Application of CITED1 in the diagnosis, prognosis and treatment of cholangiocarcinoma

Abstract

The present invention relates to the field of biomedical technology, and specifically to the application of CITED1 in the diagnosis and prognosis evaluation of bile duct cancer and the treatment of bile duct cancer. The present invention provides the application of CITED1 gene or protein in the preparation of a detection reagent or composition, which is (i) used to detect whether bile duct cancer is present; (ii) used to detect the risk of bile duct cancer; (iii) used for the prognosis evaluation of bile duct cancer patients. The present invention provides the application of the detection reagent or composition in the preparation of a kit for detecting whether bile duct cancer is present or for detecting the risk of bile duct cancer or for the prognosis evaluation of bile duct cancer patients, and the application of CITED1 inhibitors in the preparation of drugs for the treatment of bile duct cancer. The inventors found that CITED1 is highly expressed in bile duct cancer samples and is significantly negatively correlated with the disease-free survival period of patients. Its high expression promotes the proliferation and metastasis of bile duct cancer cells. It is found that the CITED1 inhibitor Cvt‑313 can effectively inhibit its interaction with p300, thereby inhibiting the expression of the target gene β‑catenin. The present invention opens up a new direction for personalized treatment of bile duct cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of CITED1 in the diagnosis and prognosis evaluation of cholangiocarcinoma and the treatment of cholangiocarcinoma. Background Art

[0002] Cholangiocarcinoma (CCA) is an aggressive malignant tumor arising from different locations in the biliary system and is highly lethal. Cholangiocarcinoma is the second most common primary liver malignancy after liver cancer, accounting for about 15% of all primary liver cancers. Although cholangiocarcinoma is rare, its incidence and mortality have continued to rise worldwide in the past few decades (the incidence of cholangiocarcinoma is 0.3-6 / 100,000 people per year, and the mortality rate is 1-6 / 100,000 people), especially in South Korea, China and Thailand, where the annual incidence of cholangiocarcinoma is as high as 6 / 100,000 people. Unfortunately, cholangiocarcinoma is difficult to detect in the early stages, and it is already in the middle and late stages when it is discovered. The current literature does not have enough research on the molecular mechanism of cholangiocarcinoma, and no molecular targets that are effective for clinical treatment have been found. Therefore, finding genes related to the occurrence and development of cholangiocarcinoma is of great significance for the mechanism research of cholangiocarcinoma and clinical diagnosis and treatment.

[0003] CBP / p300 interacting transcription activator with glutamate / aspartate carboxy-terminal domain 1 (CITED1) encodes a member of the CRED binding protein / p300 family of transactivators that interact with an Asp / Glu-rich C-terminal domain. The encoded protein is also known as melanocyte-specific gene 1. CITED1 is a non-DNA-binding transcriptional cofactor with two known functional domains: the SMAD-4 interaction domain and the conserved region 2 (CR2). On its carboxy-terminal domain CR2, CITED1 protein directly binds to the CBP / p300 transcriptional integrator to co-regulate HIF-1, Hsc70, and β-catenin. Binding of the CITED1-CR2 domain to the CBP / p300 complex is required to promote its transactivation properties and specific transcriptional responses. CITED1 has also been shown to activate transforming growth factor β (TGF-β)-dependent transcription through its second known functional domain, SID. Functionally, CITED1 is known to stimulate Smad4-dependent transcriptional responses of the TGF-β superfamily while inhibiting Wnt / β-catenin signaling. During kidney development, CITED1 may regulate specific cellular functions of the metanephric mesenchyme by providing a transcriptional "switch" to coordinate mesenchymal survival and epithelial differentiation. CITED1 was identified as a transcriptional cofactor that regulates the mesenchymal-epithelial transition. Summary of the invention

[0004] In order to overcome the defects and shortcomings in the prior art, the present invention provides the application of CITED1 in the diagnosis and prognosis evaluation of cholangiocarcinoma and the treatment of cholangiocarcinoma.

[0005] Specifically, the present invention is realized through the following technical solutions:

[0006] In a first aspect, the present invention provides the use of a CITED1 gene or protein in preparing a detection reagent or composition, wherein the detection reagent or composition is used for one or more applications selected from the following:

[0007] (i) To detect bile duct cancer;

[0008] (ii) for the detection of risk of bile duct cancer; or

[0009] (iii) Used for prognostic assessment of patients with cholangiocarcinoma.

[0010] In certain embodiments, the CITED1 gene comprises CITED1 mRNA or CITED1 cDNA.

[0011] In certain embodiments, the "CITED1 gene or protein" of the present invention refers to the nucleotide sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, and SEQ ID No.4 and the corresponding encoded proteins shown in SEQ ID No.5 and SEQID No.6, as well as the protein complex purified in the eukaryotic system.

[0012] The CITED1 gene has four transcripts (SEQ ID No.1-4). Due to the presence of two optional exons, transcript 2 (SEQ ID No.2) has a unique 5' untranslated region and 5' coding region. These differences lead to translation initiation at the upstream start codon AUG, resulting in a longer N-terminus compared to transcript 1 (SEQ ID No.1). Transcript 3 (SEQ ID No.3) and transcript 4 (SEQ ID No.4) are different from transcript 1 in 5'UTR. Transcripts 1, 3, and 4 encode the same protein with a CDS number of CCDS14419.1 (SEQ ID No.5), and the CDS number of the protein encoded by transcript 2 is CCDS48136.1 (SEQ IDNo.6).

[0013] In certain embodiments, the prognostic assessment is a prognostic assessment of a patient with cholangiocarcinoma after chemotherapy treatment.

[0014] In certain embodiments, the prognostic assessment comprises predicting the survival time of a cholangiocarcinoma patient after receiving treatment.

[0015] In certain embodiments, the protein comprises a full-length protein or a protein fragment.

[0016] In certain embodiments, the detection reagent includes a specific antibody, a binding molecule, an amplification primer, a probe, a nucleic acid chip (such as a DNA chip) or a protein chip of CITED1.

[0017] In certain embodiments, the detection reagent is conjugated to or carries a detectable label.

[0018] In certain embodiments, the detectable label is selected from the group consisting of a chromophore, a chemiluminescent group, a fluorophore, an isotope, or an enzyme.

[0019] In certain embodiments, the antibody is a monoclonal antibody or a polyclonal antibody.

[0020] In certain embodiments, the nucleic acid chip comprises a substrate and specific oligonucleotide probes spotted on the substrate, wherein the specific oligonucleotide probes comprise probes that specifically bind to CITED1 polynucleotides (mRNA or DNA).

[0021] In certain embodiments, the protein chip comprises a substrate and specific antibodies spotted on the substrate, and the specific antibodies comprise specific antibodies against CITED1.

[0022] In certain embodiments, the detection is of an ex vivo sample.

[0023] In certain embodiments, the ex vivo sample includes: a tissue sample, a body fluid sample, a cell sample, a blood sample, or a combination thereof.

[0024] In certain embodiments, the cell samples include: bile duct cancer cell samples, bile duct cancer paracancerous cell samples and normal bile duct cell samples.

[0025] In certain embodiments, the cholangiocarcinoma includes intrahepatic adenocarcinoma (iCCA), perihilar adenocarcinoma (pCCA), and distal adenocarcinoma (dCCA).

[0026] In a second aspect, the present invention provides the use of the detection reagent or composition described in the first aspect in the preparation of a kit for detecting whether a patient has cholangiocarcinoma or for detecting the risk of cholangiocarcinoma or for evaluating the prognosis of cholangiocarcinoma patients.

[0027] In certain embodiments, the kit includes a detection reagent for detecting the CITED1 gene or protein or a combination thereof.

[0028] In certain embodiments, the CITED1 gene comprises CITED1 mRNA or CITED1 cDNA.

[0029] In certain embodiments, the kit further includes a label instruction, wherein the label or instruction indicates that the kit is used to detect whether a patient has bile duct cancer or to detect the risk of bile duct cancer or to evaluate the prognosis of bile duct cancer patients.

[0030] In certain embodiments, the kit further comprises CITED1 gene and / or protein as a reference substance or quality control substance.

[0031] In certain embodiments, the method for detecting whether bile duct cancer has occurred or for detecting the risk of bile duct cancer or for evaluating the prognosis of bile duct cancer patients refers to detecting whether bile duct cancer has occurred, the location of occurrence, and / or determining the possibility (susceptibility) of developing bile duct cancer.

[0032] In some embodiments, the judgment comprises a prejudgment (prediction).

[0033] In certain embodiments, when the kit is used to detect whether or not a person has bile duct cancer or the risk of bile duct cancer, the label or instructions state the following:

[0034] If the CITED1 expression level of the test subject is significantly higher than the control expression level, the subject suffers from bile duct cancer or has a higher risk of suffering from bile duct cancer than a normal person, or the bile duct cancer of the subject has metastasized or has a high risk of bile duct cancer metastasis.

[0035] In certain embodiments, the control expression level is the CITED1 concentration in the same sample from a normal population, or the CITED1 concentration in the same sample from a general cancer patient population except for cholangiocarcinoma patients.

[0036] In a third aspect, the present invention provides use of a CITED1 inhibitor in the preparation of a medicament for preventing and / or treating cholangiocarcinoma.

[0037] In certain embodiments, the cholangiocarcinoma includes intrahepatic adenocarcinoma (iCCA), perihilar adenocarcinoma (pCCA), and distal adenocarcinoma (dCCA).

[0038] In certain embodiments, the CITED1 inhibitor is a neutralizing antibody, a small molecule compound, an antisense nucleic acid, or a combination thereof.

[0039] In certain embodiments, the CITED1 inhibitor is an antisense nucleic acid or a small molecule compound.

[0040] In certain embodiments, the antisense nucleic acid is siRNA.

[0041] In certain embodiments, the siRNA is shCITED1, and the nucleotide sequence of the shCITED1 is shown in SEQ ID No.7.

[0042] In certain embodiments, the small molecule compound is Cvt-313, Millewanin G, or hydrangea phenol 8-O-glucoside.

[0043] In certain embodiments, the small molecule compound is Cvt-313.

[0044] In certain embodiments, the medicament comprises a CITED1 inhibitor and a pharmaceutically acceptable carrier.

[0045] In certain embodiments, in the drug, the CITED1 inhibitor accounts for 0.1-99.9 wt %, preferably 10-99.9 wt %, and more preferably 70-99.9 wt % of the total weight of the drug.

[0046] In certain embodiments, the drug is in liquid, solid or semisolid form.

[0047] In certain embodiments, the drug is in the form of an oral dosage form or an injection.

[0048] In certain embodiments, the dosage form of the drug includes tablets, granules, capsules, oral solutions or injections.

[0049] In certain embodiments, the drug is in liquid dosage form.

[0050] In certain embodiments, the drug is an oral preparation.

[0051] In certain embodiments, the carrier is selected from the following group: an infusion carrier and / or an injection carrier. Preferably, the carrier is one or more carriers selected from the following group: physiological saline, glucose saline or a combination thereof.

[0052] The present invention has the following effects compared with the prior art:

[0053] The inventors found that CITED1 is highly expressed in cholangiocarcinoma samples, and cholangiocarcinoma patients with low CITED1 expression have a longer disease-free survival period. CITED1 promotes the proliferation and metastasis of cholangiocarcinoma cells. The present invention also predicts the three-dimensional structure, active site, active pocket and possible inhibitors of CITED1 protein. At the same time, related experiments verify that CITED1 inhibitor Cvt-313 can effectively inhibit the binding of CITED1 to p300 and inhibit the expression of target gene β-catenin. The present invention opens up a new direction for personalized treatment of cholangiocarcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] In order to more clearly illustrate the specific implementation manner of the present invention or the technical solution in the prior art, the drawings required for describing the specific implementation manner are briefly introduced below.

[0055] Figure 1The expression difference of CITED1 in cholangiocarcinoma and normal tissues provided by the embodiment of the present invention is shown. A. The data are derived from the data of normal tissues and cholangiocarcinoma tissues in the TCGA database, where * indicates p<0.05, ** indicates p<0.01, *** Indicates p < 0.001. B. ROC curve, showing that the expression of CITED1 in the TCGA database cholangiocarcinoma data set can well predict the survival of cholangiocarcinoma patients, p < 0.001.

[0056] Figure 2 The expression levels of CITED1 in the GEO database and clinical samples provided by the embodiments of the present invention are shown. A. In the cholangiocarcinoma dataset downloaded from the GEO database, CITED1 is highly expressed in cholangiocarcinoma tissues, where * indicates p<0.05, ** indicates p<0.01, *** Indicates p<0.001; B. Clinical cholangiocarcinoma and adjacent paracancerous samples were collected, and the expression level of CITED1 was detected by immunoblotting.

[0057] Figure 3 It shows that high expression of CITED1 provided in the embodiment of the present invention promotes the proliferation of cholangiocarcinoma cells, while low expression inhibits the proliferation of cholangiocarcinoma cells. The figure shows that after interfering with CITED1, the cell proliferation ability is reduced, and after overexpressing CITED1, the cell proliferation ability is significantly enhanced.

[0058] Figure 4 It is shown that after the interference with CITED1 provided by the embodiments of the present invention, the number of clones formed by cell clones is reduced.

[0059] Figure 5 It is shown that high expression of CITED1 provided in the embodiment of the present invention promotes the metastasis of cholangiocarcinoma cells, while low expression inhibits the metastasis of cholangiocarcinoma cells.

[0060] Figure 6 It is shown that the patients with low expression of CITED1 provided by the embodiments of the present invention have a longer disease-free survival period.

[0061] Figure 7 It was shown that knocking down CITED1 in the cholangiocarcinoma cell line provided in the embodiment of the present invention enhanced the sensitivity to cisplatin, indicating that knocking down CITED1 can synergize with chemotherapy drugs in anti-tumor.

[0062] Figure 8 The predicted three-dimensional structure diagram, active site and active pocket of the CITED1 protein provided in the embodiments of the present invention are shown.

[0063] Fig. 9The three-dimensional structures of the first three most likely CITED1 inhibitors obtained by screening provided in the embodiments of the present invention: Cvt-313, Millewanin G, and hydrangea phenol 8-O-glucoside, docked with the CITED1 protein, respectively.

[0064] Fig.10 The screening and verification of CITED1 inhibitors provided in the embodiments of the present invention are shown. Since the three predicted inhibitors Cvt-313, Millewanin G, and hydrangea phenol 8-O-glucoside bind to CITED1 in the CR2 domain, which is the direct binding domain of CITED1 and p300, these inhibitors will affect the binding of CITED1 and p300. A. In the MM-GBSA calculation analysis, the top three natural products with the lowest scores interfere with the binding of CITED1 and p300; B. 5μM, 10μM, and 20μM Cvt-313 were added to the cholangiocarcinoma HUCCT1 cell line, and the cells were harvested 12 hours later to detect the interaction between CITED1 and p300; C. CITED1 interacts with p300 to synergistically transcribe the expression of the target gene β-catenin. The cholangiocarcinoma HUCCT1 cell line was treated with 5μM, 10μM, and 20μM Cvt-313, respectively. The cells were harvested 24 hours later and the expression of related proteins was detected by immunoblotting to determine whether the inhibitor affected the expression of the target gene β-catenin. DETAILED DESCRIPTION

[0065] According to the following embodiments, the present invention can be better understood. It is easy for those skilled in the art to understand that the contents described in the embodiments are only used to illustrate and explain the present invention, and are not used to limit the present invention described in detail in the claims. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional methods unless otherwise specified, and the test materials used can be obtained from commercial companies unless otherwise specified.

[0066] Example 1

[0067] The expression difference of CITED1 gene in cholangiocarcinoma tissue and normal tissue was obtained from TCGA database. Figure 1 As shown in the figure, CITED1 gene is significantly highly expressed in cholangiocarcinoma tissue, p<0.01. The expression of CITED1 gene and the survival period and survival status of patients in the TCGA database were extracted, and the ROC curve was drawn using MEDCalc software. As shown in the figure, the area under the ROC curve in the prediction model is 0.906, p<0.001, indicating that CITED1 gene can well predict the survival of cholangiocarcinoma patients.

[0068] Example 2

[0069] We further obtained a cholangiocarcinoma dataset from the GEO database to analyze the expression level of the CITED1 gene in cholangiocarcinoma tissues and normal tissues. Figure 2 As shown in the figure, it was found that in the GSE26566 dataset, the CITED1 gene was highly expressed in cholangiocarcinoma tissues, p<0.05. At the same time, two cholangiocarcinoma (CCA) tissues and normal bile duct tissues were collected, proteins were extracted, and the expression levels of CITED1 and internal reference GAPDH were detected by Western blotting. The results showed that CITED1 was significantly underexpressed in cholangiocarcinoma tissues.

[0070] Example 3

[0071] The shSCR (negative control) and shCITED1, vector (empty control) used in the experiment, CITED1 is the corresponding viral vector purchased from Shanghai Jima Company. shCITED1 is a viral vector that interferes with CITED1, the nucleotide sequence of shCITED1 is GCAGAATCACTCTCTCCTTCT (SEQ ID No.7), and CITED1 is a viral vector that overexpresses CITED1. Polybrene was used to infect the human intrahepatic cholangiocarcinoma HUCCT1 cell line (purchased from Shanghai Cell Bank), and puromycin was added to screen out cells stably infected with the virus, and then the EdU experiment was performed, the steps are as follows:

[0072] Four cell lines stably expressing CITED1, interfering with CITED1, and corresponding controls were passaged and counted when they were in the logarithmic growth phase, with 1×10 5 The cells were seeded into 6-well plates at a density of 100 μg / mL. After the cells adhered overnight, 5-ethynyl-2'-deoxyuridine (EdU) was added and incubated for 2 hours. The cells were washed twice with PBS, decolorized with 4% paraformaldehyde and fixed on a shaker for 30 minutes. 2 mg / mL glycine was added and incubated for 5 minutes. The paraformaldehyde was neutralized, and the permeabilization agent was added and incubated for 10 minutes. The cells were washed twice with PBS, and 1×Apollo staining reaction solution was added. The cells were dehydrated and incubated on a shaker at room temperature in the dark for 30 minutes. The permeabilization agent was added and washed 2-3 times, each time for 10 minutes. DAPI was added for staining for 10 minutes. The cells were washed 2-3 times with PBS and observed and photographed under a fluorescence microscope.

[0073] The results are as follows Figure 3 As shown, compared with the control, the cell proliferation ability was significantly reduced after CITED1 interference, and the cell proliferation ability was significantly enhanced after CITED1 overexpression.

[0074] Example 4

[0075] HUTT1 human intrahepatic cholangiocarcinoma cells (purchased from Shanghai Cell Bank) with stable interference of CITED1 and corresponding control cells were analyzed for clone formation ability. The specific steps are as follows: the cells were counted and transferred to a 6-well plate, 5,000 cells per well, cultured in a 37°C incubator for 10-14 days, the medium was changed every two days, and the cells were washed twice with PBS when harvested, fixed with 4% paraformaldehyde at room temperature for 10 minutes, washed twice with PBS, stained with 0.1% crystal violet staining solution for 20 minutes, rinsed with PBS and photographed for observation.

[0076] The results are as follows Figure 4 As shown, after interfering with CITED1, the number of clones formed by cholangiocarcinoma cells was significantly reduced and the cell proliferation ability was significantly decreased.

[0077] Example 5

[0078] The human intrahepatic cholangiocarcinoma cell line HUCCT1 cells stably expressing shSCR (negative control) and shCITED1 were used in the experiment. The trans-well experiment was performed as follows:

[0079] First, the chamber was placed in a culture plate, serum-free medium was added to rehydrate the matrix gel, and then the cells were digested and 2×10 4 Resuspend the cells in 300 μL serum-free medium and inject into the upper chamber, add 500 μL serum-containing medium to the lower chamber of the 24-well well, and ensure that there are no bubbles between the chamber and the lower medium. Culture the cells for 12-48 hours, then fix the cells with paraformaldehyde for 30 minutes, wash twice with PBS, add crystal violet staining for 20 minutes, wash twice with PBS, dry, and observe and count under an inverted microscope.

[0080] The results are as follows Figure 5 As shown in the figure, the invasive ability of cholangiocarcinoma cells was significantly reduced after interfering with CITED1.

[0081] Example 6

[0082] The disease-free survival of patients with cholangiocarcinoma in the TCGA database was analyzed. Figure 6 As shown, it was found that the disease-free survival of patients with high CITED1 expression was reduced, with a p value of 0.00011, indicating a significant difference.

[0083] Example 7

[0084] The cholangiocarcinoma HUTT1 cell line in the logarithmic growth phase was subcultured and cultured at 1×10 4 / mL density was inoculated in a 96-well plate, 100 μL of cell suspension was added to each well, and cisplatin was added after overnight adherence. After 24 hours of co-culture, CCK8 solution was added under light-proof conditions, and the cells were incubated in a 37°C incubator for 2 hours. The OD value was measured at a wavelength of 450 nm using a microplate reader.

[0085] The results are as follows Figure 7 As shown in Figure 2, after interfering with CITED1, the sensitivity of the cholangiocarcinoma HUTT1 cell line to cisplatin was significantly enhanced, and the IC of cisplatin in the control cells was 50 The value is 34.67 μM, which is the IC value of cisplatin in cells that interfere with CITED1. 50 The value is 13.44 μM.

[0086] Example 8

[0087] Example 8 is the prediction of the crystal structure and active pocket of CITED1. For human CITED1, the amino acid sequence was obtained through uniprot, and AlphaFold3 was used to predict the protein crystal structure. The AlphaFold3 module on GitHub was installed using pip install alphafold3, and the corresponding AlphaFold3 code was run on the server in sequence. The amino acid sequence corresponding to the CITED1 protein was input, and the parameters were set to the default parameters to predict the protein and obtain the protein crystal. For active site identification, the SiteMap module in Schrödinger was first used to predict the best binding site, and then the Receptor Grid Generation module in Schrödinger was used to set the most appropriate Enclosing box to perfectly wrap the predicted binding site, and on this basis, the active site of the CITED1 protein was obtained. Based on SiteMap, the 3D structure and active site of CITED1 are predicted. The white dots are the active sites, and the red boxes are where the active pockets are located (see Figure 8 ).

[0088] Example 9

[0089] In Example 9, CITED1 inhibitors and their docking sites with CITED1 were screened. Comprehensive natural product compound libraries (TargetMol·Natural Compound Library, MedChemExpress·Natural Product Library, Pharmacodia (Drug Crossing) Natural Product Library, BioBioPhaBBP (West Force) Natural Product Library), anti-tumor compound library (APExBIO·Anti-cancer-Compound-Library Plus) and FDA library (Selleck·FDA-Approved Drug Library), molecular docking was performed based on the active site of CITED1 (HTVS, SP and XP were used respectively, and the docking accuracy was gradually improved). The lower the score, the lower the binding free energy of the compound with the protein, and the higher the binding stability. The lowest scoring ligand was subjected to MM-GBSA calculation analysis with the active site of CITED1 protein. The lower the score, the higher the binding stability of the ligand with CITED1 protein. The top three compounds with the lowest score were selected for the next step of verification. Further molecular docking results showed that the three natural products (Cvt-313, Millewanin G, and hydrangea phenol 8-O-glucoside) all bind to CITED1 (e.g. Fig. 9 shown).

[0090] Example 10

[0091] In Example 10, the function of CITED1 inhibitor was verified. CITED1 and / or p300 plasmids were transfected into 293T cells, and the above selected potential compounds (Cvt-313, Millewanin G, hydrangea phenol 8-O-glucoside) were added for treatment 24 hours later. After 12 hours, the cells were harvested for immunoprecipitation experiments to detect the interaction ability of the two proteins. The results showed that the natural product Cvt-313 could interfere with the interaction between CITED1 and p300 (see Fig.10 A), endogenous immunoprecipitation assay also confirmed that Cvt-313 could interfere with the interaction between CITED1 and p300 in a significant dose-dependent manner (see Fig.10 B). Then, we verified the effect of Cvt-313 on tumor cell pathways. First, in cholangiocarcinoma cells (see Fig.10 C) The expression level of β-catenin in tumor cells was detected by Cvt-313, which proved that the inhibition of β-catenin by Cvt-313 was dose-dependent ( Fig.10 C).

[0092] Finally, it was confirmed that the natural product Cvt-313 could significantly inhibit the activation of β-catenin after cisplatin chemotherapy, suggesting that Cvt-313 can indeed act as a CITED1 inhibitor, inhibiting the interaction between CITED1 and p300, thereby inhibiting the expression of β-catenin and enhancing anti-tumor immunity.

[0093] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of CITED1 gene or protein in the preparation of a detection reagent or composition, characterized in that: The detection reagent or composition is used for one or more applications selected from the following: (i) To detect bile duct cancer; (ii) for the detection of risk of bile duct cancer; or (iii) Used for prognostic assessment of patients with cholangiocarcinoma.

2. The use according to claim 1, characterized in that: The detection reagent or composition comprises: (a) a specific antibody or a specific binding molecule to CITED1; and / or (b) Primers or primer pairs, probes or chips for specifically amplifying CITED1 mRNA or CITED1 cDNA.

3. The use according to claim 1 or claim 2, characterized in that: CITED1 is highly expressed in cholangiocarcinoma samples. Cholangiocarcinoma patients with low CITED1 expression have a longer disease-free survival. CITED1 promotes the proliferation of cholangiocarcinoma cells, leading to a poor prognosis.

4. Use of the detection reagent or composition according to any one of claims 1 to 3 in the preparation of a kit for detecting whether a patient has cholangiocarcinoma or for detecting the risk of cholangiocarcinoma or for evaluating the prognosis of a cholangiocarcinoma patient, characterized in that: The kit includes a detection reagent for detecting CITED1 gene or protein or a combination thereof.

5. The use according to claim 4, characterized in that: The kit also includes a label or instructions, which indicates that the kit is used to detect whether a person has bile duct cancer or to detect the risk of bile duct cancer or to evaluate the prognosis of bile duct cancer patients.

6. The use according to claim 4, characterized in that: The kit also includes CITED1 gene and / or protein as a reference substance or quality control substance.

7. Use of CITED1 inhibitors in the preparation of drugs for preventing and / or treating cholangiocarcinoma.

8. The use according to claim 7, characterized in that: The drug uses a CITED1 inhibitor as an active ingredient and is supplemented with pharmaceutically acceptable excipients.

9. The use according to claim 7, characterized in that: The CITED1 inhibitor is a neutralizing antibody, a small molecule compound, an antisense nucleic acid or a combination thereof.

10. The use according to claim 9, characterized in that: The antisense nucleic acid is siRNA, the siRNA is shCITED1, the nucleotide sequence of the shCITED1 is SEQ ID No. 7, and the small molecule compound is Cvt-313, Millewanin G or hydrangea phenol 8-O-glucoside.

Images