Method for constructing transgenic mouse model of lung tissue specific expression SARS-Cov2 structural protein

Abstract

The invention discloses a method for constructing a transgenic mouse model of a lung tissue specific expression SARS-Cov2 structural protein, which comprises the following steps: inserting an LSL element and gene sequences of SARS-Cov2 structural proteins S, E, M and N into a mouse gene by using a CRISPR / Cas9 technology, mating a positive mouse inserted with LSL-SARSSEMN with a lung type II alveolar epithelial cell specific Cre tool mouse, and constructing a transgenic mouse model of the lung tissue specific expression SARS-Cov2 structural protein. And LSL-SARSSEMN heterozygosis and Cre positive offspring are retained, and mutual breeding is carried out. Detection and evaluation show that the LSL element is successfully cut off by Cre enzyme, and a corresponding mouse shows serious lung injury along with the enhancement of gene expression of each SARS-Cov2 structural protein. According to the invention, the SARS-Cov2 structural protein is specifically expressed in the lung tissue of the mouse, so that the lung injury after SARS-Cov2 infection can be accurately simulated.

Description

Technical Field

[0001] The present invention relates to a method for constructing a mouse model, and in particular to a method for constructing an animal model for simulating lung damage after SARS-Cov2 infection by utilizing transgenic technology for conditionally expressing SARS-Cov2 structural proteins. Background Art

[0002] The novel coronavirus (SARS-Cov2, also known as SARS-CoV-2) is the pathogen of the novel coronavirus disease, which can cause varying degrees of respiratory symptoms (such as inflammatory damage to the lungs) in infected people. In severe cases, respiratory failure, shock, and even death may occur. In addition to respiratory symptoms, infected people also show complications in multiple systems such as kidneys, cardiovascular, nervous systems, and gastrointestinal tract, which seriously affect people's lives, health, and safety.

[0003] An ideal animal model is an important tool for clarifying the pathological mechanism of infectious diseases, developing anti-infective drugs and vaccines. The animal models commonly used in SARS-Cov2 research include human angiotensin-converting enzyme (hACE2) transgenic mice directly infected by virus challenge (see: Construction of a new coronavirus mouse infection model and study of infection characteristics. Academy of Military Sciences, 2024), as well as Syrian golden hamsters, ferrets, non-human primates, etc. However, due to the problems of viral load in animals, experimental costs, animal ethics, virus susceptibility and laboratory biosafety, the in vivo research of SARS-Cov2 has been restricted. In addition, the current clinical mortality rate of humans infected with SARS-Cov2 is not high. However, when the above-mentioned CAG-hACE2 transgenic mice were exposed to SARS-CoV2, as the viral load continued to increase, the mice rapidly progressed to severe pneumonia and lung consolidation, and showed high lethality. Most mice died within 5 days (about 100% mortality), that is, the transgenic mice had a rapid course of disease after being infected with the live SARS-CoV2 virus (and some lesions were too severe), and it was not easy to capture and reproduce all the characteristics of related lesions of damage to important tissues and organs (such as the lungs).

[0004] The specific site constructed by CRISPR / Cas9 technology and homologous recombination repair is integrated with Loxp-Stop-Loxp elements or floxTransgenic mice in different regions can be used to breed with Cre mice with different tissue cell specificity (including drug-induced Cre) to express exogenous proteins in different tissues, organs and cells or knock out endogenous genes, such as CN118931964A and CN114457114A. However, in the absence of virus infection, only conditional expression of SARS-Cov2 structural proteins in experimental animals (in order to achieve tissue-specific expression) has no direct connection with the infection process of SARS-Cov2 invading animals and causing lesions in tissues and organs in the body.

[0005] In addition, given the important role played by SARS-Cov2 structural proteins (specifically, spike protein [S], envelope protein [E], membrane protein [M], and nucleocapsid protein [N]) in virus invasion, tissue and organ damage induced by virus invasion, and inhibition of the body's antiviral immune response, the development of related vaccines and antiviral drugs will also involve the modification and expression of viral structural proteins. For example, CN118436773A uses the fusion protein expressed by the BCG strain (involving N, S2 and RBD, E, and M proteins) as an antigen to immunize experimental animals, and aims to improve the effectiveness of cellular and humoral immunity against highly variable viruses. However, in this technology, after inserting several SARS-CoV2 antigen epitope sequences on the BCG vector, a plasmid vector is constructed and transferred into bacteria. The purpose is to use the viral antigen epitopes expressed by bacteria to immunize mice and examine the production of antibodies against the antigen epitopes and the activation of immune cells. The protein (specifically, the fusion protein) will not be expressed in mouse tissues and organs. In CN112760297A, the full-length or differently truncated coronavirus spike protein (i.e., S protein) is expressed by the shell of VSV virus, and a replication-defective and non-infectious pseudovirus that only expresses certain S protein fragments is obtained, which can be used to simulate the invasion of coronavirus into cells through S protein (used to bind to ACE2 expressed in cells) (but without the invasion of other structural proteins and viral nucleic acids). The titer of the measured pseudovirus can only indicate the situation of virus entry into cells (not real infection). It can be seen that the experimental design of the expression of viral structural proteins such as SARS-Cov2 does not usually involve the tissue-specific expression of viral structural proteins (such as lung tissue), nor does it involve the simulation and investigation of tissue damage after viral infection. Summary of the invention

[0006] The purpose of the present invention is to provide a method for constructing a transgenic mouse model that specifically expresses SARS-Cov2 structural proteins in lung tissue. Taking mice as an example, the present invention expresses SARS-Cov2 structural proteins S, E, M and N in their lung tissue to obtain an animal model whose pathological characteristics are highly consistent with the lung damage that occurs after human infection with SARS-Cov2 clinically. In order to achieve the above object, the present invention adopts the following technical solutions: In a first aspect, a method for constructing an animal model of lung injury after simulating SARS-Cov2 infection is provided, the method comprising the following steps: A transgenic animal that conditionally expresses the structural proteins of the novel coronavirus (SARS-Cov2) is prepared, wherein the structural proteins include spike protein (S), envelope protein (E), membrane protein (M) and nucleocapsid protein (N), and the structural proteins are expressed in the lungs of the offspring through the specific expression of the Cre enzyme in the offspring of the transgenic animal, thereby obtaining an animal model of lung damage after simulating SARS-Cov2 infection (i.e., the animal was not infected with the virus).

[0007] Preferably, the construction method specifically comprises the following steps: 1) Inserting the sequentially arranged Loxp-Stop-Loxp (LSL) element and the tandem sequence of the SARS-Cov2 structural protein gene (SARS SEMN ), obtain the integrated gene fragment LSL-SARS SEMN LSL-SARS transgenic mice SEMN transgenic mice); 2) The LSL-SARS obtained in step 1 SEMN Transgenic mice and lung tissue-specific Cre tool mice (e.g., mouse lung type II alveolar epithelial cell-specific Cre tool mice Sftpc-IRES-iCre ) and the obtained LSL-SARS SEMN Heterozygous and Cre-positive offspring (in the offspring, the LSL elements inserted into the genome of lung tissue cells of male and female mice, such as type II alveolar epithelial cells in the lungs, are removed by the Cre enzyme in the cells) are bred together to obtain transgenic mice that specifically express SARS-Cov2 structural proteins in lung tissue.

[0008] Preferably, in step 1, CRISPR / Cas9 technology is used to repair the DNA in experimental mice (specifically wild-type mice) by homologous recombination. Rosa26 The intron region between exons 1 and 2 of the gene contains a promoter, LSL element, and a tandem sequence of the SARS-Cov2 structural protein gene (SARS SEMN ), WPRE sequence and termination sequence (such as BGH polyA), that is, the SARS-Cov2 structural protein expression cassette with embedded LSL element (containing LSL-SARS SEMN), and used the LSL element in the SARS-Cov2 structural protein expression cassette with the embedded LSL element inserted into the mouse genome to block the SARS-Cov2 structural protein gene tandem sequence downstream of the element (SARS SEMN ) expression.

[0009] Preferably, the homologous recombination repair is performed on the double-stranded breaks of the genomic DNA at the target site caused by the cleavage activity of the Cas9 protein when the Cas9 protein binds to the target site under the guidance of the gRNA, wherein the target site is located at Rosa26 The intronic region between exons 1 and 2 of a gene.

[0010] Preferably, the target site is selected from a DNA sequence having the following Rosa26 Either or both of the gene loci: SEQ.ID.NO.1:5'—CTAACTTCCCATGGCTTAAATGG—3' SEQ.ID.NO.2: 5'—TTCCCATGGCTTAAATGGCATGG—3'.

[0011] Preferably, the donor vector (e.g., pCAG-LSL-SARS SEMN -EGFP-pA) includes a 1.0~1.5 kb 5' homology arm, a CAG promoter, a Loxp element, a 5×stop sequence, a Loxp element, a Kozak sequence, a SARS-Cov2-S sequence, a P2A cleavage peptide sequence, a SARS-Cov2-E sequence, a F2A cleavage peptide sequence, a SARS-Cov2-M sequence, a T2A cleavage peptide sequence, a SARS-Cov2-N sequence, an E2A cleavage peptide sequence, a green fluorescent protein (e.g., EGFP) gene sequence, a TAA stop codon, a WPRE sequence, a BGH ployA, and a 1.0~1.5 kb 3' homology arm. The 5' homology arm is Rosa26 The homologous sequence of the upstream DNA sequence separated by the target site on the gene, and the 3' homology arm is Rosa26 A homologous sequence of a downstream DNA sequence that is separated from the target site on the gene. Preferably, the step 1 specifically comprises the following steps: 1.1) Design and prepare targeting Rosa26 gRNA in the corresponding intron region of the gene; according to the LSL element and the tandem sequence of the SARS-Cov2 structural protein gene (SARS SEMN ) and other SEMNThe SARS-Cov2 structural protein expression cassette containing the embedded LSL element (containing LSL-SARS SEMN ) to construct a donor vector for homologous recombination repair; 1.2) Cas9 mRNA, gRNA, and donor vector were simultaneously microinjected into fertilized eggs of wild-type mice, and then the fertilized eggs were transplanted into pseudo-pregnant female mice, and then F0 mice were produced by pseudo-pregnant female mice; 1.3) will be Rosa26 Positive F0 mice with a SARS-Cov2 structural protein expression cassette (i.e., full-length knock-in fragment) inserted into the corresponding intron region of the gene were mated with wild-type mice, and the F1 mice obtained from the mating retained the LSL-SARS SEMN Heterozygous transgenic mice (denoted as LSL-SARS) SEMN+ / - ) as positive F1 mice, which can be used for breeding with the Cre tool mice.

[0012] Preferably, the step 2 specifically comprises the following steps: SEMN The heterozygous transgenic mice are mated with the Cre tool mice, and the Cre-positive heterozygous transgenic mice containing the knock-in fragment (referred to as LSL-SARS) are retained in the offspring mice (i.e., F2 generation mice) obtained by mating. SEMN+ / - Cre + ), the transgenic mice retained were mated with brothers and sisters, and the homozygous transgenic mice containing Cre positive knock-in fragments (referred to as LSL-SARS) were retained in the offspring mice (i.e., F3 generation mice) obtained by mating. SEMN+ / + Cre + ) and Cre-positive heterozygous transgenic mice containing the knock-in fragment.

[0013] The wild-type mice do not carry the knock-in fragment and do not contain the Cre gene and can be named LSL-SARS SEMN- / - Cre - ; named LSL-SARS SEMN+ / - Cre + The transgenic mice were bred to obtain LSL-SARS SEMN Knock-in heterozygous mice carrying the Cre gene (i.e., Cre positive) should be Rosa26 One allele of the gene was knocked in with the LSL-SARS SEMN The corresponding expression cassette of the gene was removed by Cre enzyme in specific tissue cells, while the other allele was wild type, i.e., it did not contain the knock-in fragment; named LSL-SARSSEMN+ / + Cre + The transgenic mice were bred to obtain LSL-SARS SEMN Knock-in homozygous mice carrying the Cre gene, the transgenic mice should be Rosa26 Both alleles of the gene were knocked in with LSL-SARS SEMN The corresponding expression cassettes were removed by Cre enzyme in specific tissue cells.

[0014] Preferably, the Cre enzyme of the Cre tool mouse is specifically expressed in type II alveolar epithelial cells in the lungs, that is, the above-mentioned resection occurs in these cells.

[0015] Preferably, the animal model of simulated lung injury after SARS-Cov2 infection is a transgenic mouse of ≥8 weeks old whose lung tissue specifically expresses SARS-Cov2 structural protein, such as the transgenic mouse LSL-SARS obtained in step 2. SEMN+ / + Cre + (8 weeks old), LSL-SARS SEMN+ / - Cre + (8 weeks old), or offspring that stably inherit the genotype of the transgenic mice.

[0016] In a second aspect, a method for preparing a transgenic animal that conditionally expresses a structural protein of a novel coronavirus (SARS-Cov2) is provided, the preparation method comprising the following steps: The gene sequence of SARS-Cov2 structural protein and the Cre-Loxp system elements for regulating the expression of the gene sequence are inserted into the genome of experimental animals to obtain transgenic animals that conditionally express the structural proteins of the new coronavirus (SARS-Cov2), wherein the structural proteins include spike protein (S), envelope protein (E), membrane protein (M) and nucleocapsid protein (N).

[0017] Preferably, the preparation method specifically comprises the following steps: inserting a sequentially arranged Loxp-Stop-Loxp (LSL) element and a tandem sequence of a SARS-Cov2 structural protein gene (SARS SEMN ), obtain the integrated gene fragment LSL-SARS SEMN LSL-SARS transgenic mice SEMN Transgenic mice), such as the positive F1 mice described above.

[0018] In the third aspect, the present invention provides a method for preparing the above-mentioned transgenic animals that conditionally express the structural protein of the new coronavirus (SARS-Cov2) and its application in constructing an animal model of lung injury after simulating SARS-Cov2 infection.

[0019] Preferably, the lung injury manifests as lesions associated with interstitial pneumonia, including alveolar septal thickening, inflammatory cell infiltration dominated by neutrophils, alveolar hemorrhage, and alveolar fusion. The severity of these lesions is related to the difference in the expression level of each SARS-Cov2 structural protein in the lungs of the constructed transgenic mice of different genotypes (for example, the transgenic mice LSL-SARS SEMN+ / + Cre + The expression level in lung tissue was compared with that in the above transgenic mice LSL-SARS SEMN+ / - Cre + There was a certain positive correlation between the expression levels in lung tissue and the

[0020] Preferably, the lesion also includes lung collapse, such as this lesion manifested in the above transgenic mouse LSL-SARS SEMN+ / + Cre + , but not in the above transgenic mice LSL-SARS SEMN+ / - Cre + middle.

[0021] In a fourth aspect, the present invention provides the application of the method for preparing the transgenic animals that conditionally express the structural protein of the new coronavirus (SARS-Cov2) in constructing an animal model of interstitial pneumonia.

[0022] In a fifth aspect, a method for preparing the above-mentioned transgenic animals that conditionally express the structural protein of the new coronavirus (SARS-Cov2) is provided for use in constructing an animal model of acute respiratory distress syndrome (ARDS).

[0023] The beneficial effects of the present invention are embodied in: The present invention uses the prepared transgenic animals that conditionally express SARS-Cov2 structural proteins (specifically SARS-Cov2 S, E, M and N proteins) as parents, and can achieve the specific expression of each SARS-Cov2 structural protein in the lung tissue cells of its offspring through the specific expression of the Cre enzyme, thereby simulating the lung damage caused by SARS-Cov2 infection in vivo (including typical lesions of interstitial pneumonia, such as thickening of the alveolar septum, inflammatory cell infiltration dominated by neutrophils, and alveolar hemorrhage, alveolar fusion, and lung collapse), while avoiding the premature death of the model animals and achieving genetic stability, thereby meeting the economical, simple and reliable requirements for animal models and their acquisition methods in the screening and efficacy evaluation of SARS-Cov2 pathogenic mechanism and antiviral damage drugs.

[0024] Furthermore, the present invention utilizes CRISPR / Cas9 technology and homologous recombination repair to connect the LSL element and the SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ) into a mouse gene (e.g. Rosa26 gene), the resulting LSL-SARS SEMN After the transgenic mice were mated with the specific Cre tool mice, the Cre enzyme was specifically expressed in the type II alveolar epithelial cells of the lungs of the offspring mice, so that the LSL element inserted in the genome of the type II alveolar epithelial cells of the lungs of the mice was removed, thereby making the SARS-Cov2 structural protein gene tandem sequence downstream of the element (SARS SEMN ) was expressed, improving the genetic stability of the animal model of lung injury after simulating SARS-Cov2 infection.

[0025] Furthermore, the present invention obtains transgenic mice with increased expression levels of SARS-Cov2 structural proteins (specifically, LSL-SARS with higher expression levels) by breeding mice of the same generation. SEMN+ / + Cre + mice), and as the expression levels of each SARS-Cov2 structural protein increased, the corresponding transgenic mice showed severe lung injury in the lung tissue.

[0026] Furthermore, the present invention utilizes the WPRE sequence (inserted before the BGH polyA that terminates transcription and translation) and the tandem sequence of the SARS-Cov2 structural protein gene (SARS SEMN ) uses different cleavage peptide sequences to connect different SARS-Cov2 structural protein gene sequences, which can make the knocked-in SARS-Cov2 structural protein gene tandem sequence (SARS SEMN ) stably and independently express the various SARS-Cov2 structural proteins after transcription, that is, one transcription product produces multiple proteins (specifically S, E, M and N) in the lungs, providing a material basis for the differentiated and precise modeling process of transgenic mice with different genotypes (and avoiding mutual interference between lesions), and ultimately obtaining qualitative changes in the degree of lung damage in the model animals (for example, transgenic mice LSL-SARS SEMN+ / + Cre + The lung tissue showed lung collapse, which is usually associated with ARDS), thereby more accurately simulating the lung damage that occurs after human infection with SARS-Cov2 in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1This is a schematic diagram of using CRISPR / Cas9 technology to prepare transgenic mice that specifically express SARS-Cov2 structural proteins in lung tissue in an embodiment of the present invention.

[0028] Figure 2 This is a plasmid map of the donor vector used for homologous recombination repair in the embodiments of the present invention.

[0029] Figure 3 The SARS-Cov2 structural protein expression cassette (containing LSL-SARS) with LSL elements knocked into it in the embodiment of the present invention SEMN ) of the F0 generation of mice; the primer location and the corresponding PCR product size (unit: bp) are indicated.

[0030] Figure 4 The figure is the electrophoresis diagram of PCR identification of F0 generation mice obtained in the embodiment of the present invention; wherein: numbers 1 to 9 are the numbers of F0 generation mice, WT is wild-type mouse C57BL / 6J, N is blank control, P is positive control (donor vector is used as template), and M is DNA Marker.

[0031] Figure 5 This is a PCR identification strategy diagram for the genotype of F1 generation mice obtained in the examples of the present invention.

[0032] Figure 6 The figure is the electrophoresis diagram of genotype PCR identification of F1 generation mice obtained in the example of the present invention; wherein: numbers 8 to 19 are the numbers of F1 generation mice, WT is wild-type mouse C57BL / 6J, N is blank control, and M is DNA Marker.

[0033] Figure 7 The F3 generation of mice LSL-SARS obtained in the present invention SEMN Diagram of the genotype PCR identification strategy.

[0034] Figure 8 This is a PCR identification strategy diagram for the Cre gene carrying status of F3 generation mice obtained in the examples of the present invention.

[0035] Fig. 9 The F3 generation of mice LSL-SARS obtained in the present invention SEMN PCR electrophoresis diagram for identification of genotype and Cre gene carrying status; where: M represents DNA Marker.

[0036] Fig.10This is a diagram of the PCR identification strategy for testing the effect of Cre enzyme in the lung tissue of F3 generation mice in the examples of the present invention.

[0037] Fig.11 This is a PCR electrophoresis diagram for testing the Cre enzyme action in the lung tissue of F3 mice in the embodiment of the present invention; wherein: LSL-SARS SEMN+ / + Cre - are control group mice, and M represents DNA Marker.

[0038] Fig.12 The transgenic mouse LSL-SARS of the F3 generation in the embodiment of the present invention SEMN+ / - Cre + 、LSL-SARS SEMN+ / + Cre + and control group mice (LSL-SARS SEMN+ / + Cre - ) Detection results of SARS-Cov2 structural protein expression levels in lung tissue; Among them: (A) RT-qPCR detection results, (B) immunohistochemical staining detection results; *** P <0.001, **** P <0.0001.

[0039] Fig.13 The transgenic mouse LSL-SARS of the F3 generation in the embodiment of the present invention SEMN+ / - Cre + 、LSL-SARS SEMN+ / + Cre + and control group mice (LSL-SARS SEMN+ / + Cre - ) Lung tissue injury detection results; including: (A) H&E staining detection results, (B) RT-qPCR detection results; * P <0.05,*** P <0.001. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The embodiments are only used to explain the present invention, but not to limit the scope of protection of the present invention.

[0041] The present invention uses CRISPR / Cas9 technology and Cre-Loxp system to construct a tandem sequence containing Loxp-Stop-Loxp (LSL) elements and SARS-Cov2 structural protein gene (SARS SEMN, which specifically includes the gene sequences of SARS-Cov2 structural proteins S, E, M and N), a transgenic mouse that conditionally expresses SARS-Cov2 structural proteins is prepared, and the transgenic mouse is used as a parent (father or mother) to establish a mouse model of lung injury induced by simulating SARS-Cov2 infection. When preparing the transgenic mouse, under the targeted guidance of gRNA, Cas9 cuts the target site in the mouse genome (for example, a safe site that allows the expression of foreign genes), and uses the constructed donor vector for homologous recombination repair, thereby inserting a tandem sequence containing the LSL element and the SARS-COV2 structural protein gene (SARS SEMN ) exogenous fragment, and then produce a stable knock-in fragment (containing LSL-SARS SEMN ) F1 transgenic mice, that is, transgenic mice that conditionally express SARS-Cov2 structural proteins. The mice can then be mated with Cre tool mice to obtain F2 generations, which include Cre-positive and Cre-negative mice, and mice carrying knock-in fragments (heterozygous) and Cre-positive LSL-SARS SEMN+ / - Cre + (LSL-SARS is not available in F2 generation yet SEMN+ / + Cre + ) were used for brother-sister mating and the F3 generation was obtained. There were also Cre-positive and Cre-negative mice in the F3 generation, and mice carrying knock-in fragments (heterozygous and homozygous) and Cre-positive were retained. Among these offspring (F2 generation and F3 generation), individuals without the Cre gene could not express the Cre enzyme (referring to Cre-negative), so the LSL element completely blocked the gene expression of each downstream SARS-COV2 structural protein; while individuals carrying the Cre gene could express the Cre enzyme (referring to Cre-positive), which recognized the Loxp site and then removed the LSL element upstream of the gene of each SARS-COV2 structural protein, thereby activating the gene expression of each SARS-COV2 structural protein. After testing and evaluation, it was found that the two types of mice with homozygous, heterozygous and Cre-positive knock-in fragments in the F3 generation obtained by mutual breeding of the F2 generation had different levels of specific expression of SARS-COV2 structural proteins in the lung tissue at 8 weeks of age after birth. These transgenic mice whose lung tissues specifically express SARS-Cov2 structural proteins were subsequently subjected to pathological analysis, thereby confirming the successful establishment of an animal model of lung injury after simulating SARS-Cov2 infection. The construction process of this animal model is described in detail as follows.

[0042] 1. Preparation of transgenic mice expressing SARS-Cov2 structural proteins specifically in lung tissue 1. For mice Rosa26Gene design gene knock-in strategy, knock-in region selection is Rosa26 The intron region between exons 1 and 2 of a gene (e.g. Figure 1 as shown).

[0043] 2. According to the mouse Rosa26 The intron sequence between exons 1 and 2 of the gene was identified, and gRNA was designed based on the CRISPR / Cas9 system. The gRNA action site is shown in Table 1-1.

[0044] Table 1-1. gRNA action sites

[0045] The underlined bases in Table 1-1 are targeting sequences. The targeting sequences in gRNA can complement the targeting sequences to recruit and guide Cas9 proteins to precisely cut the target sites. According to the sequences in Table 1-1, two sets of gRNA forward primers and reverse primers are designed and synthesized and annealed to form double strands with sticky ends. They are connected to the gRNA backbone plasmid and re-amplified after sequencing verification. After transcription and purification kit operation, two injectable gRNA single strands are obtained. Since the two target sites in Table 1-1 differ by 5 bases, after the two gRNA single strands are used at the same time and two gaps are cut in the genome, the donor vector will perform homologous recombination repair on the broken genome double strands through the homologous arms, but a small number of bases on the genome will be deleted after repair (the bases in the middle of the two gaps will be deleted, and the knock-in fragment will be inserted between the two gaps).

[0046] 3. In order to Rosa26 Insert the knock-in fragment into the intron region between exons 1 and 2 of the gene (including LSL-SARS SEMN ), a donor vector for homologous recombination repair was constructed in vitro using pMD18-T vector (Takara, D101A) Figure 2 As shown in the figure, during the construction process, an I-CeuI restriction site was first introduced between the Hinc II and Xba I restriction recognition sites of pMD18-T, so that a linearized vector backbone was obtained using I-CeuI to connect the knock-in fragment and the homology arms on both sides.

[0047] Table 1-2. Homology arm sequence information

[0048] Table 1-3. Homology arm sequence information

[0049] The resulting donor vector was designated as pCAG-LSL-SARS SEMN-EGFP-pA, containing the following elements or sequences arranged in sequence: 5` homology arm (5`arm), CAG promoter, Loxp element, 5×stop sequence, Loxp element, Kozak sequence, SARS-Cov2-S sequence (i.e., the gene sequence of S protein), P2A cleavage peptide sequence, SARS-Cov2-E sequence (i.e., the gene sequence of E protein), F2A cleavage peptide sequence, SARS-Cov2-M sequence (i.e., the gene sequence of M protein), T2A cleavage peptide sequence, SARS-Cov2-N sequence (i.e., the gene sequence of N protein), E2A cleavage peptide sequence, EGFP gene sequence, TAA termination codon, WPRE sequence, BGH ployA and 3` homology arm (3`arm).

[0050] 4. Microinject Cas9 mRNA, two gRNA single strands and donor vectors into fertilized eggs of C57BL / 6J mice (purchased in April 2023), and transplant the surviving fertilized eggs after injection into pseudo-pregnant female mice. Mice, namely F0 generation mice, are born in about 20 days. The genotype of F0 generation mice is identified by PCR method (i.e., PCR is performed using the extracted mouse genomic DNA as a template to identify positive F0 generation mice that have completed knock-in).

[0051] 5. After the positive F0 mice reach sexual maturity, the F1 mice are obtained by mating the positive F0 mice with wild-type mice (WT) after sexual maturity (6 weeks of age), where the wild-type mice are C57BL / 6J mice; the genotype of the F1 mice is identified by PCR. If positive mice (i.e., F1 heterozygotes with knock-in fragments) are born, it means that the knock-in LSL element and SARS SEMN Has been integrated into mouse germ cells. The positive F1 mice were verified by sequencing. Rosa26 The target genome sequence near the gene knock-in site is shown in SEQ.ID.NO.3. Rosa26In the target genomic sequence near the gene knock-in site (the full length of the sequence is 14770 bp), the region identical to the 5' homology arm sequence in the donor vector is 434 bp~1809 bp; the CAG promoter is 1819 bp~3538 bp; the two Loxp elements are 3539 bp~3572 bp and 5167 bp~5200 bp; the 5×stop sequence is 3573 bp~5166 bp; the Kozak sequence is 5221 bp~5229 bp; the SARS-Cov2-S sequence is 5230 bp~9048 bp; the P2A cleavage peptide sequence is 9049 bp~9114 bp; the SARS-Cov2-E sequence is 9115 bp~9339 bp; the F2A cleavage peptide sequence is 9340 bp~9414 bp; SARS-Cov2-M sequence is 9415 bp~10080 bp; T2A cleavage peptide sequence is 10081 bp~10143 bp; SARS-Cov2-N sequence is 10144 bp~11400 bp; E2A cleavage peptide sequence is 11401 bp~11469 bp; EGFP gene sequence is 11470 bp~12186 bp; WPRE sequence is 12198bp~12785 bp; BGH ployA is 12786 bp~13017 bp; the region identical to the 3` homology arm sequence in the donor vector is 13018 bp~14496 bp.

[0052] 6. After sexual maturity (6 weeks of age), the F1 generation heterozygotes with knock-in fragments were separated from the specific Cre tool mice (specifically Sftpc-IRES-iCre , Jiangsu Jicui Yaokang Biotechnology Co., Ltd., purchased in September 2023) were bred and the F2 generation mice born were identified by PCR and the mice with knock-in fragment heterozygosity and Cre positive were retained (recorded as LSL-SARS SEMN+ / - Cre + ).

[0053] 7. LSL-SARS to be retained in the F2 generation SEMN+ / - Cre + After the mice reached sexual maturity (6 weeks old), they were bred by brother and sister to obtain F3 mice. The mice that were homozygous for the knock-in fragment and Cre-positive were retained (denoted as LSL-SARS SEMN+ / + Cre + ), and mice with heterozygous knock-in fragments and Cre-positive (denoted as LSL-SARS SEMN+ / - Cre + ), that is, to obtain transgenic mice whose lung tissue specifically expresses SARS-Cov2 structural proteins.

[0054] 2. Mouse PCR Identification Results 2.1 PCR identification results of F0 generation mice Genomic DNA was extracted from the tail tissue of F0 mice, and the knock-in of exogenous fragments in their genome was identified by PCR amplification.

[0055] according to Figure 3 The PCR identification strategy in the method is as follows: first, primers 5'F and 5'R are used to perform PCR amplification on the 5'arm homologous recombination region. A 1558 bp fragment should be amplified in the positive genome, and no amplified fragment should be obtained in the negative genome; primers 3'F and 3'R are used to perform PCR amplification on the 3'arm homologous recombination region. A 1698 bp fragment should be amplified in the positive genome, and no amplified fragment should be obtained in the negative genome. Then, the full length of the knock-in fragment of the positive mouse is amplified by segmented PCR using primers Ⅰ and Ⅱ, primers Ⅲ and Ⅳ, primers Ⅴ and Ⅵ, primers VII and Ⅷ, primers IX and Ⅹ, and primers XI and Ⅻ. The lengths of the fragments amplified in the positive genome are: ① fragment 1898 bp, ② fragment 1916 bp, ③ fragment 1838 bp, ④ fragment 1967 bp, ⑤ fragment 1810 bp, and ⑥ fragment 1362 bp, and no amplified fragment should be obtained in the negative genome. The specific primers used for PCR identification are shown in Table 2.

[0056] Table 2. PCR primers for identification of F0 generation mice

[0057] The results of PCR identification of F0 mice are as follows Figure 4 As shown, mice No. 1 to No. 6, No. 8 and No. 9 failed to amplify the homology arm target fragment, while mouse No. 7 could amplify the homology arm target band, and could also amplify 6 target bands of fragments ① to ⑥ located within the knock-in fragment, that is, the positive F0 generation mouse was No. 7 (7#).

[0058] 2.2 PCR identification results of F1 mice Genomic DNA was extracted from the tail tissue of F1 mice and identified by PCR amplification.

[0059] according to Figure 5The F1 generation mice were identified by PCR according to the PCR identification strategy in , and the specific primers used are shown in Table 3. Primers 5`F and 5`R were used for PCR amplification of the 5`arm homologous recombination region, and a 1558 bp fragment should be amplified from the positive genome, and no amplified fragment should be amplified from the negative genome; primers 3`F and 3`R were used for PCR amplification of the 3`arm homologous recombination region, and a 1698 bp fragment should be amplified from the positive genome, and no amplified fragment should be amplified from the negative genome; primers KiF and KiR were used for PCR amplification of the knock-in fragment region, and a 11.5 kb fragment should be amplified from the positive genome (because the fragment is too large, it is shown as no band in the agarose gel electrophoresis diagram), and a 420 bp fragment should be amplified from the negative genome.

[0060] Table 3. PCR primers for identification of F1 mice

[0061] The results of PCR identification of F1 mice are as follows Figure 6 As shown, mice No. 8, 9, 12, 14, 15, and 17 can amplify the homology arm target band (and can also amplify the negative target band of the knock-in fragment region, so the genotype is determined to be knock-in heterozygous), and no knock-in homozygous F1 mice were found. The information of positive F1 mice is shown in Table 4.

[0062] Table 4. Information of positive F1 mice

[0063] 2.3 PCR identification results of F3 generation mice Genomic DNA was extracted from the tail tissue of F3 mice and identified by PCR amplification.

[0064] according to Figure 7 The PCR identification strategy in was used to perform PCR identification on F3 generation mice, and the specific primers used are shown in Table 5. PCR amplification was performed using primers F and R1, and primers F and R2, respectively. The PCR reaction of wild-type mice only obtained a single 420 bp band; the PCR reaction of knock-in heterozygous mice obtained 420 bp and 499 bp bands; the PCR reaction of knock-in homozygous mice only obtained a single 499 bp band (the identification of knock-in heterozygous was also applicable to the F2 generation).

[0065] Table 5. F3 generation mouse LSL-SARS SEMN Genotyping PCR primers

[0066] At the same time, according to Figure 8The Cre gene carrying status of F3 mice was identified by PCR using the PCR identification strategy in the previous article. The specific primers used are shown in Table 6. Using primers Fc and Rc for PCR amplification, a single 352 bp band was obtained in the PCR reaction of Cre-positive mice; no 352 bp band appeared in the PCR reaction of Cre-negative mice.

[0067] Table 6. Primers for PCR identification of Cre gene in F3 mice

[0068] The results of PCR identification of F3 mice are as follows Fig. 9 As shown, LSL-SARS retained in the F2 generation SEMN+ / - Cre + By breeding mice with brothers and sisters, we can obtain: LSL-SARS SEMN- / - Cre - , i.e. wild-type mice; LSL-SARS SEMN+ / - Cre + , that is, knock-in heterozygous and Cre-positive mice; LSL-SARS SEMN+ / + Cre + , i.e. knock-in homozygous and Cre-positive mice. In addition, LSL-SARS SEMN+ / + Cre - , that is, mice that are homozygous for the knock-in and Cre-negative.

[0069] 3. PCR identification and results of Cre enzyme action Although knock-in heterozygous and Cre-positive mice may be born in the F2 generation, it is not necessary to identify the role of the Cre enzyme in their bodies (specifically, the LSL element is removed according to the working principle of the Cre-Loxp system, so that the knock-in fragment is restored to an expression cassette structure that can normally express SARS-Cov2 S protein, E protein, M protein and N protein). After using the knock-in heterozygous and Cre-positive mice in the F2 generation as parents for brother-sister mating and breeding the F3 generation, the knock-in homozygous (or heterozygous) and Cre-positive mice in the F3 generation can be further identified by PCR to determine whether their Cre enzyme is working. At the same time, according to the system used Sftpc-IRES-iCre The Cre enzyme of the tool mice is specifically expressed in tissue cells (specifically type II alveolar epithelial cells in the lungs), and considering that it is not easy to extract type II alveolar epithelial cells in the lungs alone, the lung tissue of F3 mice (for example, F3 mice that are homozygous and Cre-positive) is selected to detect the role of the Cre enzyme.

[0070] The knock-in homozygous and Cre-positive (or Cre-negative) F3 mice were euthanized, and their lung tissues were collected to extract tissue DNA. Fig.10PCR identification was performed using the identification strategy in the previous article, that is, PCR amplification was performed using primers Postcre-F and Postcre-R. Cre played a role, and a 420 bp band appeared in the PCR reaction, that is, the excision of the LSL element in the knock-in fragment existed in the lung tissue cells, and the corresponding genotype was LSL-SARS SEMN+ / + Cre + F3 mice; Cre did not work, and a 2048 bp band appeared in the PCR reaction (no 420 bp band appeared), that is, the LSL element in the knock-in fragment was not removed, and the corresponding genotype was LSL-SARS SEMN+ / + Cre - The specific primers used for PCR identification are shown in Table 7.

[0071] Table 7. PCR identification primers

[0072] The identification results are as follows Fig.11 It should be noted that, since the mouse lung tissue contains other lung tissue cells in addition to type II alveolar epithelial cells, these cells do not have specific Cre enzymes, so LSL-SARS SEMN+ / + Cre + In addition to the obvious 420 bp band, mice also showed a faint 2048 bp band.

[0073] IV. Model evaluation of transgenic mice with lung tissue-specific expression of SARS-Cov2 structural proteins 4.1 Detection of LSL-SARS SEMN+ / - Cre + 、LSL-SARS SEMN+ / + Cre + Expression levels of SARS-Cov2 structural proteins in lung tissues of mice and control mice The genotype of F3 generation is LSL-SARS SEMN+ / - Cre + 、LSL-SARS SEMN+ / + Cre + mice and control mice (i.e., LSL-SARS SEMN+ / + Cre - The samples of mice were euthanized, and the lung tissues were taken to extract RNA. RT-qPCR detection was performed using specific primers for SARS-Cov2 S protein, E protein, M protein and N protein, and the expression of SARS-Cov2 structural proteins was analyzed at the mRNA level. The RT-qPCR primers used are shown in Table 8.

[0074] The results are as follows Fig.12 (A) Compared with the control group mice (i.e. LSL-SARS SEMN+ / + Cre - mice), LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN+ / + The lung tissues of mice showed obvious expression of SARS-Cov2 S protein, E protein, M protein and N protein. SEMN+ / + Cre + The expression level of SARS-Cov2 structural proteins in the lung tissue of mice was significantly higher than that of knock-in heterozygous and Cre-positive transgenic mice (i.e., LSL-SARS SEMN+ / - Cre + mice).

[0075] In addition, the F3 generation genotype is LSL-SARS SEMN+ / + Cre - 、LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN + / + Cre + Paraffin sections were made from the lung tissue of the mouse samples, and the expression of SARS-Cov2 structural proteins was detected by immunohistochemical staining. Since the inserted exogenous protein sequences (gene sequences of SARS-Cov2 S, E, M, and N proteins and the gene sequence of EGFP, which acts as a tracer) are all connected in series with cleavage peptides, these five exogenous proteins will be transcribed and translated at the same time. Therefore, the detection of EGFP expression can indicate the expression of the other four exogenous proteins. The results are as follows Fig.12 (B) Compared with the control group mice (i.e. LSL-SARS SEMN+ / + Cre - mice), LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN+ / + Cre + EGFP-positive areas can be clearly detected in the mouse lung tissue (indicated by black arrows in the figure), and LSL-SARS SEMN+ / + Cre + The expression intensity of mice is higher than that of LSL-SARS SEMN+ / - Cre + Mouse.

[0076] The above results show that the offspring of the transgenic mice that conditionally express SARS-Cov2 structural proteins can induce the specific expression of SARS-Cov2 structural proteins in the lung tissue of mice through the regulation of Cre enzyme, and the knock-in homozygous mice carrying the Cre gene (i.e., LSL-SARS SEMN+ / + Cre + mice) than heterozygous (i.e., LSL-SARS SEMN+ / - Cre + mice) showed higher expression intensity.

[0077] 4.2 Comparison of LSL and SARS SEMN+ / - Cre + 、LSL-SARS SEMN+ / + Cre + Lung tissue damage in mice and control group mice The genotype of F3 generation is LSL-SARS SEMN+ / - Cre + 、LSL-SARS SEMN+ / + Cre + mice and control mice (i.e., LSL-SARS SEMN+ / + Cre - The paraffin sections of lung tissues of samples from mice were stained with H&E to analyze the damage of mouse lung tissues. Fig.13 (A) Compared with the control group mice (i.e. LSL-SARS SEMN+ / + Cre - mice), LSL-SARS SEMN+ / - Cre + The mice showed certain alveolar hemorrhage, alveolar epithelial cell proliferation and necrosis, alveolar capillary proliferation, alveolar septum thickening, inflammatory cell infiltration (mainly neutrophils) and alveolar fusion, while LSL-SARS SEMN+ / + Cre + The mice showed more severe alveolar hemorrhage, alveolar epithelial cell proliferation and necrosis, alveolar capillary hyperplasia, alveolar septum thickening, inflammatory cell infiltration, alveolar fusion, and even lung collapse. The results showed that the characteristics of the lung lesions in these two Cre-positive mice were similar to the lung damage that occurs in humans after infection with SARS-Cov2 clinically (and the lesions were complete and easier to capture, and there was no interference caused by excessive bleeding). At the same time, LSL-SARS SEMN+ / + Cre + Lung injury in mice was more severe than that in LSL-SARS SEMN+ / - Cre + Mice are more typical, so knock-in homozygous and Cre-positive transgenic mice (i.e. LSL-SARS SEMN+ / + Cre +Mice) is a more accurate animal model for simulating lung injury after SARS-Cov2 infection.

[0078] In addition, RT-qPCR was used to analyze the expression of inflammatory factors in mouse lung tissue (the RT-qPCR primers used are shown in Table 9). Fig.13 (B) Compared with the control group mice (i.e. LSL-SARS SEMN+ / + Cre - Compared with mice, knock-in heterozygous Cre-positive transgenic mice (i.e., LSL-SARS SEMN+ / - Cre + mice) and knock-in homozygous and Cre-positive transgenic mice (i.e., LSL-SARS SEMN+ / + Cre + The expression of inflammatory factors IL-6 and IL-1β in the lung tissue of mice was significantly increased, and LSL-SARS SEMN+ / + Cre + The expression level of inflammatory factors in mouse lung tissue was significantly higher than that in LSL-SARS SEMN+ / - Cre + Mice. The results showed that LSL-SARS SEMN+ / - Cre + and LSL-SARS SEMN+ / + Cre + Mice can simulate the pulmonary inflammatory response after SARS-Cov2 infection, and the higher the expression level of SARS-Cov2 structural protein, the more severe the inflammatory response of lung tissue, that is, LSL-SARS SEMN+ / + Cre + The inflammatory response in the lung tissue of mice is more intense, and they can be used as an animal model for severe lung damage caused by SARS-Cov2 infection.

[0079] Table 8. RT-qPCR primers

[0080] Table 9. RT-qPCR primers for inflammatory factors

[0081] Note: Actin in Table 8 is an internal reference, and is also applicable to the internal reference of inflammatory factor RT-qPCR.

[0082] Therefore, the transgenic mice constructed above that specifically express SARS-Cov2 structural proteins in lung tissue can be used as an animal model to simulate lung damage after SARS-Cov2 infection.

[0083] V. Advantages of the present invention ① Different from the transient expression of exogenous proteins in mice mediated by adenovirus or adeno-associated virus, the mouse model of lung injury after SARS-Cov2 infection constructed by the present invention inserts the viral protein expression sequence into the mouse Rosa26 gene site through homologous recombination, so that the offspring mice obtained by breeding can stably carry the viral protein expression sequence. And with the increase of the expression of viral protein, the corresponding mouse lung tissue shows symptoms of lung injury from mild to severe (mainly including interstitial pneumonia, alveolar hemorrhage, thickening of alveolar septa, inflammatory cell infiltration dominated by neutrophils, alveolar fusion and lung collapse).

[0084] ② The mouse model of lung injury after simulating SARS-Cov2 infection constructed by the present invention can be used as an animal model of related basic diseases (such as interstitial pneumonia, ARDS) by itself or by further administering other disease-inducing factors into the mouse, thereby enriching the animal model library for SARS-Cov2 research.

[0085] ③ Since the mouse model of lung injury after simulating SARS-Cov2 infection constructed by the present invention does not involve infection with the whole (live) virus, it is not limited to conducting research in a biosafety level 3 (P3) laboratory in later applications, which is convenient for researchers to use.

[0086] ④ The present invention will provide convenient, reliable and abundant resource support for the research of SARS-Cov2, and provide guarantee for people to further understand the pathogenic mechanism of SARS-Cov2 and screen effective antiviral damage drugs.

Claims

1. A method for constructing an animal model of lung injury after simulating SARS-Cov2 infection, characterized in that: The construction method includes the following steps: A transgenic animal that conditionally expresses SARS-Cov2 structural proteins is prepared, wherein the structural proteins include S protein, E protein, M protein and N protein, and the structural proteins are expressed in the lungs of the offspring through the specific expression of Cre enzyme in the offspring of the transgenic animal, thereby obtaining an animal model of lung damage after simulating SARS-Cov2 infection.

2. The method for constructing an animal model of lung injury after simulating SARS-Cov2 infection according to claim 1, characterized in that: The construction method specifically comprises the following steps: 1) Insert the sequentially arranged Loxp-Stop-Loxp elements and the SARS-Cov2 structural protein gene tandem sequence into the wild-type mouse gene to obtain the LSL-SARS gene fragment integrated SEMN transgenic mice; 2) The transgenic mice obtained in step 1 were bred with lung tissue-specific Cre tool mice to obtain LSL-SARS SEMN Heterozygous and Cre-positive offspring were bred with each other to obtain transgenic mice that specifically expressed SARS-Cov2 structural proteins in lung tissue.

3. The method for constructing an animal model of lung injury after simulating SARS-Cov2 infection according to claim 2, characterized in that: In step 1, CRISPR / Cas9 technology is used to repair the mitochondria in wild-type mice by homologous recombination. Rosa26 An expression cassette containing a promoter, a Loxp-Stop-Loxp element, a tandem sequence of a SARS-Cov2 structural protein gene, a WPRE sequence and a termination sequence is inserted into the gene.

4. The method for constructing an animal model of lung injury after simulating SARS-Cov2 infection according to claim 3, characterized in that: The homologous recombination repair is performed on the double-stranded breaks of genomic DNA caused by the cleavage activity of the Cas9 protein at the target site under the guidance of the gRNA, wherein the target site is located at Rosa26 The intronic region between exons 1 and 2 of a gene.

5. The method for constructing an animal model for simulating lung injury after SARS-Cov2 infection according to claim 4, characterized in that: The target site is selected from the group consisting of Rosa26 Either or both of the gene loci: SEQ.ID.NO.1: 5'—CTAACTTCCCATGGCTTAAATGG—3' SEQ.ID.NO.2: 5'—TTCCCATGGCTTAAATGGCATGG—3'; The donor vector used in the homologous recombination repair comprises a 1.0-1.5 kb homology arm arranged at the 5' end of the promoter and a 1.0-1.5 kb homology arm arranged at the 3' end of the termination sequence.

6. A method for preparing a transgenic animal that conditionally expresses SARS-Cov2 structural protein, characterized in that: The preparation method comprises the following steps: The gene sequence of SARS-Cov2 structural protein and the Cre-Loxp system elements for regulating the expression of the gene sequence are inserted into the genome of the experimental animal, thereby obtaining a transgenic animal that conditionally expresses SARS-Cov2 structural protein, wherein the structural protein includes S protein, E protein, M protein and N protein.

7. The method for preparing a transgenic animal that conditionally expresses SARS-Cov2 structural protein according to claim 6, characterized in that: The preparation method specifically comprises the following steps: inserting the sequentially arranged Loxp-Stop-Loxp elements and the SARS-Cov2 structural protein gene tandem sequence into the wild-type mouse gene to obtain a gene fragment LSL-SARS SEMN of transgenic mice.

8. Use of the method for preparing a transgenic animal that conditionally expresses SARS-Cov2 structural protein as claimed in claim 6 or 7 in constructing an animal model of lung injury after simulating SARS-Cov2 infection.

9. Use of the method for preparing a transgenic animal conditionally expressing SARS-Cov2 structural protein as claimed in claim 6 or 7 in constructing an interstitial pneumonia animal model.

10. Use of the method for preparing a transgenic animal conditionally expressing a SARS-Cov2 structural protein according to claim 6 or 7 in constructing an animal model of acute respiratory distress syndrome.

Images