outside the cell. A constitutive promoter is a promoter that can express a gene under its control regardless of the cell culture conditions. A constitutive promoter is preferably a promoter that can express a gene placed downstream of the promoter without using an inducer such as IPTG. "Operably linked" means that the promoter is linked so that the target gene to be expressed can be expressed under its control.

[0019] Constitutive promoters are preferably promoters of housekeeping genes or genes with expression levels in the top 10% of cells, more preferably promoters of housekeeping genes or genes with expression levels in the top 5% of cells. Specific examples of constitutive promoters include, but are not limited to, promoters selected from promoters that drive genes selected from Ef1α, Gapdh, Actb, UbC, ribosomal component genes, and Nfkb complex component genes.

[0020] As the constitutive promoter, a promoter that drives the Ef1α gene is particularly preferred. As the constitutive promoter, a promoter having the nucleotide sequence set forth in SEQ ID NO: 4, or a promoter that has 80% or more (preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, and particularly preferably 97% or more) sequence identity with any 300 nucleotides of the nucleotide sequence set forth in SEQ ID NO: 4 and has promoter activity equivalent to or greater than that of the promoter of the nucleotide sequence set forth in SEQ ID NO: 4 may be used.

[0021] <Recognition Sequence> In the present invention, a recognition sequence is used that is present within or near the sequence of a constitutive promoter and to which a binding substance can bind. The length of the recognition sequence is preferably 10 bp or more, more preferably 15 to 100 bp, and more preferably 20 to 50 bp.

[0022] The number of recognition sequences is not particularly limited, but 1 to 10 recognition sequences, 1 to 6 recognition sequences, or 1 to 3 recognition sequences may be used.

[0023] The recognition sequence is a sequence to which the binding substance can bind. That is, when the binding substance is a sequence-specific nuclease, a restriction enzyme, a transcriptional regulator, a sequence-specific recombinase, or an RNA-induced nuclease complex, a sequence that each of them recognizes and binds to can be selected and used. For example, when Cre recombinase is used as the binding substance, examples of the recognition sequence include loxP or a variant thereof.

[0024] <Transcriptional Activator> In the present invention, a complex of three or more transcriptional activators and a binding substance, or a nucleic acid encoding the complex, is used.

[0025] A transcription activator refers to a polypeptide that binds to DNA in or near a promoter region and promotes mRNA synthesis (transcription) by RNA polymerase. In the present invention, three or more transcription activators are used, preferably three to ten transcription activators, and more preferably three to six transcription activators. Specific examples of transcription activators include, but are not limited to, one or more of VP16, P65, Rta, HSF1, their activation domains, or variants thereof.

[0026] VP16 is herpes simplex virion protein 16. VP48, which is composed of three copies of VP16 linked together, and VP64, which is composed of four copies of VP16 linked together, are known. In the present invention, activators composed of multiple VP16s, such as VP48 or VP64, can also be used. P65 is a protein with a molecular weight of approximately 65,000, which is one of the proteins that constitute NF-κB. Rta is a hydrophobic transactivator domain derived from Epstein-Barr virus that binds to enhancer regions and promotes the expression of several viral genes. HSF1 is a transcription factor (heat shock transcription factor 1) that binds to heat shock elements in the promoter regions of heat shock genes and regulates the expression of heat shock proteins.

[0027] In the present invention, a combination of VP32, which is formed by linking two copies of VP16, and HSF1 can be used. In the present invention, an artificial transcription factor VPR, which is formed by linking VP64, which is formed by linking four copies of VP16, P65, and Rta in tandem, can also be used.

[0028] <Binding Substance> A binding substance refers to a substance that can recognize and bind to a specific base sequence. Examples of the binding substance in the present invention include those selected from the group including sequence-specific nucleases, restriction enzymes, transcriptional regulators, sequence-specific recombinases, RNA-induced nuclease complexes, and variants thereof in which functions other than DNA binding activity are attenuated or deleted. The binding substance is preferably Gal4, Cre recombinase, or rtTA / tTA.

[0029] Gal4 is a yeast-derived transcription factor that specifically binds to DNA sequences (UAS). Cre recombinase is an enzyme that catalyzes DNA recombination reactions, binding to DNA sequences (loxP) and causing site-specific recombination. tTA (tetracycline transactivator) is a fusion protein of TetR and the VP16 transcription activation domain (VP16AD) derived from herpesvirus, and activates downstream promoters when it binds to the tetO sequence. rtTA (reverse tetracycline transactivator) is a fusion protein of reverse TetR (rTetR), created by partially modifying the amino acid residues of TetR, and VP16AD. Contrary to tTA, it binds to doxycycline, binding to the tetO sequence and activating downstream promoters. In one example of the present invention, Cre recombinase can be used as the binding substance, and loxP or a variant thereof can be used as the recognition sequence.

[0030] <Introduction of Nucleic Acid into Animal Cells> The method for introducing into animal cells (a) an exogenous gene of interest encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the gene of interest, and (c) a nucleic acid containing a recognition sequence within or near the sequence of the constitutive promoter to which a binding substance can bind, as well as the method for introducing into animal cells a complex of three or more transcriptional activators and the binding substances, or a nucleic acid encoding the complex, are not particularly limited and can be carried out by conventional methods. Specific examples include a method using a gene introduction reagent such as a cationic polymer, or electroporation. The cationic polymer is not particularly limited, but may be, for example, one or a combination selected from the group consisting of chitosan, poly-L-lysine (pLL), polyamine (PA), polyalkyleneimine (PAI), polyethyleneimine (PEI), poly[α-(-aminobutyl)-L-glycolic acid], polyamidoamine, poly(2-dimethylamino)ethyl methacrylate, polyhistidine, polyarginine, poly(4-vinylpyridine), poly(vinylamine), and poly(4-vinyl-N-alkylpyridinium halide). Polyamine is preferred as the cationic polymer, with polyethyleneimine (PEI) being particularly preferred. The electroporation method is not particularly limited, but 4D-Nucleofector (LONZA) or the like may also be used.

[0031] <Animal Cells> The animal cells used in the present invention may be any of isolated cells, cells contained in isolated tissue derived from a living body, and cultured cells. When the animal cells are isolated cells or cultured cells, the cells may be either adhesive cells or non-adherent cells.

[0032] The animal cells are not particularly limited, but are preferably mammalian cells or insect cells, more preferably mammalian cells. Examples of mammalian cells include, but are not particularly limited to, human cells, mouse cells, rat cells, monkey cells, and hamster cells. Preferably, human cells or hamster cells can be used. Examples of cells include mouse myeloma (NS0) cell lines, Chinese hamster ovary (CHO) cell lines, HT1080, H9, HepG2, MCF7, MDBK Jurkat, NIH3T3, PC12, BHK (baby hamster kidney cells), VERO, SP2 / 0, YB2 / 0, YO, C127, L cells, COS (e.g., COS1 and COS7), QC1-3, HEK cells (Human Embryonic Kidney cells) (e.g., HEK293), VERO, PER. C6, HeLa, EB1, EB2, EB3, oncolytic or hybridoma cell lines. Preferably, the animal cells are HEK or CHO cells.

[0033] <Useful Substance> The useful substance is not particularly limited, but examples thereof include proteins and viral vectors. The useful substance is preferably a protein. The produced protein or viral vector may be used, for example, as a pharmaceutical active ingredient.

[0034] The protein is preferably a recombinant protein, including, for example, a recombinant polypeptide chain, a recombinant secreted polypeptide chain, an antigen-binding protein, an antibody (e.g., a human antibody, a humanized antibody, a chimeric antibody, a murine antibody, a bispecific antibody, a multispecific antibody, etc.), an Fc fusion protein, a fragmented immune immunoglobulin, a single-chain antibody (scFv), etc.

[0035] The protein is preferably an antibody, more preferably a human antibody, a humanized antibody, a chimeric antibody, or a mouse antibody. Examples of fragmented immunoglobulins include Fab, F(ab')2, and Fv. The class of the antibody is not particularly limited, and may be any class, such as IgG (e.g., IgG1, IgG2, IgG3, and IgG4), IgA, IgD, IgE, or IgM, although IgG and IgM are preferred for pharmaceutical use.

[0036] Human antibodies include all antibodies that have one or more variable and constant regions derived from human immunoglobulin sequences, hi one embodiment, all of the variable and constant domains are derived from human immunoglobulin sequences (fully human antibodies).

[0037] A humanized antibody has a sequence that differs from that of an antibody derived from a non-human species by one or more amino acid substitutions, deletions, and / or additions, such that the humanized antibody is less likely to provoke an immune response and / or provokes a less severe immune response when administered to a human subject compared to the non-human species antibody. In one example, certain amino acids within the framework and constant domains of the heavy and / or light chains of the non-human species antibody are mutated to produce a humanized antibody. In another example, a constant domain from a human antibody is fused to a variable domain of a non-human species.

[0038] A chimeric antibody is an antibody in which variable and constant regions of different origins are linked. For example, an antibody consisting of the heavy and light chain variable regions of a mouse antibody and the heavy and light chain constant regions of a human antibody is a mouse-human heterochimeric antibody. A recombinant vector that expresses a chimeric antibody can be produced by linking DNA encoding the variable region of a mouse antibody to DNA encoding the constant region of a human antibody and incorporating this into an expression vector. Recombinant cells transformed with the vector can be cultured to express the incorporated DNA, thereby obtaining the chimeric antibody produced during the culture.

[0039] A bispecific antibody refers to an antibody that can simultaneously bind to two different epitopes. A multispecific antibody refers to an antibody that can simultaneously bind to two or more different epitopes. There are no restrictions on the structure of a bispecific antibody or the number of epitope-binding sites. There are no restrictions on the structure of a multispecific antibody or the number of epitope-binding sites. An example of a multispecific antibody is a bispecific antibody.

[0040] An example of a bispecific antibody (a four-subunit type having four different subunits) is a bispecific antibody consisting of a first H chain, a second H chain, a first L chain that binds to the first H chain, and a second L chain that binds to the second H chain. The first H chain and the second H chain are different, and the first L chain and the second L chain are different. An example of this bispecific antibody is a tetramer consisting of one first H chain, one second H chain, one first L chain, and one second L chain.

[0041] Another example of a bispecific antibody (a three-subunit type having three different subunits) is a bispecific antibody consisting of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain. The L chain common to two types of H chains refers to one type of L chain that pairs with two types of H chains. One example of this bispecific antibody is a tetramer in which one first H chain, one second H chain, and two L chains are connected by disulfide bonds. Each of the first H chain, second H chain, and L chain need only contain at least a region for recognizing an antigen and a region for forming an antibody.

[0042] Further examples of bispecific antibodies include bispecific antibodies consisting of an H chain, an L chain, and an scFv-Fc. An scFv is a fusion protein of the heavy chain variable region and light chain variable region of an immunoglobulin, and an scFv-Fc is a fusion protein of an scFv and an Fc region. One example of this bispecific antibody is a trimer in which one H chain, one L chain, and one scFv-Fc are connected by disulfide bonds.

[0043] The antigen and structure of a bispecific antibody are not limited as long as it has an arm that recognizes a first antigen and an arm that recognizes a second antigen. Examples of bispecific antibodies include emicizumab, blinatumomab, vanucizumab, istiratumab, pasotuxizumab, durigotuzumab, duvortuxizumab, and faricimab.

[0044] Another example of a multispecific antibody (a five-subunit type having five different subunits) is one in which the first H chain is composed of, from the N-terminus, Fab domain 1, Fc domain 1, and Fab domain 2, and the second H chain is composed of, from the N-terminus, Fab domain 3 and Fc domain 2. The first L chain binds to Fab domain 1 of the first H chain, the second L chain binds to Fab domain 2 of the first H chain, and the third L chain binds to Fab domain 3 of the second H chain to form a complex. In this example, the formation of a total of three Fab domains from the H chain and L chain results in a trispecific antibody having three antigen-binding regions.

[0045] An Fc fusion protein refers to a protein having an Fc region, including antibodies. Fab is a monovalent fragment having VL, VH, CL, and CH1 domains. F(ab')2 is a bivalent fragment having two Fab fragments linked by a disulfide bridge at the hinge region. An Fv fragment has the VL and VH domains of a single antibody arm. A single-chain antibody (scFv) is an antibody in which the VL and VH domains are joined via a linker (e.g., a synthetic sequence of amino acid residues) to form a continuous protein chain, where the linker is long enough to allow the protein chain to fold back on itself and form a monovalent antigen-binding site.

[0046] The antibody is not particularly limited, but examples thereof include an anti-IL-6 receptor antibody, an anti-IL-6 antibody, an anti-glypican-3 antibody, an anti-CD3 antibody, an anti-CD20 antibody, an anti-GPIIb / IIIa antibody, an anti-TNF antibody, an anti-CD25 antibody, an anti-EGFR antibody, an anti-Her2 / neu antibody, an anti-RSV antibody, an anti-CD33 antibody, an anti-CD52 antibody, an anti-IgE antibody, an anti-CD11a antibody, an anti-VEGF antibody, and an anti-VLA4 antibody.

[0047] The virus refers to a virus that introduces nucleic acid into cells to produce the virus. Examples of the virus include adeno-associated virus, lentivirus, baculovirus, and retrovirus, and among these, adeno-associated virus is preferred.

[0048] Adeno-associated virus (AAV) refers to a small, replication-incompetent, non-enveloped virus of the Parvoviridae and Dependoparvovirus families, containing a single-stranded DNA consisting of approximately 4,700 bases. There are over 100 AAV serotypes, and it is known that the host range and viral characteristics differ depending on the serotype. Serotype 2 (AAV2) is one of the serotypes that has been widely studied for a long time and is known to have a very wide host range. Serotype 1 (AAV1), serotype 5 (AAV5), and serotype 6 (AAV6) are serotypes with higher tissue tropism. AAV1 is said to have high gene transfer efficiency in muscles, liver, respiratory tract, central nervous system, etc.; AAV5 is said to have high gene transfer efficiency in the central nervous system, liver, retina, etc.; and AAV6 is said to have high gene transfer efficiency in heart, muscles, liver, etc. In the present invention, serotype 2 or serotype 5 is preferably used. Serotype 5 is particularly preferred.

[0049] Adeno-associated virus genes refer to genes composed of one or more nucleic acid sequences derived from one or more adeno-associated virus serotypes, and are preferably genes involved in AAV replication and packaging, and genes encoding AAV structural proteins.

[0050] AAV is a non-enveloped virus that grows in the presence of helper viruses such as adenovirus and herpesvirus.When preparing AAV for gene therapy or nucleic acid transfer, traditionally, adenovirus is co-infected into host cells to allow AAV replication.In addition, the gene responsible for the helper function of adenovirus has been identified, and the plasmid carrying this gene is also used.For example, a plasmid containing Rep gene and Cap gene, an adenovirus helper plasmid, and a plasmid containing therapeutic or preventive gene can be simultaneously transfected into cells, and then packaged into recombinant AAV (rAAV).

[0051] The Rep and Cap genes encode proteins involved in virion replication and packaging. In the wild type, the Rep gene is expressed from the P5 promoter and p19 promoter. The Cap region expresses VP1, VP2, and VP3. An example of a promoter naturally contained in the Cap gene is the p40 promoter. In the present invention, the above-mentioned exogenous constitutive promoter may be used as a promoter for expressing the Rep and Cap genes.

[0052] The adeno-associated virus genes (such as the Rep gene and the Cap gene) may be wild-type genes, but genes that have been modified by base substitution, deletion, insertion, or addition, etc., may also be used, as long as they exhibit their original functions.

[0053] When the Rep gene and the Cap gene are introduced into cells as foreign target genes encoding useful substances, a vector containing the Rep gene and the Cap gene can be introduced into the cells. The Rep gene refers to a region of the AAV genome that encodes viral replication proteins collectively required for viral genome replication, as known to those skilled in the art, or a functional homolog thereof, such as the human herpesvirus 6 (HHV-6) Rep gene (known to mediate AAV-2 DNA replication). The Cap gene refers to a region of the AAV genome that encodes viral capsid proteins, as known to those skilled in the art.

[0054] As a vector containing the Rep gene and the Cap gene, for example, a plasmid, a nucleic acid sequence derived from a virus, an artificially designed nucleic acid, etc. can be used, and a plasmid is preferred.

[0055] In the present invention, a therapeutic or preventive gene may be introduced into a cell as an exogenous target gene encoding a useful substance. The therapeutic or preventive gene may be, but is not limited to, a gene that is incomplete or missing in the genome of the target cell, or a gene encoding a non-natural protein with a desired biological or therapeutic effect (e.g., antiviral function). Specific examples of therapeutic or preventive genes include genes used to treat or prevent inflammatory diseases, autoimmune diseases, chronic and infectious diseases (including disorders such as AIDS, cancer, nervous system diseases, cardiovascular diseases, and hypercholesterolemia), various blood diseases such as anemia and hemophilia, and gene defects (e.g., cystic fibrosis, Gaucher disease, adenosine deaminase (ADA) deficiency, emphysema, etc.).

[0056] Therapeutic or preventive genes may also be some antisense oligonucleotides (e.g., short oligonucleotides complementary to sequences around the translation start site (AUG codon) of mRNA) that are useful in antisense therapy for cancer and viral diseases.

[0057] The therapeutic or prophylactic gene may be linked to a promoter for expressing the therapeutic or prophylactic gene. The promoter for expressing the therapeutic or prophylactic gene is not particularly limited, and examples include a cytomegalovirus-derived promoter (optionally containing an enhancer), the SV40 early promoter, the human elongation factor-1α (Ef1α) promoter, the human ubiquitin C promoter, the retroviral Rous sarcoma virus LTR promoter, the dihydrofolate reductase promoter, the β-actin promoter, and the phosphoglycerate kinase (PGK) promoter, which may also be used as the exogenous constitutive promoter described above. The therapeutic or prophylactic gene and the promoter for expressing the gene may be flanked by ITR sequences.

[0058] In the present invention, preferably, a viral helper gene derived from adenovirus may be introduced into a cell. The viral helper gene is a non-adeno-associated virus gene that enables replication and packaging of the adeno-associated virus. As the viral helper gene, a gene derived from a virus other than the adeno-associated virus is used. Specific examples of the viral helper gene include a viral helper gene derived from an adenovirus or a herpesvirus, and preferably, the viral helper gene is derived from an adenovirus.

[0059] Examples of viral helper genes derived from adenovirus include E1A, E1B, E2A, E4, and VA-RNA. In host cells having all or a part of the E1 region, the regions of the adenovirus genome necessary for the AAV genome to replicate and be packaged into capsids to form viral virions are the E2A region, E4 region, and VA1 RNA region. Regarding the function of the E4 region, the E4 34 kDa protein encoded by open reading frame 6 (E4 ORF6) of the E4 region is required for AAV replication. Preferably, the viral helper genes are the E2 gene, the E4 gene, and the VA-RNA gene. The VA-RNA gene is preferably the VA-RNAI gene.

[0060] The adenovirus-derived viral helper genes (E1A, E1B, E2A, E4, VA-RNA, etc.) may be wild-type genes, but genes that have been modified by base substitution, deletion, insertion, addition, or the like may also be used, as long as they exhibit their inherent functions.

[0061] When a viral helper gene is introduced into a cell, a vector containing the viral helper gene can be introduced into the cell.

[0062] As a vector containing a viral helper gene, for example, a plasmid, a virus-derived sequence, an artificially designed nucleic acid, etc. can be used, and a plasmid is preferred.

[0063] The viral helper gene is preferably under the control of a promoter. Specific examples of promoters include, but are not limited to, the cytomegalovirus-derived promoter (CMV promoter) (optionally containing an enhancer), the SV40 early promoter, the human elongation factor-1α (Ef1α) promoter, the human ubiquitin C promoter, the retroviral Rous sarcoma virus (RSV) LTR promoter, the dihydrofolate reductase promoter, the β-actin promoter, and the phosphoglycerate kinase (PGK) promoter. These may also be used as the exogenous constitutive promoter described above. The viral helper gene promoter may be under the control of a promoter whose expression can be regulated. The promoter whose expression can be regulated may be a Tet on / off system promoter, whose expression can be regulated by tetracycline, or a Tet on system promoter.

[0064] <Gene of interest> In the present invention, an exogenous gene of interest that encodes a useful substance is used. The gene of interest is preferably a gene encoding an antibody or a gene capable of expressing a recombinant viral vector containing a therapeutic gene. Details of genes of interest that encode bispecific antibodies will be described later. In one example of the present invention, the animal cells are hamster cells, and the exogenous gene of interest is a gene encoding an antibody. In another example of the present invention, the animal cells are human cells, and the exogenous gene of interest is a gene capable of expressing a recombinant viral vector containing a therapeutic gene.

[0065] In one embodiment of the present invention, the gene of interest comprises two or more genes, each of which is operably linked to an exogenous constitutive promoter, and the recognition sequence is present within or near at least one of the sequences of the constitutive promoter, preferably within or near two or more of the sequences of the constitutive promoter.

[0066] One example of the present invention provides a method for producing a useful substance, comprising introducing into an animal cell: (A) (a) two or more exogenous target genes encoding useful substances, (b) an exogenous constitutive promoter operably linked to each of the target genes, and (c) a nucleic acid that is present within or near the sequence of each of the constitutive promoters linked to each of the target genes and that contains a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcription activation factors or transcription activation domains with the binding substances, or a nucleic acid encoding the complex, thereby enabling enhanced expression of the one or more target genes or enabling balanced regulation of the expression of the two or more target genes in the animal cell; and culturing the resulting animal cell.

[0067] The effects of the present invention are enhanced when three or more target genes are contained, and even more so when more than two target genes are contained. Furthermore, when two or more target genes are contained, the balance of target gene expression can be more easily adjusted. When multispecific antibodies are produced using such animal cells, the production of useful substances (e.g., antibodies) can be increased by enhancing the expression of the target genes. Furthermore, because the balance of subunit expression can be adjusted, if the useful substance is, for example, a multispecific antibody, the production of by-products resulting from incorrect subunit combinations can be suppressed, thereby increasing the production of the desired multispecific antibody with the correct assembly state. Furthermore, the increased number of highly productive cells contained in pooled cells into which target genes have been introduced using this technology allows for the elimination or simplification of the cloning process, thereby shortening the time required for the CLD (cell line development) process.

[0068] <Design Example for Monoclonal Antibodies (Two-Subunit Type)> The following is an example of utilizing the present invention with monoclonal antibodies. Preferably, the expression ratio of the heavy chain (HC) and light chain (LC) that constitute the antibody is measured in advance, and if the expression ratios are consistent, the number of binding sequences near or within the promoter that drives each gene is designed to be three or more in order to improve the amount of antibody production.

[0069]

[0070] Another example of the application of the present invention to a monoclonal antibody is as follows: If the expression ratio of the heavy chain (HC) and light chain (LC) constituting the antibody is measured and there is a bias in the expression ratio, the production yield can be improved by adjusting the balance of heavy chain or light chain expression and designing the number of binding sequences to three or more near or within the promoter that drives the gene with low expression level.

[0071]

[0072] <Design Example for Bispecific Antibody (Four-Subunit Type)> The following is an example of utilizing the present invention with a four-subunit type bispecific antibody. In Example 3, it is assumed that the desired bispecific antibody is completed by the association of an HC1 / LC1 complex and an HC2 / LC2 complex. To optimize the production yield of the desired bispecific antibody, it is generally important to ensure that the expression level of each subunit is high and that the ratio is consistent. Therefore, by adjusting the number of binding sequences for each subunit, it is possible to design an antibody that improves the overall production yield while maintaining a consistent expression balance.

[0073]

[0074] <Design Example for Bispecific Antibody (Three-Subunit Type)> The following is an example of utilizing the present invention with a three-subunit bispecific antibody. In Example 4, it is assumed that the desired bispecific antibody is completed by forming a complex between HC1 and LC, and a similar complex with HC2 and associating with each other. Since two LCs are required in the construction of this bispecific antibody, in order to optimize the production yield of the desired bispecific antibody, it is necessary to increase the expression of the LC relative to the expression of each HC, while also optimizing the expression balance between HC1 and HC2.

[0075]

[0076] <Culturing of Animal Cells> In the present invention, useful substances can be produced by culturing animal cells. The animal cells can be cultured under normal conditions for culturing animal cells. The culture temperature for the animal cells is not particularly limited, and is carried out at a temperature at which the animal cells can survive. The culture temperature is generally 25°C to 45°C, preferably 30°C to 42°C, more preferably 35°C to 40°C, and an example is 37°C. CO ２ The concentration is generally 3 to 10% CO ２ and preferably 5 to 10% CO ２ As an example, 8% CO ２ is.

[0077] The period for producing a useful substance is preferably 24 hours or more and 30 days or less, more preferably 5 days or more and 20 days or less, and even more preferably 10 days or more and 15 days or less.

[0078] The culture can be batch culture, fed-batch culture, perfusion culture, or shake culture. At least a part of the virus production process is preferably perfusion culture.

[0079] The culture vessel is not particularly limited, and examples thereof include a flask or a bioreactor. That is, in one example, animal cells can be cultured in a bioreactor.

[0080] The culture scale is not particularly limited, and cells can be cultured in any volume of medium, for example, 1 mL to 2500 L of medium, preferably 1 L to 2300 L, more preferably 50 L to 2200 L, and particularly preferably 300 L to 2100 L. Apparatuses and culture methods for perfusion culture are known in the art and are described in WO2018 / 159847, WO2019 / 049843, WO2019 / 181234, WO2019 / 239780, WO2020 / 003833, WO2020 / 162125, WO2021 / 187008, WO2022 / 196710, and WO2023 / 054556, which are incorporated herein by reference.

[0081] Cultivation may be carried out with shaking agitation. The agitation speed when shaking agitation is generally 50 rpm to 200 rpm, preferably 80 to 150 rpm. Agitation culture may be rotation agitation culture using a propeller or the like in a reactor. The agitation speed when rotating agitation is generally 50 rpm to 200 rpm, preferably 80 to 150 rpm. Agitation may also be performed by wave-type shaking agitation or by up-and-down movement of an agitator blade, but is not particularly limited thereto.

[0082] Examples of media include, but are not limited to, BalanCD® Medium, Expi293 Expression Medium (Thermo Fisher Scientific, A1435101), Dulbecco's Modified Eagle's Medium (DMEM) containing 10% (vol / vol) fetal bovine serum (FBS), Gibco™ Viral Production Medium (Thermo Fisher Scientific, A4817901), serum-free UltraCULTURE™ Medium (Lonza), HuMEC Basal Serum-Free Medium, KNOCKOUT™ CTS™ XenoFREE ESC / iPSC Medium, and STEMPRO™-34 SFM Medium, STEMPRO™ NSC Medium, ESSENTIAL™-8 Medium, Medium 254, Medium 106, Medium 131, Medium 154, Medium 171, Medium 171, Medium 200, Medium 231, HeptoZYME-SFM, Human Endothelial-SFM, GIBCO® FREESTYLE™ 293 Expression Medium, Medium 154CF / PRF, Medium 154C, Medium 154CF, Medium 106, Medium 200PRF, Medium 131, Essential™-6 Medium, STEMPRO™-34 Medium, Gibco® Astrocyte Medium, AIM V® Medium CTS™, AMINOMAX™ Examples of suitable medium include C-100 Basal Medium, AMINOMAX™-II Complete Medium, CD FORTICHO™ Medium, CD CHO AGT Medium, CHO-S-SFM Medium, GIBCO® FREESTYLE™ CHO Expression Medium, CD OPTICHO™ Medium, CD CHO Medium, CD DG44 Medium, SF-900™ Medium, EXPI293™ Expression Medium, LHC Basal Medium, LHC-8 Medium, 293 SFM Medium, CD 293 Medium, AEM Growth Medium, PER.C6® Cell Medium, AIMV® Medium, EXPILIFE® Medium, Keratinocyte SFM Medium, LHC Medium, LHC-8 Medium, LHC-9 Medium, and any derivatives or variations thereof.In certain non-limiting embodiments, the high density culture medium may be CD FORTICHO™ Medium, CD CHO AGT Medium, CHO-S-SFM Medium, GIBCO® FREESTYLE™ CHO Expression Medium, CD OPTICHO™ Medium, C DCHO Medium, CD DG44 Medium, GIBCO® FREESTYLE™ 293 Expression Medium, EXPI293™ Expression Medium, LV-MAX™ Production Medium, FREESTYLE™ F17 Expression Medium, DYNAMIS™ Medium, or similar media, or variations thereof. If desired, L-Glutamine, HT Supplement (100X) (Thermo Fisher Scientific Inc.), etc. may be added to the medium.

[0083] <Recovery of Useful Substances> The useful substance produced can be recovered by simply recovering the culture medium, or by using a filter or centrifuge to recover the liquid from which at least a portion of the cells have been removed, and any known method can be used without particular limitation. If it is desired to improve the purity of the useful substance, change the solvent, or change the form, for example, by making it into a powder, the culture medium or the liquid can be subjected to further treatment.

[0084] It is also possible to collect a portion of the culture medium during perfusion, or to use a filter or centrifuge on a portion of the culture medium during perfusion, and collect the liquid from which at least a portion of the cells have been removed.

[0085] The produced useful substance can be purified by a purification process as described above in this specification. When the useful substance is a protein, the separation and purification of the useful substance can be performed using separation and purification methods commonly used for proteins. As described above in this specification, for example, the useful substance can be separated and purified by appropriately selecting and combining a chromatography column such as affinity chromatography and other methods. Furthermore, when the product is an antibody, the antibody titer can also be measured using a commercially available analytical instrument such as Roche's Cedex Bio.

[0086] Examples of columns used in affinity chromatography include protein A columns and protein G columns. Chromatography other than affinity chromatography includes, for example, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, and adsorption chromatography. These chromatographies can be performed using liquid phase chromatography such as HPLC (high performance liquid chromatography) or FPLC (fast protein liquid chromatography).

[0087] <Method and kit for producing animal cells> The present invention further provides a method for producing the animal cells of the present invention, which comprises introducing into animal cells: (A) (a) an exogenous gene of interest encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the gene of interest, and (c) a nucleic acid that is present within or near the sequence of the constitutive promoter and includes a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid that encodes the complex.

[0088] The order in which the nucleic acid (A) and the nucleic acid (B) are introduced into the animal cell is not particularly limited. The nucleic acid (A) may be introduced into the animal cell after the nucleic acid (B), or the nucleic acid (B) may be introduced into the animal cell after the nucleic acid (A), or the nucleic acid (A) and the nucleic acid (B) may be introduced simultaneously.

[0089] The present invention further provides a kit for expressing a target gene in an animal cell, comprising: (A) (a) an exogenous target gene encoding a useful substance or a cloning site for inserting the target gene, (b) an exogenous constitutive promoter linked upstream of the target gene or the cloning site, and (c) a nucleic acid that is present within or near the sequence of the constitutive promoter and includes a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid encoding the complex.

[0090] Specific examples and preferred embodiments of the method and kit for producing animal cells of the present invention are as described above in this specification.

[0091] The present invention will be explained in more detail with reference to the following examples, but the present invention is not limited to these examples.

[0092] <Experiment 1> Plasmids A and B were synthesized using an artificial gene synthesis service (Azenta). Sanger sequencing analysis confirmed that the DNA sequence from the promoter to the poly(A) addition sequence contained no mutations, and these were used in subsequent experiments. Each sequence is clearly indicated by a literature citation.

[0093] Plasmid A (one, three, or six loxP sequences) was transfected into Chinese hamster ovary (CHO) cells using 4D-Nucleofector (LONZA). ＴＭ The cells were cultured in a medium (hereafter referred to as CHO culture medium) containing 8 mmol / L L-Glutamine (Thermo Fisher Scientific Inc.) at a final concentration of 8 mmol / L and 1% HT Supplement (100X) (Thermo Fisher Scientific Inc.) at 37°C and 5% CO. ２After that, hygromycin was added to the medium at a final concentration of 400 μg / ml, and the cells were cultured for two weeks to prepare three types of stable expression strains with different numbers of loxP sequences.

[0094] Plasmid B (effector portion: VPR gene and no effector) was transfected into each of the stable expression lines using 4D-Nucleofector (LONZA). After culturing the above cell lines in CHO culture medium for 3 days, puromycin was added to the medium at a final concentration of 8 μg / ml and cultured for 2 weeks to produce stable expression lines (report on VPR design: Nat Methods 12, 326-328 (2015)).

[0095] The cellular distribution of red fluorescence intensity of these cell lines was measured using a flow cytometer Attune NxT (Thermo Fisher Scientific Inc.) Peak position analysis of the measurement data was performed using FlowJo v10.10.0.

[0096] Furthermore, for cell lines transfected with Plasmid A containing three loxP sequences, the luminescence intensity was measured using a Nano Glo HiBiT Lytic Detection System (Promega) kit and a plate reader Envision (Perkinelmer). To correct the expression level for cell number, the cell mass was measured using a plate reader Envision using a cell ATP measurement reagent ver. 2.0 (Toyo B-Net). Finally, the mCherry protein expression level per cell was quantified by correcting the HiBit luminescence level for the amount of ATP.

[0097] The results of the flow cytometer are shown in Figure 2 and Table 5, and the results of the plate reader are shown in Table 6. The fluorescence peak was 1.79-fold when there was one loxP residue, 4.72-fold when there were three loxP residues, and 4.84-fold when there were six loxP residues. From this, it was concluded that the expression level improved significantly as the number of loxP residues increased up to three, and that the improvement was gradual beyond that.

[0098]

[0099]

[0100]

[0101]

[0102] The sequence of the bovine growth hormone poly A addition signal sequence ("pA" in Figure 1) is shown below: Ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga (SEQ ID NO: 3)

[0103]

[0104]

[0105] <Experiment 2> A schematic diagram of Plasmid C1-C8 is shown in Figure 3. These plasmids were prepared by obtaining partial sequences from an artificial gene synthesis service (Azenta), amplifying the fragments by PCR, and then ligating them using an In-Fusion HD Cloning Kit (Takara Bio Inc.). Plasmid C1-C8 was used in subsequent experiments after confirming by Sanger sequencing that the DNA sequence from the promoter to the poly(A) addition sequence contained no mutations.

[0106] Plasmids C1-C8 were transfected into the cells stably transfected with Plasmid A ligated with three loxP sites, established in Experiment 1, using 4D-Nucleofector (LONZA). The above cell lines were cultured in CHO culture medium at 5% CO ２ After culturing for 2 days at 37°C, the cellular distribution of red fluorescence intensity was measured using a flow cytometer Attune NxT (Thermo). Peak analysis of the measurement data was performed using FlowJo v10.10.0.

[0107] HSF1 ggcttcagcgtggacaccagtgccctgctggacctgttcagcccctcggtgaccgtgcccgacatgagcctgcctgaccttgacagcagcctggccagtatccaagagctcctgtctccccaggagccccccaggcctcccgaggcagagaacagcagcccggattcagggaagcagctggtgcactac acagcgcagccgctgtttcctgctggacccccggctccgtggacaccgggagcaacgacctgccggtgctgtttgagctgggagagggctcctacttctccgaaggggacggcttcgccgaggacccccaccatctccctgctgacaggctcggagcctcccaaagccaaggaccccactgtctcc (SEQ ID NO: 6)

[0108] VP16: Nat Methods 12, 326 - 328 (2015) gacgcattggacgattttgatctggatatgctg (SEQ ID NO: 7)

[0109] P65: Nat Methods 12, 326 - 328 (2015) cagtacctgcccgacaccgacgaccggcaccggatcgaggaaaagcggaagcggacctacgagacattcaagagcatcatgaagaagtcccccttcagcggccccaccgaccctagacctccacctagaagaatcgccgtgcccagcagatccagcgccagcgtgccaaaacctgccccccagccttaccccttcaccagcagcctgagcaccatcaactacgacgagttccctaccatggtgttccccagcggccagatctctcaggcctctgctctggctccagcccctcctcaggtgctgcctcaggctcctgctcctgcaccagctccagccatggtgtctgcactggctcaggcaccagcacccgtgcctgtgctggctcctggacctccacaggctgtggctccaccagcccctaaacctacacaggccggcgagggcacactgtctgaagctctgctgcagctgcagttcgacgacgaggatctgggagccctgctgggaaacagcaccgatcctgccgtgttcaccgacctggccagcgtggacaacagcgagttccagcagctgctgaaccagggcatccctgtggcccctcacaccaccgagcccatgctgatggaataccccgaggccatcacccggctcgtgacaggcgctcagaggcctcctgatccagctcctgcccctctgggagcaccaggcctgcctaatggactgctgtctggcgacgaggacttcagctctatcgccgatatggatttctcagccttgctg (SEQ ID NO: 8)

[0110] Rta: Nat Methods 12, 326-328 (2015) (SEQ ID NO: 9)

[0111] The results are shown in Figures 4 and 5 and Table 7. It was demonstrated that when the total number of transcriptional activators was 3 or more, the Fold Change was 2.0 or more, and expression was significantly increased.

[0112]

[0113] <Experiment 3> A schematic diagram of Plasmid D, Plasmid E, and Plasmid F is shown in Figure 6. Plasmid D was produced by obtaining the GAPDH promoter sequence by PCR using the CHO cell genome as a template, and replacing the Ef1α promoter portion of Plasmid B using the In-Fusion HD Cloning Kit (Takara Bio Inc.). Plasmid E and Plasmid F were synthesized by an artificial gene synthesis service (Azenta). Sanger sequencing analysis confirmed that the DNA sequence from the promoter to the poly(A) addition sequence contained no mutations, and the plasmids were used in subsequent experiments.

[0114] LoxP3-linked minipromoter sequence of PlasmidD: coreD from the paper cited in doi: 10.3390 / cells11142141 was used. The Lox71 sequence is shown in uppercase. TACCGTTCGTATAGCATACATTATACGAAGTTATgaattgagcactagTACCGTTCGTATAGCATACATTATACGAAGTTATgaattgagcactagTACCGTTCGTATAGCATACATTATACGAAGTTATgaattctttagacgcgtacggtgggcgcctatataagcagagctcgtttagtgaaccgtcagatcgcctggagcaattccacaacacttttgtcttataccaactttccgtaccacttcctaccctcgtaaagccaccatg (SEQ ID NO: 10)

[0115] Plasmid D was transfected into Chinese hamster ovary cells (CHO cells) using 4D-Nucleofector (LONZA). The above cell line was cultured in CHO culture medium under 5% CO ２ After culturing at 37°C for 3 days, Puromycin was added at a final concentration of 8 µg / ml and the culture was continued for 2 weeks to prepare a strain into which PlasmidD was stably introduced.

[0116] Plasmid A (with three loxP sites), Plasmid E, and Plasmid F were transfected into the cell line using 4D-Nucleofector (LONZA). After culturing the cell line for 3 days, hygromycin was added to the medium at a final concentration of 400 μg / ml and the cell line was cultured for 2 weeks.

[0117] The cellular distribution of red fluorescence intensity was measured for these three cell lines using a flow cytometer, Attune NxT (Thermo). Peak position analysis of the measured data was performed using FlowJo v10.10.0. The results are shown in Figure 7 and Table 8. These results indicate that the use of a constitutive promoter for transactivation can improve expression levels more than the use of a minimal promoter.

[0118]

[0119] <Experiment 4> A schematic diagram of Plasmid G, Plasmid H, and Plasmid I is shown in Figure 8. Plasmids G, H, and I were prepared by obtaining partial sequences from an artificial gene synthesis service (Azenta), partially amplifying them by PCR, and then ligating them using an In-Fusion HD Cloning Kit (Takara Bio Inc.).

[0120] The minipromoter sequence used in Plasmid G was the same as that used in Plasmid D described above.

[0121] Plasmid G was transfected into Chinese hamster ovary cells (CHO cells) using 4D-Nucleofector (LONZA). The above cell line was cultured in CHO culture medium under 5% CO ２ After culturing for 7 days at 37°C, single cell sorting of green fluorescent positive cells was performed using a cell sorter SH800S (manufactured by Sony Corporation) to establish dCre-VPR stably expressing cells.

[0122] The dCre-VPR stable-expressing cells were transfected with either Plasmid H or Plasmid I using 4D-Nucleofector (LONZA). After culturing the cell line for 3 days, Puromycin was added to the medium at a final concentration of 8 μg / ml, and drug selection was performed for 14 days. Subsequently, Plasmid H- or Plasmid I-transfected cells were seeded onto 96-well plates by limiting dilution and cloned. Genomic DNA from multiple candidate clone cells was purified using a QIAamp DNA Mini Kit (QIAGEN). The copy numbers of the antibody light chain gene (LC) and antibody heavy chain gene (HC) introduced were measured using a QX200dd PCR system (BioRad). Cloned cells with one copy of each gene inserted were selected and used for antibody production tests.

[0123] To compare the antibody production ability of Plasmid H-introduced cloned cells (non-transactivation effect-sensitive) and Plasmid I-introduced cloned cells (transactivation effect-sensitive), CD OptiCHO ＴＭ The cells were suspended in 40 mL of medium (Thermo Fisher Scientific Inc.) and cultured in a 125 mL shaker culture flask at 37°C and 5% CO ２ Shaking culture was carried out at a speed of 140 rpm under a high concentration of 0.05% CO₂. A fixed amount of feed medium was added every day from day 3 to day 12 of the culture. On day 12 of the culture, the culture medium was collected, and cells and cell debris were removed using a depth filter (pore size 0.22 μm) to obtain a culture supernatant.

[0124] The antibody concentration in the culture supernatant was measured by liquid chromatography using a Protein A column. The antibody was purified from the culture supernatant using a Protein A column, and the antibody concentration was quantified using an icIEF analyzer, Maurice (Protein Simple). The effect of the transactivation system on antibody production is shown in Table 9.

[0125]

[0126] <Experiment 5> We investigated whether two or more foreign genes introduced into cells could be controlled by changing the number of transactivator binding sequences linked to the promoters that drive each gene.

[0127] Among the plasmids with different numbers of transactivator binding sites, Plasmid J (G0), (G1), and (G3) carrying the green fluorescent gene EGFP are shown in Figure 9. Among the plasmids with different numbers of transactivator binding sites, Plasmid K (R0), (R1), and (R3) carrying the red fluorescent gene mCherry are shown in Figure 10.

[0128] Chinese hamster ovary-derived cells (CHO cells) were transfected with two types of plasmids, one each from Plasmid J and Plasmid K, according to Table 10, using 4D-Nucleofector (LONZA). The above four cell lines were cultured in CHO culture medium under 5% CO ２ After culturing for 3 days at 37°C, G418 and hygromycin were added as selection drugs at final concentrations of 400 µg / ml each, and the culture was continued for an additional 2 weeks.

[0129]

[0130] To measure the expression enhancing effect of the transactivator on these four types of drug-selected cells, Plasmid L was transfected using 4D-Nucleofector (LONZA). A schematic diagram of Plasmid L is shown in Figure 11.

[0131] After gene transfer, the CHO culture medium was incubated at 5% CO ２ After culturing for 2 days at 37°C, green and red fluorescence intensities were measured using a flow cytometer Attune NxT (Thermo). Fluorescence intensity analysis of peak positions of the measurement data was performed using FlowJo v10.10.0.

[0132] The fluorescence intensity of the control G0 / R0 cells was set at 100%, and the fluorescence intensities of the other three cells are shown in Table 11. From these results, we concluded that when multiple exogenous target genes are introduced into cells, the intensity of gene expression can be controlled by the number of transactivator binding sequences placed in the promoter of each gene.

[0133]

Claims

1. A method for producing a useful substance, comprising introducing into an animal cell: (A) (a) an exogenous target gene encoding a useful substance; (b) an exogenous constitutive promoter operably linked to said target gene; and (c) a nucleic acid present within or near the sequence of said constitutive promoter and comprising a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcriptional activators and said binding substance, or a nucleic acid encoding said complex; and culturing the resulting animal cell.

2. The method of claim 1, wherein the transcriptional activation factor is one or more of VP16, P65, Rta, HSF1, activation domains thereof, or variants thereof.

3. The method of claim 1, wherein the constitutive promoter is a promoter of a housekeeping gene or a gene that is in the top 10% of expression levels in cells.

4. The production method according to claim 1, wherein the constitutive promoter is a promoter selected from promoters that drive genes selected from Ef1α, Gapdh, Actb, UbC, ribosome component genes, or Nfkb complex component genes.

5. The manufacturing method according to claim 1, wherein the constitutive promoter is a promoter having the base sequence set forth in SEQ ID NO: 4, or a promoter having 80% or more sequence identity within any 300 nucleotides of the base sequence set forth in SEQ ID NO: 4 and having promoter activity equal to or greater than that of the promoter having the base sequence set forth in SEQ ID NO:

4.

6. The method of claim 1, wherein the binding substance is selected from the group consisting of sequence-specific nucleases, restriction enzymes, transcriptional regulators, sequence-specific recombinases, RNA-guided nuclease complexes, and variants thereof in which functions other than DNA binding activity are attenuated or deleted.

7. The method of claim 1, wherein the binding substance is Gal4, Cre recombinase, or rtTA / tTA.

8. The method of claim 1, wherein the recognition sequence has a length of 10 bp or more.

9. The method of claim 1, wherein the recognition sequences are 1 to 10.

10. The method of claim 1, wherein the binding substance is Cre recombinase and the recognition sequence is loxP or a variant thereof.

11. The method of claim 1, wherein the gene of interest is a gene encoding an antibody or a gene capable of expressing a recombinant viral vector containing a therapeutic gene.

12. The production method according to claim 1, wherein the target gene comprises two or more genes, each of which is operably linked to an exogenous constitutive promoter, and at least one of the constitutive promoters has a recognition sequence within or near the sequence thereof.

13. The method of claim 12, wherein recognition sequences are present within or near two or more sequences of the constitutive promoter.

14. The method of claim 1, wherein the culturing of the animal cells is carried out in a bioreactor.

15. (A) An animal cell having (a) an exogenous gene of interest encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the gene of interest, and (c) a nucleic acid present within or near the sequence of the constitutive promoter and containing a recognition sequence to which a binding substance can bind, and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid encoding the complex.

16. A method for producing an animal cell according to claim 15, comprising introducing into an animal cell: (A) (a) an exogenous target gene encoding a useful substance, (b) an exogenous constitutive promoter operably linked to the target gene, and (c) a nucleic acid present within or near the sequence of the constitutive promoter and including a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid encoding the complex.

17. (A) A kit for expressing a target gene in an animal cell, comprising: (a) an exogenous target gene encoding a useful substance or a cloning site for inserting the target gene; (b) an exogenous constitutive promoter linked upstream of the target gene or the cloning site; and (c) a nucleic acid present within or near the sequence of the constitutive promoter and containing a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcriptional activators and the binding substance, or a nucleic acid encoding the complex.

18. A method for producing a useful substance, comprising introducing into an animal cell: (A) (a) two or more exogenous target genes encoding useful substances; (b) an exogenous constitutive promoter operably linked to each of the target genes; and (c) a nucleic acid that is present within or near the sequence of each of the constitutive promoters linked to each of the target genes and that contains a recognition sequence to which a binding substance can bind; and (B) a complex of three or more transcription activation factors or transcription activation domains with the binding substance, or a nucleic acid encoding the complex, thereby enabling enhanced expression of the one or more target genes or enabling balanced regulation of the expression of the two or more target genes in the animal cell, and culturing the resulting animal cell.

Images