A preparation for optimizing sperm function through an extracellular vesicle pathway, a preparation method, and its application in a sperm damage repair system

Abstract

The present invention belongs to the field of biomedicine technology, and specifically relates to a preparation, preparation method and application in a sperm damage repair system for optimizing sperm function through an extracellular vesicle pathway. The method comprises the following steps: step one, constructing a plasmid; step two, cell transfection and construction of a cell line; step three, isolating exosomes. In step one, constructing a plasmid comprises first amplifying the SKAP2-CDS sequence from a PCR reaction of cDNA; and then inserting the SKAP2-CDS sequence into a PHY-GFP plasmid between BamHI and EcoRI sites to obtain a recombinant plasmid. In the present invention, drawing on the influence of seminal plasma extracellular vesicle proteins on sperm function, exosome modification technology is adopted to express the key protein SKAP2 in seminal plasma extracellular vesicles into engineered exosomes. In vitro sperm addition culture can effectively improve sperm motility, capacitation and acrosome reaction, thereby improving sperm function.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to preparations, preparation methods, and applications in sperm damage repair systems that optimize sperm function via the extracellular vesicle pathway. Background Art

[0002] Oxidative stress is a major cause of male infertility. Under oxidative stress, excessive reactive oxygen species can pathologically affect sperm, leading to decreased sperm density, reduced motility, reduced fertilization, and even apoptosis. The mechanism involves not only damaging the sperm membrane, mitochondria, and nuclear DNA integrity but also causing epigenetic alterations. Seminal plasma extracellular vesicles have a positive regulatory effect on sperm motility, capacitation, and acrosome response, and can promote sperm damage repair. Therefore, the development of formulations that optimize sperm function and the establishment of sperm damage repair systems using these formulations are of significant auxiliary research value for improving sperm damage and enhancing sperm motility in patients with asthenospermia in vitro. Summary of the Invention

[0003] To address the aforementioned technical problems, the present invention aims to provide a formulation that optimizes sperm function via the extracellular vesicle pathway, and to establish a sperm damage repair system to facilitate auxiliary research in the treatment of male infertility, such as related drug development research.

[0004] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0005] A method for preparing a formulation that optimizes sperm function via the extracellular vesicle pathway includes the following steps:

[0006] Step 1: Construct plasmids;

[0007] The SKAP2-CDS sequence was amplified from cDNA using a PCR (polymerase chain reaction).

[0008] The SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between the BamHI and EcoRI sites to obtain the recombinant plasmid;

[0009] Step 2: Cell transfection and cell line construction;

[0010] First, recombinant plasmids were transfected using EZ transfection reagent, and then HEK293T cells were transfected using the recombinant plasmid product. After transfection, the cells were centrifuged and the supernatant was collected.

[0011] HEK293T cells were cultured using the collected supernatant and an equal volume of fresh culture medium. After culture, the HEK293T cells were transferred to a medium containing 1 μg / mL puromycin for further culture. After further culture, the HEK293T cells were transferred to a medium containing 0.5 μg / mL puromycin for subsequent culture to obtain the cell line.

[0012] Step 3: Isolate exosomes;

[0013] The cell line was expanded and cultured. After expansion and culture, the cells were washed and cultured again in serum-free medium. After culture, the supernatant was collected. The supernatant was centrifuged, filtered, concentrated, and PBS was added to the concentrate for further concentration to obtain an exosome suspension.

[0014] The exosome suspension is a preparation that optimizes sperm function via the extracellular vesicle pathway.

[0015] Preferably, in step one, the cDNA includes human cDNA and mouse cDNA;

[0016] The human SKAP2-CDS sequence was obtained by PCR amplification of human cDNA, and the mouse SKAP2-CDS sequence was obtained by PCR amplification of mouse cDNA.

[0017] The sequence of the forward primer of the human SKAP2-CDS is shown in SEQ ID NO.1: 5'-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCAGCACCTCCT-3';

[0018] The reverse primer sequence for human SKAP2-CDS is shown in SEQ ID NO.2: 5'-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTATGTAG-3';

[0019]

[0020] The sequence of the mouse SKAP2-CDS forward primer is shown in SEQ ID NO.4: 5'-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCTGTACCTCTT-3';

[0021] The sequence of the mouse SKAP2-CDS reverse primer is shown in SEQ ID NO.5: 5'-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTAGGTAG-3';

[0022]

[0023] Preferably, in step one, the PCR reaction system includes: 2×PhantaMax MasterMix, upstream primer, downstream primer, cDNA template, DNA polymerase, and deionized water, and the PCR reaction program includes: pre-deformation, denaturation, annealing, extension, cycling, and complete extension.

[0024] Preferably, in step one, the process of inserting the SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites includes: double digesting the PCR product of SKAP2 and the PHY-GFP plasmid with BamHI and EcoRI restriction enzymes, respectively, and using DNA ligase to ligate the digested target gene fragment with the plasmid fragment to form a recombinant plasmid.

[0025] Preferably, in step two, the cell transfection process specifically includes:

[0026] (1) Recombinant plasmid transfection using EZ transtransfection reagent: Dilute EZ Trans transfection reagent into serum-free high-glucose DMEM medium, mix well to obtain diluted transfection reagent; dilute recombinant plasmid DNA into serum-free high-glucose DMEM medium, mix well, add diluted transfection reagent, mix well, incubate at room temperature for 15 min to complete recombinant plasmid transfection, forming EZ Trans-DNA complex, i.e. recombinant plasmid product;

[0027] (2) The EZ Trans-DNA complex was dropped into a culture dish containing HEK293T cells, dispersed evenly, and co-incubated to transfect the cells.

[0028] Preferably, the present invention also discloses a method for preparing another formulation that optimizes sperm function via the extracellular vesicle pathway, comprising the following steps:

[0029] Step (1): Extract milk-derived exosomes;

[0030] The milk is centrifuged for the first time, and the supernatant is collected. The supernatant is then centrifuged for the second time, and the supernatant is collected again. The supernatant is then centrifuged for the third time, and the precipitate is collected, washed, and filtered to obtain an exosome suspension. The exosome suspension is the milk-derived exosome.

[0031] Step (2): Exosomal protein coating;

[0032] Milk-derived exosomes were loaded onto SKAP2 protein using an ultrasound system: milk-derived exosomes and SKAP2 protein were mixed in PBS at a mass ratio of 1:1, and after ultrasound treatment, incubation was performed to obtain SKAP2 protein-coated milk-derived exosomes; the SKAP2 protein-coated milk-derived exosomes are a preparation for optimizing sperm function via the extracellular vesicle pathway.

[0033] Preferably, in step (1): the first centrifugation is performed at 4°C and centrifugation force of 13000xg for 25-35 minutes; the second centrifugation is performed at 4°C and centrifugation force of 100000xg for 50-70 minutes; and the third centrifugation is performed at 4°C and centrifugation force of 145000xg for 80-100 minutes.

[0034] Preferably, in step (2): the ultrasonic treatment conditions are ultrasonication for 30 seconds at an amplitude of 20%, followed by cooling for 2 minutes, and the ultrasonic-cooling process is repeated 6 times; the incubation conditions are incubation at 37°C for 50-70 minutes.

[0035] The present invention also discloses a preparation of an extracellular vesicle pathway-optimized sperm function preparation obtained by the preparation method of the above-mentioned extracellular vesicle pathway-optimized sperm function preparation.

[0036] The present invention also discloses the application of an agent that optimizes sperm function via the extracellular vesicle pathway as described above in a sperm damage repair system.

[0037] Preferably, the application includes a sperm damage repair model established based on an agent that optimizes sperm function through the extracellular vesicle pathway.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] In this invention, drawing on the influence of seminal plasma extracellular vesicle proteins on sperm function, an exosome modification technique is used to prepare a formulation that can optimize sperm function. The formulation is then used to establish a sperm damage repair system, which improves the motility of lead-contaminated sperm and enhances sperm motility in patients with asthenospermia in vitro. This provides a theoretical basis for auxiliary research in the treatment of male infertility, such as the development of related drugs. Attached Figure Description

[0040] Figure 1 This is a BCA protein concentration standard curve of SKAP2 when the concentration of SKAP2 supernatant was determined in Example 3; Figure 2 This is a diagram showing the results of sperm damage repair in mice in Example 4; Figure 3 This is a diagram showing the results of human sperm damage repair in Example 5; Figure 4This is a diagram showing the results of human sperm damage repair in Example 6; Figure 5 This is a graph showing the changes in rat body weight over lead exposure time in Example 7; Figure 6 The figure shows the effect of lead poisoning on the quality of epididymal sperm in rats in Example 7. Figure 7 This is a diagram showing the morphological examination results of sperm from lead-exposed rats in Example 7. Figure 8 This is a diagram of the testicular structure of the lead-poisoned rats in Example 7; Figure 9 The image shows the transmission electron microscopy results of extracellular vesicles extracted from the seminal plasma of healthy male rats in Example 8. Figure 10 The figure shows the diameter and concentration distribution of extracellular vesicles extracted from the seminal plasma of healthy male rats in Example 8, identified by nanoparticle tracking analysis. Figure 11 The image shows the results of protein biomarker identification of extracellular vesicles extracted from the seminal plasma cells of healthy male rats in Example 8 using Western blotting. Figure 12 This is a graph showing the effect of seminal plasma extracellular vesicles on rat sperm motility in Example 8; Figure 13 This is a graph showing the effect of seminal plasma extracellular vesicles on human sperm motility in Example 9; Figure 14 This is a graph showing the effect of seminal plasma extracellular vesicles on sperm capacitation in Example 8; Figure 15 This is a graph showing the effect of seminal plasma extracellular vesicles on the acrosome response of rat sperm in Example 8; Figure 16 This is a graph showing the effect of seminal plasma extracellular vesicles on the acrosome response of human sperm in Example 9; Figure 17 The image shows the results of extracellular vesicle protein identification in rat prostatic fluid, seminal vesicle fluid, and epididymal fluid in Example 8. Figure 18 This is a differential protein diagram of extracellular vesicles in the epididymal fluid of rats in Example 8, showing the differences between the lead-exposed group and the control group. Figure 19 This is a differential protein diagram of extracellular vesicles in rat seminal plasma cells in Example 8, showing the differences between the lead-exposed group and the control group. Figure 20 This is a cluster analysis diagram of 37 differentially expressed proteins in extracellular vesicles of rat epididymal fluid in Example 8; Figure 21 This is a clustering analysis diagram of seven differentially expressed proteins in extracellular vesicles of rat seminal plasma cells in Example 8; Figure 22 This is a graph showing the enrichment analysis of differentially expressed protein GO in extracellular vesicles of rat seminal vesicle fluid in Example 8. Figure 23 This is a graph showing the enrichment analysis of the differentially expressed protein GO in extracellular vesicles of rat prostatic fluid in Example 8. Figure 24 This is a graph showing the enrichment analysis of differentially expressed protein GO in extracellular vesicles of rat epididymal fluid in Example 8. Figure 25 This is a graph showing the enrichment analysis of differentially expressed protein GO in extracellular vesicles of rat seminal plasma cells in Example 8; Figure 26 This is a graph showing the enrichment analysis of the differential protein KEGG in extracellular vesicles of rat seminal plasma cells in Example 8; Figure 27 This is a graph showing the enrichment analysis of the differential protein KEGG in extracellular vesicles of rat seminal vesicle fluid in Example 8; Figure 28 This is a graph showing the enrichment analysis of the differential protein KEGG in extracellular vesicles of rat prostatic fluid in Example 8; Figure 29 This is a graph showing the enrichment analysis of the differential protein KEGG in extracellular vesicles of rat epididymal fluid in Example 8. DETAILED DESCRIPTION

[0041] Example 1

[0042] This embodiment discloses a method for preparing a formulation that optimizes sperm function via the extracellular vesicle pathway, comprising the following steps:

[0043] Step 1: Construct plasmids;

[0044] The human SKAP2-CDS sequence was amplified by PCR reaction of human cDNA;

[0045] The components of the PCR reaction system are: 25 μL of 2×Phanta Max Master Mix, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 10 ng of human cDNA template, 1 μL of DNA polymerase, and the remainder is deionized water, which is added to 50 μL. The PCR reaction procedure is as follows: (1) Pre-denaturation is performed at 95℃ for 5 min; (2) Denaturation is performed at 95℃ for 1 min; (3) Annealing is performed at 55℃ for 2 min; (4) Extension is performed at 72℃, and each kb (kJ / kB) DNA fragment is extended for 90 s; (5) Cycling is performed, and (2)-(4) are repeated for a total of 35 cycles; (6) Complete extension is performed at 72℃ for 5 min to ensure that all DNA segments are completely extended. The human SKAP2 PCR reaction product (human SKAP2-CDS sequence) is stored at 10℃.

[0046] The sequence of the forward primer for human SKAP2-CDS is shown in SEQ ID NO.1: 5'-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCAGCACCTCCT-3';

[0047] The reverse primer sequence for human SKAP2-CDS is shown in SEQ ID NO.2: 5'-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTATGTAG-3';

[0048]

[0049] The human SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between the BamHI and EcoRI sites to obtain the recombinant plasmid;

[0050] The process of inserting the human SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites includes: double digestion of the human SKAP2 PCR product and the PHY-GFP plasmid with BamHI and EcoRI restriction enzymes, respectively, for 2 hours at 37°C; recovery of the target gene fragment by 1% agarose gel electrophoresis; and ligation of the target gene fragment and plasmid fragment by DNA ligase at 16°C for 12 hours to obtain the recombinant plasmid.

[0051] Furthermore, the successful construction and inclusion of the target gene by the recombinant plasmid can be confirmed through cultivation, screening, and identification steps, including the following steps: Take 10 μL of recombinant plasmid and mix it with 100 μL of DH5a competent bacteria, incubate on ice for 30 min, heat shock at 42℃ for 90 s, immediately place on ice for 5 min, add 700 μL of LB medium preheated to room temperature, incubate at 37℃ in a shaker for 50 min, take 200 μL of bacterial solution, mix with a pipette, and spread evenly on an LB plate containing 100 μg / mL Ampicillin resistance, incubate in an inverted incubator at 37℃ overnight, pick 5 single colonies and inoculate them into LB medium containing 5 mL of 100 μg / mL Ampicillin resistance, incubate at 300 rpm and 37℃ in a shaker overnight, amplify the overnight bacterial solution, select positive bacterial solutions, extract plasmids using a plasmid mini-extraction kit, and then perform sequencing verification;

[0052] Step 2: Cell transfection and cell line construction;

[0053] (1) Recombinant plasmid transfection using EZ transtransfection reagent: Dilute EZ Trans transfection reagent into serum-free high-glucose DMEM medium, mix well to obtain diluted transfection reagent; dilute recombinant plasmid DNA into serum-free high-glucose DMEM medium, mix well, add diluted transfection reagent, mix well, incubate at room temperature for 15 min to complete recombinant plasmid transfection, forming EZ Trans-DNA complex, i.e. recombinant plasmid product;

[0054] The EZ Trans-DNA complex was evenly added to a culture dish containing HEK293T cells. The mixture was gently shaken to disperse the EZ Trans-DNA complex evenly. The mixture was incubated at 37°C and 5% CO2 for 18 hours. The medium was then replaced with fresh DMEM containing serum and incubated for another 24 hours to analyze the expression of the transfected gene fragment. After transfection, the mixture was centrifuged at 4000 rpm for 5 minutes at 4°C and the supernatant was collected.

[0055] (2) When HEK-293T cells reached 80%, the collected supernatant and an equal volume of fresh MEM medium (containing 10% exosome-free fetal bovine serum) were used to incubate HEK293T cells in a 37°C, 5% CO2 incubator. After incubation for 48 h, HEK293T cells were transferred to MEM medium containing 1 μg / mL puromycin for further culture. After 48 h of further culture, HEK293T cells were transferred to MEM medium containing 0.5 μg / mL puromycin for further culture to obtain the cell line.

[0056] Step 3: Isolate exosomes;

[0057] The cell line was expanded and cultured in 10 culture dishes with a diameter of 15 cm. After the cell concentration reached 70%, the cells were washed three times with 1x PBS and then cultured in serum-free MEM medium for 48 h. The supernatant was collected and centrifuged. The centrifugation conditions were as follows: first centrifugation at 2000 g for 30 min at 4 °C, then centrifugation at 12000 g for 30 min at 4 °C. The supernatant was filtered through a 0.22 μm sterile filter and concentrated to 500 μL by rotation in a 100 kD ultrafiltration tube at 4000 g at 4 °C. 10 mL of PBS was added to the concentrate and it was concentrated again to 500 μL to obtain human SKAP2-HEK2293T exosome suspension, which is a preparation for optimizing sperm function through the extracellular vesicle pathway.

[0058] Example 2

[0059] This embodiment discloses a method for preparing a formulation that optimizes sperm function via the extracellular vesicle pathway, comprising the following steps:

[0060] Step 1: Construct plasmids;

[0061] The mouse SKAP2-CDS sequence was amplified by PCR reaction of mouse cDNA;

[0062] The components and reaction procedure of the PCR reaction system are the same as in Example 1;

[0063] The sequence of the mouse SKAP2-CDS forward primer is shown in SEQ ID NO.4: 5'-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCTGTACCTCTT-3';

[0064] The sequence of the mouse SKAP2-CDS reverse primer is shown in SEQ ID NO.5: 5'-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTAGGTAG-3';

[0065]

[0066] The mouse SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between the BamHI and EcoRI sites to obtain the recombinant plasmid;

[0067] The procedure for inserting the mouse SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites is the same as the procedure for inserting the mouse SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites in Example 1.

[0068] Step 2: Cell transfection and cell line construction;

[0069] The procedures for cell transfection and cell line construction are the same as in Example 1;

[0070] Step 3: Separate exosomes to obtain mouse SKAP2-HEK2293T exosome suspension, which is a preparation for optimizing sperm function through the extracellular vesicle pathway; the procedure for separating exosomes is the same as in Example 1.

[0071] Example 3

[0072] This embodiment discloses a method for preparing a formulation that optimizes sperm function via the extracellular vesicle pathway, comprising the following steps:

[0073] Step (1): Extract milk-derived exosomes:

[0074] Milk was subjected to a first centrifugation to remove fat globules, cells, and cell debris. The first centrifugation was performed at 4°C and 13,000 x g for 30 min. The supernatant was collected. The supernatant was then subjected to a second centrifugation to remove large particles and microvesicles. The second centrifugation was performed at 4°C and 100,000 x g for 60 min. The supernatant was then collected. The second centrifugation was performed to a third centrifugation at 4°C and 145,000 x g for 90 min. The precipitate was collected, washed three times with PBS, and filtered through a 0.22 μm filter to obtain an exosome suspension, namely milk-derived exosomes (mEXOs).

[0075] Step (2): Exosomal protein coating;

[0076] Milk-derived exosomes were loaded onto SKAP2 protein using an ultrasound system: Milk-derived exosomes and SKAP2 protein were mixed in PBS at a mass ratio of 1:1, with a final concentration of 4 μg / mL of milk-derived exosomes in the mixture. The mixture was sonicated at 20% amplitude for 30 seconds, then cooled for 2 minutes. This sonication-cooling process was repeated 6 times. After sonication, the mixture was incubated at 37°C for 60 minutes to obtain SKAP2 protein-coated milk-derived exosomes. These SKAP2 protein-coated milk-derived exosomes (SKAP2-milk) are a formulation for optimizing sperm function via the extracellular vesicle pathway.

[0077] Furthermore, the loading rate of SKAP2 protein was determined using the following method:

[0078] a) Milk-derived exosomes (exosome suspension) were labeled with a red fluorescent dye (Dil, Biotium, USA) as follows: The exosome suspension was mixed with Dil at a ratio of 1000 μg exosome suspension to 10 μL of Dil stock solution. The mixture was repeatedly and slowly pipetted to ensure complete dissolution and avoid clumping. The mixture was incubated at 37°C in the dark for 30 min, with slow and repeated pipetting every 5 min (50 times). Then, the mixture was centrifuged at 140,000 g for 90 min. After centrifugation, the supernatant was discarded, and the precipitate was retained. This process also removed the dye that was not bound to the exosomes. The precipitate was resuspended in sterile PBS and transferred to a light-protected EP tube to obtain Dil-mEXOs.

[0079] If the obtained Dil-mEXOs are to be used in the short term, they should be stored in a refrigerator at 4°C. If they are to be stored for a long term, they should be stored in a refrigerator at -80°C.

[0080] b) Dil-mEXOs and SKAP2 protein were mixed in sterile PBS and repeatedly resuspended with a pipette to ensure homogeneity. The mixture included 0.1 mL of sterile PBS, and the mass ratio of Dil-mEXOs to SKAP2 protein was 1:1, with each protein having a concentration of 0.4 μg / μL.

[0081] c) The mixture was subjected to ultrasonic treatment. The ultrasonic treatment process was as follows: ultrasonication for 30 seconds at an amplitude of 20%, followed by cooling for 2 minutes. The ultrasonic-cooling process was repeated 6 times. After ultrasonic treatment, the mixture was incubated at 37°C for 60 minutes. The ultrasonic treatment process was required to be carried out on ice.

[0082] d) Loading rate of SKAP2 protein: The concentration of unencapsulated SKAP2 protein in the supernatant at 562 nm was measured using a microplate reader. Multiple measurements were taken, and the average value was used to determine the loading rate of SKAP2 protein. The calculation was performed according to the following formula: Loading rate of SKAP2 protein = (Total concentration of SKAP2 protein - Concentration of SKAP2 supernatant) / Total concentration of SKAP2 protein; The loading rate of SKAP2 protein was found to be 93.35%.

[0083] When determining the concentration of SKAP2 supernatant, the BCA protein concentration standard curve of SKAP2 is as follows: Figure 1 shown.

[0084] Example 4

[0085] This embodiment discloses a mouse sperm damage repair model established using a formulation that optimizes sperm function via the extracellular vesicle pathway. The steps for establishing the mouse sperm damage repair model are as follows:

[0086] Step 1: Separation of damaged mouse sperm: The semen of lead-poisoned mice was centrifuged to separate seminal plasma and sperm. BWW culture medium for sperm cells was added to the semen and centrifuged at 900 rpm for 5 min to obtain damaged mouse sperm.

[0087] If the seminal plasma and sperm are not completely separated, remove the supernatant and add sperm cells BWW medium again, centrifuge at 900 rpm for 5 minutes until the seminal plasma and sperm are separated.

[0088] The lead poisoning process for mice was as follows: male mice were fed a 0.1 wt% lead acetate solution in their drinking water for 3 months.

[0089] Step 2, Repair Incubation: Use a 24-well plate, 2.5 × 10⁶ samples per well. 6 One damaged mouse sperm was placed in 1 mL of BWW medium, and 1.72 μL of a preparation for optimizing sperm function via the extracellular vesicle pathway (prepared in Example 2) was added to each well. The mixture was incubated at 37°C, 5% CO2, and 95% humidity for 1 h.

[0090] Furthermore, after incubation, sperm motility was tested, and the results are shown in Table 1:

[0091] Table 1. Improvement of sperm motility levels in mice after in vitro stimulation

[0092]

[0093] a-The results were presented as the mean±SD; b-Comparedwith theControl,P<0.05; c-Compared with the EVs-Empty,P<0.05; d-Compared with theControl,P<0.01; e-Compared with the EVs-Empty,P<0.01;

[0094] In the table, sperm motility-related indicators are as follows: PR (Progressive Motility): Blank control group: 14.94±2.97%; Negative control group: 15.14±1.97%; Treatment group: 25.92±4.92% (P<0.001 compared with the blank and negative control groups); Analysis: The percentage of progressively motile sperm in the treatment group was significantly higher than that in the blank and negative control groups, indicating that treatment may enhance the forward motility of sperm; PRNP (Progressive and Non-Progressive Motility): Blank control group: 22.57±4.55%; Negative control group: 22.96±3.13%; Treatment group: 33.91±6.76% (P<0.001 compared with the blank and negative control groups); Analysis: The percentages of progressively motile and non-progressive sperm in the treatment group were also significantly higher than those in the blank and negative control groups, indicating that treatment has a positive effect on the overall sperm motility.

[0095] Sperm motility characteristics: Hyperactivation (percentage of hyperactivation): Blank control group: 2.79±1.04%; Negative control group: 1.68±0.73%; Treatment group: 4.08±1.18% (P<0.01 compared with blank and negative control groups); Analysis: The increased percentage of hyperactivation in the treatment group indicates that the treatment may have promoted hyperactivation of sperm, which is one of the key factors for successful fertilization.

[0096] Sperm motility-related indicators: VCL (Curvilinear Velocity): Blank control group: 21.98±3.18 μm / s; Negative control group: 23.50±3.91 μm / s; Treatment group: 41.24±8.21 μm / s (P<0.001 compared with blank and negative control groups); Analysis: The curvilinear velocity in the treatment group was significantly increased, indicating that the treatment improved the overall sperm motility. VSL (Straight Line Velocity): Blank control group: 4.64±1.45 μm / s; Negative control group: 4.54±1.06 μm / s; Treatment group: 8.68±2.60 μm / s (P<0.01 compared with blank and negative control groups); Analysis: The straight line velocity in the treatment group was also significantly increased, indicating that the treatment made the sperm move more rapidly in a straight line. VAP (Average Pathway) Velocity (mean path velocity): Blank control group: 9.80±1.73 μm / s; Negative control group: 10.42±1.84 μm / s; Treatment group: 18.22±3.93 μm / s (P<0.001 compared with blank and negative control groups); Analysis: The mean path velocity in the treatment group was significantly increased, indicating that the treatment improved the stability and efficiency of sperm motility;

[0097] Sperm morphology and motility parameters: STR (Straightness): Blank control group: 0.10±0.03; Negative control group: 0.09±0.02; Treatment group: 0.15±0.03 (P<0.05 compared with the blank control group); Analysis: The straightness of the treatment group was improved, but the difference was only significant compared with the blank control group, indicating that the treatment may make the sperm more linear during motility; BCF (Beat Cross) Frequency (whipping frequency): Blank control group: 2.22±0.53Hz; Negative control group: 2.14±0.38Hz; Definition of ALH: ALH refers to the maximum amplitude of lateral oscillation of the sperm head along its trajectory, and is an important indicator for measuring sperm dynamics and exploratory ability; Blank control group: 2.22±0.28μm; Negative control group: 2.44±0.43μm; Treatment group: 4.08±0.73μm (compared with blank and negative control groups, P<0.001); Analysis: The experimental results show that the ALH value of the treatment group is significantly higher than that of the blank and negative control groups, indicating that the treatment may enhance the lateral oscillation ability of the sperm head, thereby improving sperm dynamics and exploratory ability in complex environments; Clinical significance of ALH: Increased ALH may help improve sperm fertilization ability, because a larger lateral displacement amplitude of the head may make sperm more flexible when passing through the female reproductive tract, making it easier to find the egg and complete the fertilization process; In addition, ALH is also an important parameter for assessing sperm quality and male fertility.

[0098] Depend on Figure 2 It was found that mouse SKAP2-HEK2293T exosomes could improve mouse sperm motility indices. After mouse sperm were damaged by in vitro stimulation with mouse SKAP2-HEK2293T exosomes, compared with the blank control and empty HEK293T exosomes (EVs-Empty), the sperm motility rate and sperm viability were significantly increased, and each was higher than the original control. Furthermore, the motility indices ALH, BCF, STR, VAP, VCL, VSL, and sperm hyperactivation were significantly increased compared with the two control groups.

[0099] In the diagram, PR represents the anterior motility rate, which is the sum of grade A and grade B sperm; PRNP represents sperm motility, which is the sum of grade A, grade B, and grade C sperm.

[0100] Example 5

[0101] This embodiment discloses a human sperm damage repair model established using a formulation that optimizes sperm function via the extracellular vesicle pathway. The steps for establishing the human sperm damage repair model are as follows:

[0102] Step 1: Separation of damaged human sperm: The semen of humans with asthenospermia is centrifuged to separate seminal plasma and sperm. BWW culture medium for sperm cells is added to the semen, and the mixture is centrifuged at 900 rpm for 5 minutes to obtain damaged human sperm. If the seminal plasma and sperm are not completely separated, the supernatant is removed and BWW culture medium for sperm cells is added again, and the mixture is centrifuged at 900 rpm for 5 minutes until the seminal plasma and sperm are separated.

[0103] Step 2, Repair Incubation: Use a 24-well plate, 2.5 × 10⁶ samples per well. 6 One damaged human sperm was placed in 1 mL of BWW medium, and 1.72 μL of the preparation for optimizing sperm function via the extracellular vesicle pathway (prepared in Example 1) was added to each well. The mixture was incubated at 37°C, 5% CO2, and 95% humidity for 1 h.

[0104] Furthermore, after incubation, sperm motility was tested, and the results are shown in Table 2.

[0105] Table 2. Improvement of sperm motility levels under in vitro stimulation

[0106]

[0107] a-The results were presented as the mean±SD; d-Comparedwith the blankcontrol,P<0.05; e-Compared with the negative control,P<0.05;

[0108] Depend on Figure 3 It was found that human SKAP2-HEK2293T exosomes can improve sperm motility in patients with asthenospermia. After human SKAP2-HEK2293T exosomes stimulated and damaged human sperm in vitro, compared with the blank control and empty HEK2293T exosomes, the sperm motility rate and sperm vitality were significantly increased, and each case was higher than the original control, while the percentage of grade D dead sperm was significantly reduced.

[0109] In the diagram, A+B represents the motility rate, which is the sum of the rates of grade A and grade B sperm; A+B+C represents sperm motility.

[0110] Example 6

[0111] This embodiment discloses a human sperm damage repair model established using a formulation that optimizes sperm function via the extracellular vesicle pathway. The steps for establishing the human sperm damage repair model are as follows:

[0112] Step 1: Separation of damaged human sperm: The semen of humans with asthenospermia is centrifuged to separate seminal plasma and sperm. BWW culture medium for sperm cells is added to the semen, and the mixture is centrifuged at 900 rpm for 5 minutes to obtain damaged human sperm. If the seminal plasma and sperm are not completely separated, the supernatant is removed and BWW culture medium for sperm cells is added again, and the mixture is centrifuged at 900 rpm for 5 minutes until the seminal plasma and sperm are separated.

[0113] Step 2, Repair Incubation: Use a 24-well plate, 2.5 × 10⁶ samples per well. 6 One damaged human sperm was placed in 1 mL of BWW medium, and 1.72 μL of a preparation for optimizing sperm function via the extracellular vesicle pathway (prepared in Example 3) was added to each well. The mixture was incubated at 37°C, 5% CO2, and 95% humidity for 1 h.

[0114] Furthermore, after incubation, sperm motility was tested, and the results are shown in Table 3.

[0115] Table 3 Improvement of human sperm motility levels under in vitro stimulation

[0116]

[0117]

[0118] a-The results were presented as the mean±SD; d-Comparedwith the blankcontrol,P<0.05; e-Compared with the negative control,P<0.05;

[0119] Depend on Figure 4 It was found that SKAP2 protein-coated milk exosomes could improve sperm motility in patients with asthenospermia. After SKAP2 protein-coated milk exosomes stimulated and damaged human sperm in vitro, compared with the blank control and empty milk exosomes (EVs-Empty), sperm protonic motility and sperm vitality were significantly increased, and each case was higher than the original control.

[0120] In the diagram, A+B represents the motility rate, which is the sum of the rates of grade A and grade B sperm; A+B+C represents sperm motility.

[0121] Example 7

[0122] This embodiment discloses a method for establishing a rat model of chronic lead acetate exposure, including the following steps:

[0123] Step (1), Prepare reagents:

[0124] 1.1 Preparation of lead acetate poisoning solution: Taking a 0.2% lead acetate solution as an example, weigh 2.00g of anhydrous lead acetate, dissolve it in 100mL of distilled water, transfer it to a volumetric flask and make up to 1L to obtain a 0.2% lead acetate solution.

[0125] The preparation methods for 0.04% lead acetate solution, 0.4% lead acetate solution and 0.8% lead acetate solution are the same as those for 0.2% lead acetate solution;

[0126] Label the 0.04% lead acetate solution, 0.2% lead acetate solution, 0.4% lead acetate solution, and 0.8% lead acetate solution with the date, and set them aside for use.

[0127] 1.2 Preparation of SDS-PAGE electrophoresis buffer: Take one 1L bottle of Beyotime SDS-PAGE electrophoresis buffer powder into a clean beaker, add 900mL of double-distilled water, mix and dissolve with a magnetic stirrer, transfer to a volumetric flask and bring the volume to 1L to obtain the SDS-PAGE electrophoresis buffer; label the SDS-PAGE electrophoresis buffer with the date, store at 4℃ until use;

[0128] 1.3 Preparation of transfer buffer: Take one 1L bottle of Beyotime semi-dry transfer buffer powder into a clean beaker, add 700mL of double-distilled water, mix and dissolve with a magnetic stirrer, add 200mL of anhydrous ethanol, mix well, transfer to a volumetric flask and bring the volume to 1L to obtain the transfer buffer; label the transfer buffer with the date, store at 4℃ until use;

[0129] 1.4 Preparation of washing solution (PBST washing solution): Take one 18.7g packet of PBS powder into a clean beaker, add 1900mL of double-distilled water, mix and dissolve with a magnetic stirrer, add 2mL of Tween-20, mix well, transfer to a volumetric flask and bring the volume to 2L to obtain the washing solution; label the washing solution with the date, store at 4℃ for later use;

[0130] 1.5 Preparation of standard curve solution:

[0131] 1.5.1 Dilution of internal standard: The internal standard stock solution with a concentration of 10 ppm was diluted to an internal standard application solution with a concentration of 100 ppb using a gradient dilution method;

[0132] 1.5.2 Dilution of external standard: The external standard stock solution with a concentration of 10 ppm was diluted with external standard application solutions at concentrations of 1 ppm, 100 ppb, 10 ppb, and 1 ppb, respectively, using a gradient dilution method.

[0133] 1.5.3 The final concentration gradient of the external standard in the standard curve solution is: 50 ppb, 10 ppb, 2 ppb, 0.4 ppb, 0.2 ppb, and the final concentration of the internal standard is 10 ppb. The rest are added with 3% nitric acid aqueous solution by mass percentage. The total volume of the standard curve solution is 8 mL.

[0134] Step (2): Establish a rat model of chronic lead acetate exposure.

[0135] 2.1 Selection of experimental subjects

[0136] Healthy male SD rats (3-4 weeks old) weighing 60-110g and classified as SPF (Specific Pathogen Free) were purchased from the Experimental Animal Center of Army Medical University. These rats were then acclimatized in the laboratory animal room for one week at a temperature of 26±1℃ and a relative humidity of 45%-65%RH. The light-dark cycle was 12 hours (light on at 8:00 AM and off at 8:00 PM). Animal husbandry strictly followed the manual of the Experimental Animal Committee of Army Medical University.

[0137] 2.2 The rats selected in 2.1 were randomly divided into six groups of 12 rats each. A chronic lead exposure model was established by administering the corresponding lead acetate exposure doses via drinking water. The six groups were: negative control group, sodium acetate control group (0.4% sodium acetate, NaAC), low lead exposure group (0.04% lead acetate, PbAC), medium lead exposure group (0.2% lead acetate), high lead exposure group (0.4% lead acetate), and ultra-high lead exposure group (0.8% lead acetate). Diet and growth were recorded, and rat weight was measured weekly. The exposure period was 4 months. The changes in rat weight over the exposure period are shown in Table 4. Figure 5 As shown:

[0138] Table 4

[0139]

[0140] From Table 4 and Figure 5It was found that the appetite of rats in the sodium acetate control group increased significantly after 1 week of exposure, while the appetite of rats in the 0.80% lead-exposed group decreased significantly after 3 weeks of exposure. Other lead-exposed groups showed no change in appetite, but some experienced diarrhea and anxiety. After 5 weeks of exposure, rats showed darkening of body color, loosening and yellowing of fur, and even hair loss. Compared with the control group, the weight of rats in the 0.80% PbAC group decreased significantly. Although the weight of rats in other lead-exposed groups was lower than that of the control and NaAC control groups over time, no statistically significant effect of lead exposure on the weight of the rat brain, testes, prostate, or seminal vesicles was observed compared with the control group. The changes in the rat visceral coefficient were analyzed, calculated using the formula: Visceral coefficient = tissue / organ weight / animal body weight. Only the prostate coefficient of the 0.04% PbAC group was significantly higher than that of the control group. No statistically significant differences were found in the changes of the visceral coefficient between the other lead-exposed groups and the control group. The weights of rat tissues and organs are shown in Table 5.

[0141] Table 5

[0142]

[0143] Furthermore, the rats subjected to the poisoning experiment were analyzed, including:

[0144] (1) Whole blood lead test

[0145] After the rats were exposed to the poison, they were placed in a rat restraint device with their tails exposed. They were then immersed in warm water at about 50°C to dilate the blood vessels, and the tails turned bright red. The tails were then repeatedly wiped with alcohol swabs for disinfection, dried with dry cotton balls, and the tip of the tail was cut off by about 0.5 cm. Blood was allowed to flow from the tip of the tail and dripped into an EDTA blood collection tube. The collected whole blood samples from the rats were frozen at -80°C for later use.

[0146] The concentration of blood lead in frozen rat whole blood samples was determined using inductively coupled plasma mass spectrometry (ICP-MS). The procedure is as follows:

[0147] Blood sample processing: Take the frozen rat whole blood sample, incubate at 37℃ for 5 min, vortex thoroughly to mix, take 40 μL of rat whole blood sample into a 2 mL polytetrafluoroethylene digestion tube, add 150 μL of 100 ppb internal standard working solution, add 3 wt% nitric acid aqueous solution to make up to 1.5 mL, mix thoroughly by inverting, sonicate for 1 h, let stand for 24 h, centrifuge at 10000 r / min for 20 min, collect the supernatant for analysis; determine the lead (Pb) content in the supernatant using ICP-MS, with the following settings for the inductively coupled plasma mass spectrometer: wavelength 283.3 nm, lamp current 8 mA, slit width 0.7 L / nm;

[0148] (2) Analysis of semen quality

[0149] 2.1 Semen extraction: The epididymal tails of rats after the poisoning experiment were longitudinally cut open and placed in a 6-well plate of 1 mL HTF medium. The HTF medium was placed on a 37℃ constant temperature table for 2 min. During the process, the epididymal tails were gently blown 5 times with a pipette to fully release the semen.

[0150] 2.2 Take 20 μL of semen and add it to 37℃ culture medium containing 1 mL HTF. Invert the tube 3 times to mix well. Quickly add 40 μL to a disposable sperm analysis slide. Perform routine semen analysis on a sperm automated detection and analysis system (CASA). Count 500 sperm per rat.

[0151] The main testing indicators include routine semen parameters and sperm motility parameters. Routine parameters include: semen volume, sperm concentration, total sperm count, and sperm motility (percentage of progressively motile sperm (PR), percentage of non-progressively motile sperm (NP), and percentage of immobile sperm (IM)). Sperm motility parameters mainly include: average curve velocity of VCL (μm / s), average linear velocity of VSL (μm / s), average path velocity of VAP (μm / s), linearity of LIN motility (%), forward motion of STR motility (%), oscillation of WOB motility (%), average lateral swing amplitude of ALH sperm (μm), and average whiplash frequency of BCF sperm (Hz). The test results are shown in Table 6 and... Figure 6 As shown:

[0152] Table 6

[0153]

[0154]

[0155] From Table 6 and Figure 6 It was found that, compared with the control group, the percentages of non-progressive sperm (NP) and grade C sperm (P = 0.043) in the 0.20% and 0.80% PbAC-treated groups were significantly lower, while the percentages of immotile sperm (IM) and grade D sperm (P = 0.002) were significantly higher. The percentage of grade A sperm in the 0.80% PbAC-treated group was significantly lower (P < 0.001). The mean linear velocity (VSL), wobble motion (WOB), linearity (LIN), and forward motion (STR) in the 0.04% PbAC-treated group were significantly higher. The wobble motion (WOB) in the 0.20% PbAC-treated group was also significantly higher. The mean whiplash frequency (BCF) in the 0.40% PbAC-treated group was significantly lower.

[0156] (3) Sperm morphology examination

[0157] The 2% eosin staining method was used to examine abnormal sperm in rats. The experimental steps are as follows:

[0158] 3.1 Preparation of semen smears:

[0159] 3.1.1 Wipe both sides of the glass slide with lint-free paper;

[0160] 3.1.2. Use an HB pencil to record the rat number on the white paint area of ​​the slide, and add 10 μL of the semen extracted in 2.1 to the edge of the slide;

[0161] 3.1.3 Press the semen against the surface of the first slide and push the slide forward;

[0162] 3.1.4 Fix with anhydrous ethanol, and air dry the slide at room temperature to obtain a fixed sperm smear;

[0163] 3.22% Eosin staining: Place the fixed sperm smear on a slide holder, put it into a staining tank with a mass concentration of 2% Eosin staining solution, let it stand for 48 hours for staining, rinse off excess dye with water, and observe under a microscope;

[0164] Two hundred sperm cells were examined in different fields of view. The proportions of normal sperm, sperm with head malformations, sperm with neck and midpiece malformations, sperm with tail malformations, and sperm with both malformations were statistically analyzed. The sperm morphology index TZI and sperm morphology index SDI were calculated. The results of rat sperm morphology examination are shown in Table 7. Figure 7 As shown:

[0165] Table 7

[0166]

[0167] From Table 7 and Figure 7 It was found that the normal sperm rate was significantly decreased in the 0.20% PbAC group, the 0.40% PbAC group, and the 0.80% PbAC group (P<0.001), and the sperm abnormality index (SDI) was significantly increased (P<0.01); the head malformation rate (P<0.001), neck and midsegment malformation rate (P<0.001) were significantly increased in the 0.80% PbAC group; the tail malformation rate was significantly increased in the 0.20% and 0.40% PbAC groups (P<0.001, P=0.028); while the abnormal sperm index (TZI) was significantly decreased in the 0.04% PbAC group (103.18±2.78 vs 101.34±1.39, P<0.001).

[0168] (4) Paraffin sections of testes and HE staining

[0169] After the toxicity experiment, rat testicular tissue was fixed with testicular tissue fixative. Paraffin sections were stained with hematoxylin-eosin (HEstaining) and the testicular structure of each group of rats was observed. The experimental steps are as follows:

[0170] 4.1 Tissue collection: The rat testis was removed from the fixation solution and the tissue at the target site was trimmed flat with a scalpel in a fume hood. The trimmed tissue and the corresponding label were placed in an embedding frame.

[0171] 4.2 Dewaxing: Paraffin sections of rat testicular tissue were dewaxed with xylene for 10 min, then dewaxed again with fresh xylene for 10 min, and then soaked in anhydrous ethanol, 90% ethanol aqueous solution, 80% ethanol aqueous solution, 70% ethanol aqueous solution and distilled water for 5 min in sequence.

[0172] 4.3 Embedding: The tissues soaked in wax are embedded in the embedding machine. First, the melted wax is placed into the embedding frame. Before the wax solidifies, the tissues are taken out from the dehydration box and placed into the embedding frame according to the requirements of the embedding surface and labeled accordingly. The tissues are cooled on a -20℃ freezing stage. After the wax solidifies, the wax block is taken out from the embedding frame and the wax block is trimmed.

[0173] 4.4 Sectioning: Place the trimmed wax block on a paraffin microtome and section it to a thickness of 4μm. Float the section on 40℃ warm water in a slide spreader to flatten the tissue. Pick up the tissue on a glass slide and bake it in a 60℃ oven until the moisture is dried and the wax is melted. Remove it and store it at room temperature for later use.

[0174] 4.5 Staining:

[0175] 4.5.1 The dewaxed rat testicular tissue sections were stained with hematoxylin staining solution for 10 min;

[0176] 4.5.2 Rinse with tap water for 10 minutes, then wash once with distilled water to remove impurities;

[0177] 4.5.3 Soak in 1% hydrochloric acid-ethanol differentiation solution (prepared by mixing 1 mL of 37 wt% concentrated hydrochloric acid with 99 mL of 75 wt% ethanol aqueous solution) for 30 seconds, then rinse with tap water for 10 minutes;

[0178] 4.5.4 After staining with eosin solution for 2 minutes, rinse with tap water for 10 minutes;

[0179] 4.6 Dehydration: The slide samples were dehydrated sequentially using 70% ethanol aqueous solution, 80% ethanol aqueous solution, 90% ethanol aqueous solution, and anhydrous ethanol. The dehydration times were 10s for 70% ethanol aqueous solution, 10s for 80% ethanol aqueous solution, 10s for 90% ethanol aqueous solution, and 10s for anhydrous ethanol.

[0180] 4.7 Clearing: Dehydrated rat testicular tissue sections were cleared in xylene for 5 min, and then cleared again in fresh xylene for 5 min.

[0181] 4.8 Mounting: The cleared rat testicular tissue sections were mounted using mounting medium and then set aside for use.

[0182] Stained rat testicular tissue sections were examined under a regular optical microscope to observe the structure of the testicular seminiferous epithelium and diagnose tissue damage; the results of HE staining of rat testes are as follows. Figure 8 As shown by Figure 8 It was found that the testicular structure of rats exposed to lead acetate showed obvious pathological changes: in the control group, 5-7 layers of normal spermatogenic cells were visible in the seminiferous tubules of the testes. The cells were polarized and neatly arranged. A small number of short spindle-shaped supporting cells were visible between the spermatogenic cells, and spermatogenesis was visible in the middle of the lumen. In the 0.20% PbAC-exposed group, the number of spermatogenic cells in the seminiferous tubules of the testes was significantly reduced, with only 2-3 layers. A small number of sperm were visible in the middle of the lumen. In the 0.40% group, the spermatogenic cells disappeared in the seminiferous tubules, leaving only short spindle-shaped or oval supporting cells. The tubule walls were slightly collapsed, and no spermatogenesis was visible in the lumen.

[0183] Example 8

[0184] This embodiment discloses a method for establishing a rat sperm lead poisoning model, including the following steps:

[0185] Step (1): Extract seminal plasma (EVs) from healthy male rats;

[0186] The experimental subjects are the same as in step 2.1 of Example 7;

[0187] EVs refer to vesicle-like microvesicles with a double-membrane structure, detached from the cell membrane or secreted by the cell, with a diameter of 50-1000 nm. They include exosomes, large vesicles, and apoptotic bodies. Therefore, they were extracted using 50kD ultrafiltration tube centrifugation. The extraction steps are as follows:

[0188] 1.1 Collection of seminal vesicle fluid and prostatic fluid: After sacrificing healthy male rats by neck dislocation, the seminal vesicles and prostate were placed in PBS aqueous solution (pH=7.4), cut open to allow the contents to flow out, and the tissues were repeatedly rinsed and discarded. The collected fluids were seminal vesicle fluid and prostatic fluid, respectively.

[0189] 1.2 Collection of epididymal fluid: After collecting seminal vesicle fluid and prostatic fluid, the intact epididymis of the rat was longitudinally cut open and repeatedly rinsed with PBS solution. The collected semen was centrifuged, and the upper layer was the epididymal fluid.

[0190] 1.3 Rat seminal plasma was prepared by using 65% seminal vesicle fluid, 25% prostatic fluid, and 10% epididymal fluid.

[0191] 1.4 Extraction of rat seminal plasma extracellular vesicles (EVs) from rat seminal plasma;

[0192] 1.4.1 The rat seminal plasma was transferred into a sterile EP tube and centrifuged at 13000g for 10 min at 4℃ to remove cells and other substances;

[0193] 1.4.2 Take the supernatant from the centrifugation and add it to the ultrafiltration tube. Then add 10 mL of exosome diluent and centrifuge using a horizontal rotor centrifuge at 22°C and 3000 g centrifugal force until the liquid volume in the ultrafiltration tube is 2 mL to remove small molecules, salts and other substances.

[0194] 1.4.3 Add 15 mL of exosome diluent to the ultrafiltration tube again and repeat the above steps until the liquid volume in the ultrafiltration tube is about 250 μL. Blow the ultrafiltration tube to wash out the liquid and obtain seminal plasma (EVs) from healthy male rats.

[0195] The seminal plasma (EVs) of healthy male rats were frozen at -80°C.

[0196] Step (2): Identification of EVs from seminal plasma of healthy male rats.

[0197] 2.1 Determination of the morphology of seminal plasma EVs from healthy male rats

[0198] Ultrastructure of the double-layered capsule of seminal plasma EVs from healthy male rats was observed using transmission electron microscopy (TEM):

[0199] Holding the edge of a 300-mesh copper mesh with tweezers, place the mesh on a tilted silica gel plate for fixation. Resuspend healthy male rat seminal plasma EVs extracted by ultrafiltration in 300 μL of PBS aqueous solution (pH = 7.4). Take 100 μL of the resuspension and drop it onto the front side of a 2 mm diameter carbon-containing copper mesh. After drying in a fume hood, add 3 wt% sodium phosphotungstenate aqueous solution (pH = 6.8), negatively stain at room temperature for 5 min, gently wash once with a drop of ultrapure water, air dry at room temperature, and bake under an incandescent lamp for 2 min. Observe under a microscope and photograph the morphology of male rat seminal plasma EVs at 80 FkV. Figure 9 It can be seen that the extracted vesicles are spherical and have a double-membrane structure, which is consistent with the structural characteristics of extracellular vesicles.

[0200] 2.2 Particle Tracking Analysis (NTA)

[0201] The Brownian motion of each particle was tracked and analyzed, and the particle size distribution and concentration of EVs in male rat seminal plasma were calculated using the Stockes-Einstein equation.

[0202] 2 μL of rat seminal plasma (EVs) was transferred to a 5 mL EP tube, and 2 mL of ultrapure water was added to dilute the sample 1000 times. After mixing the diluted sample, it was drawn through a 0.22 μm filter membrane using a 1 mL syringe. The filtrate was centrifuged at 5000 x g for 1 min to remove small air bubbles. The centrifuged sample was then injected into an NS300 nanoparticle tracking analyzer (NS300, Malvern). After the particle count stabilized, five different fields of view were selected for measurement, and the data were analyzed using NTA3.2 software.

[0203] The settings for the NS300 nanoparticle tracking analyzer are as follows: CameraLevel is set to 13, TimeofVideoRecords to 60s, DetectThreshold to 6, and other parameters use the system default settings. Figure 10 It can be seen that the diameter of the extracted vesicles in each group is in the range of 50-150 nm, with narrow peaks and uniform size, which is consistent with the size characteristics of extracellular vesicles, and the concentration distribution is 5.82 × 10⁻⁶. 8 -2.57×10 9 ;

[0204] 2.3 Identification of protein biomarkers

[0205] The specific proteins CD9, CD63, and CD81 on the surface of the seminal plasma EVs membrane of male rats were identified by Western blotting.

[0206] 2.3.1 Protein Sample Preparation

[0207] Dissolve the RIPA lysis buffer (strong), add PMSF (benzosulfonyl fluoride) at a volume ratio of PIRA:PMSF = 100:1 to make the final PMSF concentration 1mM, mix well, and obtain the cell lysis buffer;

[0208] Take 50 μL of rat seminal plasma (EVs), add 150 μL of prepared cell lysis buffer, mix well, and lyse on ice for 30 min. Centrifuge at 13000 x g for 15 min at 4 °C. Transfer the supernatant to a new 1.5 mL EP tube to obtain the protein stock solution. During the aspiration process, be careful not to aspirate any precipitate. All operations must be performed on ice.

[0209] 2.3.2 Protein Concentration Determination

[0210] The protein concentration of the stock protein solution was determined using the BCA protein concentration assay (enhanced version, Beyotime). The procedure is as follows:

[0211] 2.3.2.1 Place the protein stock solution in a 1.5 mL EP tube and dilute it twice with PBS aqueous solution (pH=7.4) to obtain the test sample; place the test sample on ice for later use.

[0212] 2.3.2.2 Prepare a 0.5 mg / mL BSA protein standard solution and set aside for later use;

[0213] 2.3.2.3 Prepare BCA working solution by mixing BCA Solution A and BCA Solution B in a 50:1 ratio according to the required amount of sample (200 μL for each sample), and set aside for use after thorough mixing;

[0214] 2.3.2.4 Add 0.5 mg / mL BSA protein standard solution to 96-well plates at concentrations of 0 μL, 1 μL, 2 μL, 4 μL, 8 μL, 12 μL, 16 μL, and 20 μL, respectively. Then add the corresponding PBS aqueous solution (pH = 7.4) to make the standard concentrations 0 mg / mL, 0.025 mg / mL, 0.05 mg / mL, 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, and 0.5 mg / mL, respectively. Add 2 μL of sample to each well, and bring the total volume of all wells to 20 μL with PBS aqueous solution (pH = 7.4).

[0215] 2.3.2.5 Add 200 μL of the prepared BCA working solution to each well, gently tap to mix, and incubate at 37°C for 30 min in a constant temperature incubator. Stop incubation when the standard shows a clear blue color.

[0216] 2.3.2.6 Place the 96-well plate in a multi-functional microplate reader and measure the absorbance of each well at a wavelength of 562 nm;

[0217] 2.3.2.7 Use ELISAcalc software to plot the standard curve equation, substitute the absorbance value of the sample to be tested into the calculated value of the protein concentration in the sample to be tested, and the actual protein concentration value is the calculated protein concentration value × 10.

[0218] 2.3.3 Leveling and denaturation: According to the protein concentration determination method of BCA in male rat seminal plasma EVs obtained in 2.3.2, the protein loading buffer of 5× was mixed evenly at a ratio of 4:1, and the protein concentration was increased at 100℃. The protein concentration of the seminal plasma EVs sample was adjusted with PBS aqueous solution (pH=7.4) to obtain a leveled protein dilution. The protein concentration in the leveled protein dilution was 4 mg / mL. The leveled protein dilution was heated for 15 min to denature the protein. After cooling to room temperature, it was stored in a -20℃ refrigerator for later use.

[0219] 2.3.4 SDS-PAGE electrophoresis

[0220] 2.3.4.1 Gel preparation: Prepare 12wt% separating gel and 5wt% stacking gel according to the instructions of the SDS-PAGE gel preparation kit (Beyotime);

[0221] 2.3.4.2 Glue Pouring: Clean the glass plate for glue preparation and dry it in a constant temperature oven. Align the bottoms of the long and short plates and place them into the glue rack. Clamp the device and use a 1mL pipette to add the prepared 12% separating glue along the edge of the glass plate (to 2 / 3 of the short plate). Then add a small amount of anhydrous ethanol to seal the opening and prevent the glue from contacting air. Let it stand at room temperature for 30 minutes. After the separating glue solidifies, pour out the ethanol and blot it dry with filter paper. Use the same method to pour the prepared 5% concentrated glue. Insert the comb at an angle in time to avoid air bubbles. Let it solidify at room temperature for 30 minutes.

[0222] 2.3.4.3 SDS-PAGE electrophoresis: Remove the comb, fill the well with the prepared 1× electrophoresis buffer, add 5 μL of pre-stained protein marker (170 kD) from the leftmost lane, and add 40 μg of the balanced protein dilution sample to the sample well; install the electrophoresis tank and fill it with electrophoresis buffer, turn on the power, and run the electrophoresis at 80 V for 30 min. When the sample enters the separating gel and forms a straight line, run the electrophoresis at 120 V for 80 min.

[0223] 2.3.5 Transfer (semi-dry method) and sealing

[0224] 2.3.5.1 Cut the polyvinylidene fluoride (PVDF) membrane to a size of 5cm × 8cm;

[0225] 2.3.5.2 Immerse the PVDF membrane in anhydrous ethanol for 2 minutes to activate it;

[0226] 2.3.5.3 Transfer the activated PVDF membrane, filter paper, and gel to the transfer solution prepared in step 1.4 of Example 1 and soak at room temperature for 30 seconds to fully wet them. Turn on the semi-dry transfer apparatus, cut the gel according to the position of the protein marker, and place them in the order of filter paper (negative)-PVDF membrane-gel-filter paper (positive). During this process, use a roller to compact the gel so that there are no air bubbles between each layer.

[0227] 2.3.5.4 Cover the transfer apparatus with the cover plate and transfer at a constant voltage of 20V for 20 minutes;

[0228] 2.3.5.5 The blocking solution used was rapid blocking solution (PBSTw, Beyotime). After the membrane transfer was completed, the membrane was washed with PBST washing solution on a decolorizing shaker for 2 min and then placed in the blocking solution at room temperature for 1 h.

[0229] 2.3.6 Incubation of primary and secondary antibodies

[0230] 2.3.6.1 Prepare CD9, CD63, and CD81 primary antibodies according to the volume ratio of primary antibody dilution buffer: antibody = 1000:1. Dry the PVDF membrane with filter paper, place it in the primary antibody box, and incubate it overnight on a shaker in a cold storage (4.3℃).

[0231] 2.3.6.2 After the primary antibody incubation is complete, wash the membrane three times on a shaker with PBST washing buffer for 15 min each time;

[0232] 2.3.6.3 Prepare each secondary antibody (HRP-labeled) corresponding to the primary antibody according to the volume ratio of secondary antibody dilution buffer: antibody = 2000:1. After drying the membrane with filter paper, place it in the secondary antibody box and incubate at room temperature for 1 hour.

[0233] 2.3.6.4 After the secondary antibody incubation is completed, wash the membrane three times on a shaker with PBST washing solution for 15 minutes each time;

[0234] 2.3.7 Analysis of Gel Imaging System

[0235] The ECL ultrasensitive luminescent solution was thoroughly mixed in a 1:1 ratio (solution A:solution B = equal volumes). The washed PVDF membrane was then placed in a dish containing the luminescent solution and exposed and photographed using a gel imaging system (Fusion FX). The bands were analyzed using ImageJ software. Figure 11 It can be seen that the extracted samples showed expression of three protein markers: CD9, CD63, and CD81, which are consistent with the characteristics of extracellular vesicle proteins.

[0236] Step (3): Determine the effect of rat seminal plasma EVs exposed to different lead concentrations on normal rat sperm:

[0237] Extract seminal plasma EVs from rats exposed to different lead concentrations using the same extraction method as in step (1), and co-culture them with normal male rat sperm.

[0238] 3.1 Determining the effect of lead-exposed rat seminal plasma EVs on sperm motility in normal rats;

[0239] Sperm was extracted from the epididymal tail of healthy rats using the same extraction method as in Example 1, section 2.1. The semen was liquefied in a 37°C water bath for 20 minutes. 3 mL of prepared BWW culture medium was placed at the bottom of a 15 mL sterile centrifuge tube, and 2 mL of the liquefied semen was slowly added along the tube wall. The tube was centrifuged at 900 x g for 5 minutes to separate the seminal plasma from the sperm. The supernatant was discarded, and the sperm clumps were resuspended in 2 mL of BWW culture medium to prepare a sperm suspension. 5 μL of this suspension was added to a disposable sperm analysis standard slide (4 compartments, Spain). The concentration of the sperm suspension was assessed using the SSA-II automated sperm detection and analysis system. The sperm suspension was adjusted with BWW culture medium to bring the sperm cell concentration close to 1 x 10⁻⁶. 7 / mL, two 1mL aliquots of sperm suspension were taken into 24-well plates each time, and rat seminal plasma EVs exposed to different lead concentrations and healthy male rat seminal plasma EVs were added to make the rat seminal plasma EV content in 1mL sperm suspension 10μg / μL. The plates were incubated in an incubator at 37℃, 5% CO2, and 95% humidity. Sperm motility was measured at 1h and 4h, and the detection indicators were the same as those in the semen quality analysis in Example 1.2; The results of the detection of the effect of healthy male rat seminal plasma EVs on the sperm motility of normal rats are shown in Table 8:

[0240] Table 8

[0241]

[0242] Note: * indicates P < 0.05, ** indicates P < 0.01;

[0243] The effects of different lead concentrations of rat seminal plasma EVs on sperm motility in normal rats (after incubation for 15 min) are shown in Table 9.

[0244]

[0245]

[0246] Table 9

[0247] The effects of different lead concentrations of rat seminal plasma EVs on sperm motility in normal rats (after 1 hour of incubation) are shown in Table 10.

[0248] Table 10

[0249]

[0250] The effects of different lead concentrations of rat seminal plasma EVs on sperm motility in normal rats (after 2 hours of incubation) are shown in Table 11.

[0251] Table 11

[0252]

[0253]

[0254] The effects of different lead concentrations of rat seminal plasma EVs on sperm motility in normal rats (after 4 hours of incubation) are shown in Table 12.

[0255] Table 12

[0256]

[0257] From Table 8-12 and Figure 12It was found that at 15 min of incubation, there was no significant difference in sperm motility parameters between the control group and the 0.20% PbAC-treated group co-cultured with EVs. However, after 1 h of incubation, compared with the control group, the percentage of grade A sperm in the 0.20% PbAC-treated group co-cultured with EVs was significantly lower (P = 0.047). After 2 h of incubation, the percentage of grade A sperm in the 0.20% PbAC-treated group co-cultured with EVs was significantly lower (P = 0.015), while the percentage of immotile sperm (IM, i.e., grade D sperm) and the mean velocity curve (VCL) were significantly higher (P = 0.039). After 4 hours of incubation, the percentages of progressively motile sperm (PR = 0.022), non-progressively motile sperm (PRNP = 0.044), grade B sperm (P = 0.020), and grade C sperm (P = 0.044) in sperm co-cultured with EVs in the 0.20% PbAC-treated group were significantly decreased; the percentage of immotile sperm (IM), i.e., grade D sperm (P = 0.044), was significantly increased. At the above four time points, no statistically significant differences were found between the sperm co-cultured with EVs in the 0.04% PbAC-treated group and the control group in any of the motility indicators. Figure 12 Chinese: A: Effect of seminal plasma extracellular vesicles on sperm motility in healthy rats; B: Effect of seminal plasma extracellular vesicles on sperm motility in lead-poisoned rats after 1 hour of incubation; C: Effect of seminal plasma extracellular vesicles on sperm motility in lead-poisoned rats after 2 hours of incubation; D: Effect of seminal plasma extracellular vesicles on sperm motility in lead-poisoned rats after 4 hours of incubation.

[0258] 3.2 Determining the effect of lead-exposed rat seminal plasma EVs on sperm capacitation in normal rats;

[0259] Sperm capacitation can be evaluated by detecting sperm tyrosine phosphorylation (P-Tvr) levels using Western blotting with rat anti-phosphotyrosine antibody clone 4G10 (Millipore). The procedure is as follows:

[0260] 3.2.1 Sperm capacitation: Prepare sperm suspension according to the method in step 3.1. When culturing rat sperm, add 3 mg / mL bovine serum albumin (BSA) to BWW medium to facilitate sperm capacitation. Incubate in a 37℃, 5% CO2 incubator for 4 h to obtain capacitation sperm.

[0261] 3.2.2 Sperm protein lysis: Collect capacitated sperm and centrifuge at 12000xg for 5 min at 4℃. A small amount of sperm precipitate can be seen at the bottom of the EP tube. Carefully remove the supernatant and lyse the sperm protein according to the method in step 2.3.2. Add 50 μL of phosphatase inhibitor to the lysis buffer. The entire process is carried out on ice.

[0262] 3.2.3 Western blot: The remaining steps are the same as in step 2.3, except that the PBS / PBST solution is replaced with TBS / TBST solution. Block with 5% BSA for 1 h at room temperature. The primary antibody is rat antiphosphotyrosine 4G10 (1:1000 dilution; Merck, Germany). The intensity of the protein blot is analyzed using ImageJ software.

[0263] Depend on Figure 14 It was found that, compared with the control group, the tyrosine phosphorylation level of sperm protein in rats supplemented with EVs from healthy male rats was significantly increased at around 70 KD (P = 0.028), while it was significantly decreased at 40-55 KD and 35-40 KD (P = 0.009, P = 0.009). There were no significant differences in the tyrosine phosphorylation levels of rat sperm protein between the control group and the 0.20% EV group at 70 KD, 40-55 KD, and 35-40 KD. Figure 14 (C, D); Detection of Ca in sperm cells 2+ At the same level, the concentration of calcium ions in sperm in the group supplemented with EVs was significantly higher than that in the control group (P = 0.001); the concentration of calcium ions in sperm in the control group supplemented with EVs was significantly higher than that in the group supplemented with 0.20% EVs (P < 0.001). Figure 14 In the middle: A: Western blot analysis of tyrosine phosphorylation in rat sperm proteins in the blank group and the EV-added group; B: Difference in tyrosine phosphorylation levels of sperm proteins between the blank group and the EV-added group; C: Western blot analysis of tyrosine phosphorylation in rat sperm proteins in the supplemented control group (EVs) and the 0.20% EV-added group; D: Difference in tyrosine phosphorylation levels of rat sperm proteins in the supplemented control group (EVs) and the 0.20% EV-added group; E: Left panel: Ca in rat sperm proteins in the blank group and the EV-added group. 2+ Level differences, right figure: Rat sperm Ca2+ levels in the control group (EVs) and the 0.20% EV group. 2+ Level differences;

[0264] 3.3 Determining the effect of lead-exposed rat seminal plasma EVs on the acrosome response of normal rat sperm;

[0265] The acrosome reaction test is a stable sperm function parameter, mainly evaluated through the structural integrity of the acrosome. The acrosome reaction is induced and evaluated; the procedure is as follows:

[0266] 3.3.1 Sperm capacitation: Prepare a sperm suspension according to the method in step 3.1, and incubate it in an incubator at 37℃ and 5% CO2 for 3 hours to obtain capacitation sperm;

[0267] 3.3.2 Acrosome reaction: After capacitation, the sperm suspension is added with Ca dissolved in DMSO. 2+ Carrier A23187 enables Ca2+ The final concentration of carrier A23187 was 10 μmol / L. It was incubated in a 37℃, 5% CO2 incubator for 1 h to induce the acrosome reaction in sperm.

[0268] 3.3.3 Centrifugation and washing: After the acrosome reaction, the semen suspension was centrifuged at 600xg for 5 min. The supernatant was removed, and 1 mL of GENMED cleaning buffer (Reagent A) was added. The particles were mixed thoroughly, and sperm cells were counted on disposable sperm analysis standard slides, adjusting the volume to 2×10⁻⁶. 7 / mL;

[0269] 3.3.4 Staining and fixation: Transfer 10 μL of sperm cells to a new 1.5 mL EP tube, add 10 μL of LGENMED staining solution (Reagent B), mix well, incubate at room temperature in the dark for 30 min, then add 1 μL of LGENMED fixation solution (Reagent C) and mix well.

[0270] 3.3.5 Slide pushing and sealing: Immediately transfer 10 μL to one end of a clean adhesive slide, push the slide with another slide at a 45° angle, add 20 μL of anti-fluorescence quenching sealing solution, and cover with a coverslip;

[0271] 3.3.6 Observation and counting: Immediately observe and count under a (confocal) fluorescence microscope (400X), observe the green fluorescence - filter excitation wavelength 395nm, emission wavelength 510nm;

[0272] Under high magnification, sperm that did not undergo acrosome reaction showed uniform bright green fluorescence throughout the acrosome, with only the equatorial surface of the acrosome showing green fluorescence. Sperm heads with no or low fluorescence were reactive acrosomes. At least 200 sperm should be randomly counted to calculate the percentage of sperm that underwent acrosome reaction.

[0273] The results of the determination of the effect of seminal plasma EVs from healthy male rats on the acrosome reaction of normal rat sperm are shown in Table 13:

[0274] Table 13

[0275]

[0276] The results of the determination of the effect of rat seminal plasma EVs exposed to different lead concentrations on the acrosome reaction of normal rat sperm are shown in Table 14:

[0277] Table 14

[0278]

[0279] From Table 13-14 and Figure 15It was found that, compared with the blank group, the addition of extracellular vesicles (EVs) to the seminal plasma of healthy rats significantly increased the sperm's reactive acrosome (P = 0.026) and acrosome reaction rate (12.65 ± 2.62 vs 16.89 ± 2.82, P = 0.036), indicating that extracellular vesicles may induce premature acrosome reaction in sperm. The analysis results of extracellular vesicles in the seminal plasma of lead-poisoned rats on sperm acrosome reaction showed that, compared with the control group, the extracellular vesicles in the seminal plasma of rats in the 0.20% PbAC poisoning group significantly increased the sperm's uncapacitated acrosome (P = 0.002), and significantly decreased the reactive acrosome (P = 0.001) and acrosome reaction rate (11.88 ± 1.98 vs 6.34 ± 0.96, P < 0.001), indicating that the extracellular vesicles in this group may have an inhibitory effect on sperm acrosome reaction. Figure 15 A: Acrosome reaction in rat sperm: CTC fluorescent staining, the left image shows uniform green fluorescence in the head of the uncapacitated acrosome, and the right image shows no fluorescence in the head of the reactive acrosome; B: Effect of seminal plasma extracellular vesicles in healthy rats on the acrosome reaction in rat sperm; C: Effect of seminal plasma extracellular vesicles in lead-poisoned rats on the acrosome reaction in rat sperm.

[0280] 3.4 Determination of protein profiles of EVs in seminal plasma of rats exposed to different lead concentrations

[0281] 3.4.1 Protein extraction and quantification: Protein samples were prepared and protein concentrations were determined using the method described in step 2.3 of Example 2 for protein biomarker identification;

[0282] 3.4.2 Protein reductive alkylation and enzymatic digestion:

[0283] 3.4.2.1 Take 30 μg of protein solution sample for each sample and dilute it to 100 μL with 25 mM ammonium bicarbonate aqueous solution to obtain protein solution;

[0284] 3.4.2.2 Reductive alkylation: First, add dithiothreitol (DTT) (Sigma) to the protein solution and mix well to make the final concentration of DTT 10 mM. Reduce at 95℃ for 5 min. Then add iodoacetamide (IAA) (Sigma) at a volume ratio of DTT:IAA = 1:5. Mix thoroughly and incubate in the dark at room temperature for 30 min for alkylation. After alkylation, centrifuge at 20000 x g for 10 min to obtain the reductively alkylated protein solution.

[0285] 3.4.2.3 The reduced alkylated protein solution was added to a 10kD ultrafiltration tube, washed three times with 200μL of 8M urea (13500xg, centrifuged), and then washed twice with 200μL of 50mM ammonium bicarbonate aqueous solution (13500xg, centrifuged). The solution at the bottom of the ultrafiltration tube was discarded.

[0286] 3.4.2.4 Add the protein solution in the ultrafiltration tube to 150 μL of 50 mM ammonium bicarbonate aqueous solution, add trypsin (Promega) and Lys-C (intracellular protease) at a ratio of 1:50, and digest at 37°C for 16 h;

[0287] 3.4.2.5 After digestion, collect the enzymatically digested polypeptide fragments by centrifugation: Centrifuge at 13500xg to recover the polypeptide fragments into a new collection tube. To improve the recovery rate of polypeptide fragments, wash the filter membrane twice with 200μL of 50mM ammonium bicarbonate aqueous solution, centrifuge to concentrate and dry to obtain polypeptide fragments.

[0288] 3.4.3 Monospin desalting column desalting: The peptide fragments are desalted by passing them through a Monospin desalting column, dried, and then prepared for mass spectrometry analysis. The desalting method is as follows:

[0289] 3.4.3.1 The dried polypeptide fragments were dissolved in 0.1% trifluoroacetic acid (TFA) solution to obtain a reconstituted sample;

[0290] 3.4.3.2 Activate the desalination column using 100% acetonitrile;

[0291] 3.4.3.3 Equilibrate the desalting column using 0.1% TFA solution;

[0292] 3.4.3.4 Add the reconstituted sample to the desalting column and centrifuge;

[0293] 3.4.3.5 Add 0.1% TFA solution to wash the desalting column;

[0294] 3.4.3.6 Add 50% acetonitrile solution, centrifuge, elute the polypeptide fragments, and collect the eluent using a new EP tube;

[0295] 3.4.3.7 Centrifuge, concentrate, and dry the eluent to remove acetonitrile;

[0296] The dried polypeptide fragments were dissolved in 0.1% trifluoroacetic acid (TFA), desalted using a C-18 column, and then concentrated by vacuum centrifugation.

[0297] 3.4.4 Detection by liquid chromatography-tandem mass spectrometry (LC-MS / MS):

[0298] 3.4.4.1 The peptide fragments after vacuum desalting and concentration were reconstituted with mass spectrometry solution A, centrifuged at 13000 rpm for 5 min, the supernatant was collected and slowly added to the sample vial, and chromatographic separation was performed using a nano-flow HPLC system EASY-nLC1200 (Thermo Scientific, USA).

[0299] 3.4.4.2 The analytical column (C-18, 1.9 μm, 75 μm × 20 cm) was subjected to gradient elution with a 0.1% formic acid-acetonitrile aqueous solution B (84% acetonitrile and 0.1% formic acid) at a flow rate of 300 nL / min;

[0300] 3.4.4.3 An Orbitrap Fusion Lumos (Thermo Scientific, USA) mass spectrometer was used with positive ion detection. The first-stage mass spectrometry resolution was 70,000, the first-stage mass spectrometry scan range was 300-1800 m / z, the automatic gain control (AGC) was set to 1e6, the maximum ion injection time was 50 ms, the dynamic exclusion time (DE) was 60 s, the second-stage mass spectrometry resolution was 17,500, the isolation window was 2.0 m / z, the higher energy collision dissociation (HCD) mode was used, and the normalized collision energy (NCE) was set to 30 eV.

[0301] 3.4.5 Protein Identification and Quantitative Analysis: Protein ID sequences were obtained by searching the database using Thermo's Proteome Discoverer 2.5. Quality control analysis was performed based on enzymatic digestion efficiency. Protein and peptide characteristics were analyzed using: a. protein relative molecular mass distribution; b. peptide sequence length distribution; c. distribution of identified peptide number; d. protein coverage distribution.

[0302] Relative quantification of peptide fragments is performed using the more precise primary mass spectrometry-related peptide peak intensity (precursor intensity) as the label-free quantification parameter. When a protein is found to have multiple detected peptide fragments in the library, the peak intensities of all detected peptide fragments are weighted and calculated to obtain the peak intensity (abundance) of the protein expression. Figure 17 It can be seen that the relative molecular weight of proteins is mainly distributed in the range of 20-120 kDa. Figure 17 A); Proteins containing ≥2 unique peptides numbered 2954, accounting for 73.45% of the total proteins. Figure 17 B); the longest peptide length is 9, and the average length is 12.63, which is within the reasonable range for peptide length. Figure 17 C); The percentage of proteins with identification coverage in the range of [0, 10%] was 38.59%, proteins with coverage ≥20% accounted for 41.42% of the total proteins, and the average protein identification coverage was 20.14%. Figure 17 D); Figure 17In Chinese: A: Relative molecular weight distribution of proteins; B: Distribution of unique peptide number; C: Distribution of peptide sequence length; D: Protein coverage distribution.

[0303] Furthermore, the peak intensities of each protein in each peptide sample were normalized to obtain the Abundance (Normalized), and the Abundance was used to perform quantitative analysis of each protein in all samples.

[0304] When comparing pairs between groups, the mean of the normalized signal of all samples within each group is calculated, and the Foldchange ratio between groups is calculated based on this. The Studentt-test is used to calculate the p-value between the two groups.

[0305] 3.4.5.1 For intragroup biological replicates that do not meet the ≥3 differential statistical screening criteria, proteins that meet the following two conditions are considered as intergroup differential proteins: a. Fold change ≥4 or ≤0.25 (i.e., 1 / 4); b. #Unique Peptides ≥2;

[0306] 3.4.5.2 For intra-group biological replicates ≥3, proteins meeting the following two conditions were selected as differentially expressed proteins between groups: a. Fold change ≥1.2 or ≤0.8333 (i.e., 1 / 1.2); bp-value <0.05; The enzyme digestion efficiency of each sample was statistically analyzed using Proteome Discoverer 2.4 library search results, and the statistical results are shown in Table 15.

[0307] Table 15

[0308]

[0309] The total statistical results of the mass spectrometry library search are shown in Table 16:

[0310] Table 16

[0311]

[0312]

[0313] The number of protein types in each sample obtained from the database search is shown in Table 17:

[0314] Table 17

[0315]

[0316] 3.4.6 Bioinformatics Analysis:

[0317] 3.4.6.1 Significant Difference Analysis: Data from mass spectrometry analysis of peptide samples were subjected to intergroup T-tests / U-tests for statistical calculation, yielding two parameters: p-value and foldchange. These two parameters were used to create a Volcanoplot. Proteins exhibiting upregulation and downregulation meeting certain foldchange and p-value criteria were represented by red dots, and other proteins by green dots. Figure 18 and Figure 19 As shown;

[0318] 3.4.6.2 Cluster Analysis: For differentially expressed proteins with inter-group modulation, unsupervised hierarchical cluster analysis was performed. Using protein expression data, the pairwise distances between multiple samples were calculated to form a distance matrix. The two closest clusters were merged into a new cluster, and the distance between the new cluster and each of the current clusters was calculated. This process of merging and calculation continued until only one cluster remained. The expression levels of the selected differentially expressed proteins were used to calculate the direct correlation between samples. In the cluster diagram, the horizontal axis represents the sample names between groups, and the vertical axis represents the differentially expressed genes. In the diagram, red indicates high expression levels of differentially expressed genes in the grouped samples, and blue indicates low expression levels of differentially expressed proteins in the grouped samples. Figure 20 and Figure 21 As shown;

[0319] 3.4.6.3 GO Enrichment Analysis: GO consists of three ontologies, describing the molecular function, cellular location, and biological process of a gene. GO analysis was performed on differentially expressed proteins between groups, and the 10 items with the smallest p-values ​​were selected to create a barplot (if fewer than 10 items are selected, all are displayed). In the barplot, the vertical axis represents the Numbers of Count (the number of genes matched to that item), and the horizontal axis represents the number of items. Figure 22-25 As shown;

[0320] 3.4.6.4 KEGG Pathway Enrichment Analysis: Pathway enrichment analysis first maps differentially expressed proteins to pathways in the KEGG database. Then, algorithms such as Fisher's are used to calculate the probability of differentially expressed proteins mapping to different pathways; this is the pathway enrichment analysis. A p-value < 0.05 indicates that the significant enrichment of a pathway is not a low-probability event but rather a pathway influenced by the experimental treatment. Pathway analysis is performed on differentially expressed proteins between groups, and the 15 items with the smallest p-values ​​are selected to create a dotplot (if there are fewer than 15, all are displayed). In the dotplot, the horizontal axis represents the GeneRatio (the number of genes matched to this item in the input list (Count) / the total number of genes identified in the corresponding category in the input list), and the vertical axis represents the items. The color of the dot represents the p-value (statistical significance level of the enrichment analysis), and the size of the dot represents the Count (the number of genes matched to this item). Figure 26-29 As shown;

[0321] Table 18 shows the differentially expressed proteins in extracellular vesicles of the epididymal fluid of lead-exposed rats compared to the control group:

[0322] Table 18

[0323]

[0324]

[0325] Table 19 shows the differentially expressed proteins in extracellular vesicles of seminal plasma from lead-exposed rats compared to the control group.

[0326] Table 19

[0327]

[0328] As shown in Tables 18 and 19, compared with the control group, there were 397 differentially expressed proteins in the extracellular vesicles of the prostatic fluid of rats exposed to lead, of which 186 were upregulated and 211 were downregulated; there were 841 differentially expressed proteins in the extracellular vesicles of the seminal vesicles, of which 341 were upregulated and 500 were downregulated; there were 37 differentially expressed proteins in the extracellular vesicles of the epididymis, of which 14 were upregulated and 23 were downregulated; and there were 7 differentially expressed proteins in the extracellular vesicles of the seminal plasma, of which 2 were upregulated proteins (ACADVL and TTC17), and 5 were downregulated proteins (nonspecific serine / threonine protein kinase, choline transporter-like protein (CTL), Src kinase-associated phosphoprotein 2 (SKAP2), Ras-associated protein (RalGDS / AF-6), pleckstrin homologous domain 1 (RAPH1), and heme-binding protein 2 (HEBP2).

[0329] Example 9

[0330] This embodiment discloses a method for establishing a human sperm lead poisoning model, including the following steps:

[0331] Step (1) Extracting human seminal plasma (EVs)

[0332] 1.1 Selection of experimental subjects (semen donation volunteers)

[0333] Selection criteria: ① Age 18 years or older; ② No inflammation of the urogenital system such as orchitis or epididymitis; ③ No trauma to the reproductive system; ④ No obvious abnormalities of the reproductive organs such as the testes, epididymis, and accessory glands (including cryptorchidism, spermatic cord torsion, epididymal nodules, varicocele, etc.); ⑤ No fertility-related genetic diseases;

[0334] Exclusion criteria: ① Abuse of tobacco and alcohol; ② Excessive and frequent staying up late; ③ Long-term state of high stress; ④ Insufficient secretion of sex hormones; ⑤ Recent use of drugs that damage the reproductive system;

[0335] The research of this invention has been approved by the Ethics Committee of Xinxiang Medical College (Ethics Review Approval No.: XYLL-20170311);

[0336] Human semen donated by volunteers was cryopreserved at -80°C.

[0337] 1.2 Extraction of human seminal plasma (EVs)

[0338] 1.2.1 Thaw the human semen stored at -80℃ naturally, transfer it into a sterile EP tube, and centrifuge it at 13000g for 10 minutes at 4℃ to remove sperm cells and other substances.

[0339] 1.2.2 Take the supernatant from the centrifugation and add it to the ultrafiltration tube. Then add 10 mL of exosome diluent and centrifuge using a horizontal rotor centrifuge at 22°C and 3000 g centrifugal force until the liquid volume in the ultrafiltration tube is 2 mL to remove small molecules, salts and other substances.

[0340] 1.2.3 Add 15 mL of exosome diluent to the ultrafiltration tube again and repeat the above steps until the liquid volume in the ultrafiltration tube is about 250 μL. Blow the ultrafiltration tube to wash out the liquid and obtain human seminal plasma (EVs).

[0341] Human seminal plasma (EVs) were frozen at -80°C.

[0342] Step (2): Identify human seminal plasma EVs using the same method as the identification method for healthy male rat seminal plasma EVs in Step (2) of Example 8.

[0343] Step (3): Determine the effect of rat seminal plasma EVs exposed to different lead concentrations on human sperm;

[0344] 3.1 Determination of the effect of rat seminal plasma EVs exposed to different lead concentrations on human sperm motility: The determination method is the same as step 3.1 in Example 8;

[0345] The results of the detection of the effect of human seminal plasma EVs on human sperm motility are shown in Table 20:

[0346] Table 20

[0347]

[0348] The effects of rat seminal plasma EVs exposed to different lead concentrations on human sperm motility (after 1 hour of incubation) are shown in Table 21.

[0349] Table 21

[0350]

[0351]

[0352] The effects of rat seminal plasma EVs exposed to different lead concentrations on human sperm motility (after 4 hours of incubation) are shown in Table 22.

[0353] Table 22

[0354]

[0355] From Table 20-22 and Figure 13 It was found that, compared with the control group, after 1 hour of incubation, the percentages of progressively motile sperm (PR, P=0.035), total motility percentage (PR+NP, P=0.037), grade B sperm percentage (P=0.013), and average lateral swing amplitude (ALH, P=0.022) were significantly decreased in the 0.20% extracellular vesicle-supplemented human sperm group, while the percentage of immotile sperm (IM, P=0.034), i.e., grade D sperm percentage (P=0.041), was significantly increased. These differences were statistically significant. After 4 hours of incubation, the 0.20% group of human sperm showed significantly increased motility. The percentages of forward-motile sperm (PR) (P = 0.005), total motility (PR+NP) (P = 0.025), hyperactivated sperm (P = 0.012), grade B sperm (P = 0.022), mean linear velocity (VSL) (P = 0.032), forward motility (STR) (P = 0.026), and mean whiplash frequency (BCF) (P = 0.028) were all significantly decreased, while the percentage of immotile sperm (IM) (P = 0.026), i.e., the percentage of grade D sperm (P = 0.027), was significantly increased. Figure 13Chinese: A: Effects of seminal plasma extracellular vesicles on sperm motility in healthy men (incubation for 4 hours); B: Effects of lead-poisoned seminal plasma extracellular vesicles on human sperm motility (incubation for 1 hour); C: Effects of lead-poisoned seminal plasma extracellular vesicles on human sperm motility (incubation for 4 hours).

[0356] 3.2 The effect of rat seminal plasma EVs exposed to different lead concentrations on human sperm capacitation was determined. The procedure is as follows:

[0357] 3.2.1 Sperm capacitation: Prepare sperm suspension according to the method in step (3) 3.1 of Example 8. When culturing human sperm, add 3 mg / mL human serum albumin (HSA) to BWW medium to facilitate sperm capacitation. Incubate in a 37°C, 5% CO2 incubator for 4 h to obtain capacitation sperm.

[0358] 3.2.2 Sperm protein cleavage: The method is the same as step 3.2.2 in Example 8;

[0359] 3.2.3 Western blotting of proteins: The method is the same as step 3.2.3 in Example 8; from Figure 14 It can be seen that detecting Ca in sperm cells 2+ At the same level, the intrasperm calcium ion concentration in the EV-supplemented group was significantly higher than that in the control group; the intrasperm calcium ion concentration in the EV-supplemented control group was significantly higher than that in the 0.20% EV-supplemented group. Figure 14 In the middle, F: Left figure: Intracellular Ca in human sperm cells of the blank group and the group with added healthy male EVs. 2+ Level differences, right figure: Human sperm Ca2+ levels in the supplemented control group (EVs) and the 0.20% EV group. 2+ Level differences;

[0360] 3.3 Determining the effect of lead-exposed rat seminal plasma EVs on the acrosome response of normal rat sperm;

[0361] The measurement method is the same as step 3.3 in Example 2; the results of the measurement of the effect of human seminal plasma EVs on the acrosome reaction of human sperm are shown in Table 23.

[0362] Table 23

[0363]

[0364] The results of the determination of the effects of rat seminal plasma EVs exposed to different lead concentrations on the acrosome reaction of human sperm are shown in Table 24.

[0365] Table 24

[0366]

[0367] From Table 23-24 and Figure 16It was found that, compared with the control group, the number of uncapacitated acrosomes in sperm supplemented with healthy male seminal plasma EVs was significantly reduced (P = 0.027), while the number of reactive acrosomes (P < 0.001) and the acrosome reaction rate (20.98 ± 1.08 vs 31.90 ± 4.34, P = 0.004) were significantly increased. This indicates that extracellular vesicles may induce premature acrosome reaction in human sperm. See Table 23 for details. Figure 16 (B); such as Figure 16 (C) shows that compared with the control group, the number of non-capacitated acrosomes in human sperm from rat seminal plasma EVs supplemented with 0.20% PbAC was significantly reduced (P = 0.003), while the number of reactive acrosomes (P = 0.001) and the acrosome reaction rate (29.88 ± 2.88 vs 20.32 ± 2.54, P = 0.001) were significantly increased. This indicates that extracellular vesicles exposed to lead may lead to a decrease in the acrosome reaction rate of human sperm through some mechanism. Figure 16 Chinese: A: The acrosome reaction in human sperm; B: The effect of extracellular vesicles in seminal plasma from healthy men on the acrosome reaction in human sperm; C: The effect of extracellular vesicles in seminal plasma from lead-exposed men on the acrosome reaction in human sperm.

[0368] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A preparation method for the preparation of an extracellular vesicle pathway to optimize sperm function, Its characteristic is that Include the following steps: Step 1: Construct the plasmid; Amplification of SKAP2-CDS sequence from PCR reaction of cDNA; The SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between BamHI and EcoRI sites to obtain a recombinant plasmid; Among them, the cDNA includes human cDNA and mouse cDNA; The human SKAP2-CDS sequence was obtained from the PCR amplification of human cDNA, and the mouse SKAP2-CDS sequence was obtained from the PCR amplification of mouse cDNA; The sequence of the forward primer of human SKAP2-CDS is shown in SEQ ID NO.1: 5’- TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCAGCACCTCCT -3’; The sequence of the reverse primer of human SKAP2-CDS is shown in SEQ ID NO.2: 5’- CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTATGTAG -3’; The sequence of human SKAP2 is shown in SEQ ID NO.3: ATGCCCAACCCCAGCAGCACCTCCTCTCCCTACCCCCTCCCTGAGGAAATTAGGAACCTGTTGGCAGATGTTGAAACATTTGTAGCAGATATACTGAAAGGAGAAAATTTATCCAAGAAAGCAAAGGAAAAGAGAGAATCCCTTATTAAGAAGATAAAAGATGTAAAGTCTATCTATCTTCAGGAATTTCAAGACAAAGGTGATGCAGAAGATGGGGAAGAATATGATGACCCTTTTGCTGGGCCTCCAGACACTATTTCATTAGCCTCAGAACGATATGATAAAGACGATGAAGCCCCCTCTGATGGAGCCCAGTTTCCTCCAATTGCAGCACAAGACCTTCCTTTTGTTCTAAAGGCTGGCTACCTTGAAAAACGCAGAAAAGATCACAGCTTTCTGGGATTTGAATGGCAGAAACGGTGGTGTGCTCTCAGTAAAACGGTATTCTATTATTATGGAAGTGATAAAGACAAACAACAGAAAGGTGAATTTGCAATAGATGGCTACAGTGTCAGAATGAATAACACTCTAAGAAAGGATGGAAAGAAAGATTGCTGTTTTGAAATCTCTGCTCCTGATAAACGTATATATCAGTTTACAGCAGCTTCTCCCAAAGATGCTGAAGAATGGGTACAGCAGCTGAAATTTGTATTGCAAGATATGGAATCTGATATTATTCCTGAGGATTATGATGAGAGAGGAGAATTATATGATGATGTTGATCATCCTCTACCAATAAGCAATCCACTAACAAGCAGTCAACCAATAGATGATGAAATTTATGAAGAACTTCCAGAAGAAGAAGAGGACAGTGCTCCAGTGAAAGTGGAAGAACAAAGGAAGATGAGTCAGGATAGTGTCCATCACACCTCAGGGGATAAGAGCACTGATTATGCTAATTTTTACCAGGGATTGTGGGATTGTACTGGAGCTTTTTCTGATGAGTTGTCATTTAAGCGTGGTGATGTGATTTACATTCTTAGCAAGGAATACAATAGATATGGCTGGTGGGTAGGAGAAATGAAGGGAGCCATTGGCTTGGTGCCTAAAGCCTACATAATGGAGATGTATGATATTTGA ; The sequence of mouse SKAP2-CDS forward primers is shown in SEQ ID NO.4: 5’- TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCTGTACCTCTT -3’; The sequence of mouse SKAP2-CDS reverse primer is shown in SEQ ID NO.5: 5’- CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTAGGTAG -3’; The sequence of mouse SKAP2 is shown in SEQ ID NO.6: ATGCCCAACCCCAGCTGTACCTCTTCTCCCGGCCCTCTCCCTGAGGAAATTAGGAACCTGTTGGCAGATGTTGAAACATTTGTGGCAGACACACTGAAAGGAGAAAATTTATCCAAGAAAGCCAAGGAAAAGAGAGAATCTCTCATTAAGAAGATAAAAGATGTAAAGTCTGTCTATCTTCAGGAATTTCAAGACAAAGGTGATGCTGAGGACGGCGATGAATATGACGATCCCTTTGCTGGGCCTGCAGACACGATTTCCTTAGCCTCAGAGCGCTACGATAAAGATGATGATGGCCCCTCTGATGGAAACCAGTTTCCTCCCATTGCAGCCCAGGACCTTCCTTTTGTCATAAAGGCTGGCTACCTGGAAAAACGCAGAAAAGATCACAGCTTTCTGGGGTTTGAATGGCAGAAACGGTGGTGTGCGCTCAGCAAAACAGTGTTCTATTATTACGGGAGCGATAAAGACAAGCAACAGAAAGGTGAATTTGCAATAGATGGCTATGATGTCAGAATGAACAACACCCTTAGGAAGGATGGAAAGAAAGATTGCTGTTTTGAAATCTGTGCTCCCGACAAACGTATCTATCAGTTTACAGCAGCCTCTCCCAAAGATGCTGAGGAATGGGTCCAGCAGCTGAAATTTATACTACAAGACCTGGGATCCGACGTTATTCCTGAGGATGATGAGGAAAGAGGAGAATTATATGATGACGTTGACCATCCTGCTGCCGTCAGCAGCCCGCAGAGGAGCCAGCCAATCGATGATGAGATTTATGAGGAGCTCCCAGAGGAGGAAGAGGACACTGCTTCAGTGAAGATGGACGAGCAAGGGAAGGGAAGTCGGGACAGTGTGCATCACACCTCAGGAGATAAAAGCACTGATTACGCTAATTTTTACCAGGGTCTGTGGGACTGCACTGGAGCTCTGTCTGATGAGTTGTCCTTTAAGCGTGGTGATGTGATTTACATTCTTAGCAAGGAATACAATAGATATGGCTGGTGGGTAGGAGAGATGAAGGGAGCCATTGGCTTGGTGCCTAAAGCCTACCTAATGGAGATGTATGATATTTGA ; The PCR reaction system includes: 2×Phanta Max Master Mix, upstream primers, downstream primers, cDNA templates, DNA polymerase, deionized water, and the PCR reaction program includes: pre-deformation, denaturation, annealing, extension, circulation, and complete extension; The process of inserting the SKAP2-CDS sequence into the PHY-GFP plasmid between BamHI and EcoRI sites includes: using BamHI and EcoRI endonuclease to perform dual enzyme digestion of SKAP2 PCR product and PHY-GFP plasmid, respectively, and using DNA ligase to connect the target gene fragment after the digestion and the plasmid fragment to form a recombinant plasmid; Step 2: Cell transfection and cell line construction; First use EZ transtransfection reagent for recombinant plasmid transfection, then use recombinant plasmid product to transfect HEK293T cells, purify, and collect supernatant; The process of transfection of the cell specifically includes: (1) Use EZ trans transfection reagent for recombinant plasmid transfection: dilute the EZ Trans transfection reagent into serum-free high-saccharide DMEM culture medium, mix well, and obtain diluted transfection reagent; diluted reagent DNA into serum-free high-saccharide DMEM culture medium, mix well, add diluted transfection reagent, mix well, and place at room temperature to complete recombinant plasmid transfection to form EZTrans-DNA complex, that is, recombinant plasmid product; (2) Drop the EZ Trans-DNA complex into a culture dish containing HEK293T cells, disperse it evenly, and co-incubate the cells for transfection; HEK293T cells were cultured using the collected supernatant and fresh culture medium. After the culture was completed, the HEK293T cells were transferred to culture medium containing puromycin for continued cultivation. After continuing to culture, the HEK293T cells were transferred to culture medium containing puromycin for subsequent culture to obtain a cell line; Step 3: Isolate exosomes; The cell line is amplified and cultured. After the amplification and culture is completed, the supernatant is washed, cultured, and the supernatant is collected; the supernatant is centrifuged, filtered, concentrated, and PBS is added to the concentrate and concentrated again to obtain an exosome suspension; The exosome suspension is a preparation for optimizing sperm function by the extracellular vesicle pathway.

2. A preparation method of a preparation for optimizing sperm function by extracellular vesicle pathway, Its characteristic is that Include the following steps: Step (1) Extract milk source exosomes; The first centrifugation of the milk was performed, the first centrifugation supernatant was performed, the second centrifugation supernatant was performed, the second centrifugation supernatant was performed, the second centrifugation supernatant was performed, the second centrifugation supernatant was collected, the centrifugation pellet was washed, and filtered to obtain an exosome suspension; The exosome suspension is milk-derived exosome; Among them, the conditions for the first centrifugation treatment are centrifugation at a temperature of 4℃ and centrifugation for 25-35 minutes under 13000xg centrifugation force, the conditions for the second centrifugation treatment are centrifugation for 50-70 minutes under 100000xg centrifugation force, and the conditions for the third centrifugation treatment are centrifugation for 80-100 minutes under 145000xg centrifugation force; Step (2), exosomal protein coating; Milk-derived exosomes were loaded on SKAP2 protein by ultrasonic system: Milk-derived exosomes and SKAP2 protein were mixed in PBS at a mass ratio of 1:1, and after the ultrasonic treatment was completed, it was incubated to obtain SKAP2 protein coated with milk-derived exosomes; Among them, the conditions for sonication are for 30 seconds after ultrasonication at 20% amplitude, cool down for 2 minutes, and the ultrasonic-cooling process is 6 cycles; the conditions for incubation are for 50-70 minutes at 37℃; The SKAP2 protein is prepared by following steps: Amplification of SKAP2-CDS sequence from PCR reaction of cDNA; The SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between BamHI and EcoRI sites to obtain the SKAP2 protein; The cDNA includes human cDNA and mouse cDNA; The human SKAP2-CDS sequence was obtained from the PCR amplification of human cDNA, and the mouse SKAP2-CDS sequence was obtained from the PCR amplification of mouse cDNA; The sequence of the forward primer of the human SKAP2-CDS is shown in SEQ ID NO.1: 5’- TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCAGCACCTCCT -3’; The sequence of the reverse primer of human SKAP2-CDS is shown in SEQ ID NO.2: 5’- CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTATGTAG -3’; The sequence of human SKAP2 is shown in SEQ ID NO.3: ATGCCCAACCCCAGCAGCACCTCCTCTCCCTACCCCCTCCCTGAGGAAATTAGGAACCTGTTGGCAGATGTTGAAACATTTGTAGCAGATATACTGAAAGGAGAAAATTTATCCAAGAAAGCAAAGGAAAAGAGAGAATCCCTTATTAAGAAGATAAAAGATGTAAAGTCTATCTATCTTCAGGAATTTCAAGACAAAGGTGATGCAGAAGATGGGGAAGAATATGATGACCCTTTTGCTGGGCCTCCAGACACTATTTCATTAGCCTCAGAACGATATGATAAAGACGATGAAGCCCCCTCTGATGGAGCCCAGTTTCCTCCAATTGCAGCACAAGACCTTCCTTTTGTTCTAAAGGCTGGCTACCTTGAAAAACGCAGAAAAGATCACAGCTTTCTGGGATTTGAATGGCAGAAACGGTGGTGTGCTCTCAGTAAAACGGTATTCTATTATTATGGAAGTGATAAAGACAAACAACAGAAAGGTGAATTTGCAATAGATGGCTACAGTGTCAGAATGAATAACACTCTAAGAAAGGATGGAAAGAAAGATTGCTGTTTTGAAATCTCTGCTCCTGATAAACGTATATATCAGTTTACAGCAGCTTCTCCCAAAGATGCTGAAGAATGGGTACAGCAGCTGAAATTTGTATTGCAAGATATGGAATCTGATATTATTCCTGAGGATTATGATGAGAGAGGAGAATTATATGATGATGTTGATCATCCTCTACCAATAAGCAATCCACTAACAAGCAGTCAACCAATAGATGATGAAATTTATGAAGAACTTCCAGAAGAAGAAGAGGACAGTGCTCCAGTGAAAGTGGAAGAACAAAGGAAGATGAGTCAGGATAGTGTCCATCACACCTCAGGGGATAAGAGCACTGATTATGCTAATTTTTACCAGGGATTGTGGGATTGTACTGGAGCTTTTTCTGATGAGTTGTCATTTAAGCGTGGTGATGTGATTTACATTCTTAGCAAGGAATACAATAGATATGGCTGGTGGGTAGGAGAAATGAAGGGAGCCATTGGCTTGGTGCCTAAAGCCTACATAATGGAGATGTATGATATTTGA ; The sequence of the mouse SKAP2-CDS forward primer is shown in SEQ ID NO.4: 5’- TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCTGTACCTCTT -3’; The sequence of mouse SKAP2-CDS reverse primer is shown in SEQ ID NO.5: 5’- CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTAGGTAG -3’; The sequence of mouse SKAP2 is shown in SEQ ID NO.6: ATGCCCAACCCCAGCTGTACCTCTTCTCCCGGCCCTCTCCCTGAGGAAATTAGGAACCTGTTGGCAGATGTTGAAACATTTGTGGCAGACACACTGAAAGGAGAAAATTTATCCAAGAAAGCCAAGGAAAAGAGAGAATCTCTCATTAAGAAGATAAAAGATGTAAAGTCTGTCTATCTTCAGGAATTTCAAGACAAAGGTGATGCTGAGGACGGCGATGAATATGACGATCCCTTTGCTGGGCCTGCAGACACGATTTCCTTAGCCTCAGAGCGCTACGATAAAGATGATGATGGCCCCTCTGATGGAAACCAGTTTCCTCCCATTGCAGCCCAGGACCTTCCTTTTGTCATAAAGGCTGGCTACCTGGAAAAACGCAGAAAAGATCACAGCTTTCTGGGGTTTGAATGGCAGAAACGGTGGTGTGCGCTCAGCAAAACAGTGTTCTATTATTACGGGAGCGATAAAGACAAGCAACAGAAAGGTGAATTTGCAATAGATGGCTATGATGTCAGAATGAACAACACCCTTAGGAAGGATGGAAAGAAAGATTGCTGTTTTGAAATCTGTGCTCCCGACAAACGTATCTATCAGTTTACAGCAGCCTCTCCCAAAGATGCTGAGGAATGGGTCCAGCAGCTGAAATTTATACTACAAGACCTGGGATCCGACGTTATTCCTGAGGATGATGAGGAAAGAGGAGAATTATATGATGACGTTGACCATCCTGCTGCCGTCAGCAGCCCGCAGAGGAGCCAGCCAATCGATGATGAGATTTATGAGGAGCTCCCAGAGGAGGAAGAGGACACTGCTTCAGTGAAGATGGACGAGCAAGGGAAGGGAAGTCGGGACAGTGTGCATCACACCTCAGGAGATAAAAGCACTGATTACGCTAATTTTTACCAGGGTCTGTGGGACTGCACTGGAGCTCTGTCTGATGAGTTGTCCTTTAAGCGTGGTGATGTGATTTACATTCTTAGCAAGGAATACAATAGATATGGCTGGTGGGTAGGAGAGATGAAGGGAGCCATTGGCTTGGTGCCTAAAGCCTACCTAATGGAGATGTATGATATTTGA ; The PCR reaction system includes: 2×Phanta Max Master Mix, upstream primers, downstream primers, cDNA templates, DNA polymerase, deionized water, and the PCR reaction program includes: pre-deformation, denaturation, annealing, extension, circulation, and complete extension; The process of inserting the SKAP2-CDS sequence into the PHY-GFP plasmid between BamHI and EcoRI sites includes: using BamHI and EcoRI endonuclease to perform dual enzyme cleavage of SKAP2 PCR product and PHY-GFP plasmid, respectively, and using DNA ligase to connect the target gene fragment after the cleavage with the plasmid fragment to form the SKAP2 protein; The SKAP2 protein coated with milk-derived exosomes is a preparation for optimizing sperm function by the extracellular vesicle pathway.

3. A preparation method for optimizing sperm function by the extracellular vesicle pathway as claimed in claim 1.

4. A preparation method for optimizing sperm function by the extracellular vesicle pathway as claimed in claim 2.

Images