Method and kit for gene knockout based on CRISPR-Cas9

Abstract

The invention discloses a method and a kit for gene knockout based on CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9). The gene knockout method disclosed by the invention comprises the following steps: adding sgRNA of a targeted target gene, sgRNA-Q of a targeted Donor plasmid and the Donor plasmid containing a selection marker gene into a gene knockout system; according to the method, sgRNA is used for excising a notch of a target gene, sgRNA-Q is used for linearizing a Donor plasmid, the linearized Donor plasmid is inserted into the excising notch of the target gene, a selection marker gene is expressed, and normal expression of the target gene is blocked, so that knockout of the target gene is realized, and screening of gene knockout cells is realized by using the selection marker gene. According to the gene knockout method, the target gene can be accurately knocked out, and the gene knockout cell line can be efficiently, rapidly and accurately obtained by utilizing the expression of the selection marker gene.

Description

Technical Field

[0001] The present application relates to the field of gene knockout technology, and in particular to a method and kit for gene knockout based on CRISPR-Cas9. Background Art

[0002] Gene editing is a technology that modifies a specific target genome. It can be used to correct genome mutations of genetic diseases and treat diseases. It can also edit normal genomes, simulate genome mutations of tumors and genetic diseases, and develop model research tools such as cells and animals. It has great application prospects in gene research, gene therapy, and gene breeding.

[0003] Existing technologies usually use sp-Cas9 alone to perform gene knockout on the genome. The main defects of this include: 1) the efficiency of gene knockout is relatively low, only about 1%-10%; 2) it is difficult to successfully construct a knockout cell line at a site with low cutting efficiency; 3) it is difficult to distinguish between edited cells and unedited cells; 4) there is a lack of screening markers, and the construction time of the knockout cell line is relatively long; 5) it lacks precision when used alone.

[0004] In addition, the existing technology has a cell model that uses CRISPR-Cas9 to knock out GBA1 in HeLa cells; however, it also has shortcomings such as long experimental cycle and low success rate.

[0005] Therefore, how to make the CRISPR-Cas9 gene knockout system more efficient, rapid and precise in editing specific genomes remains the research focus and difficulty in this field. Summary of the invention

[0006] The purpose of this application is to provide an improved method and kit for gene knockout based on CRISPR-Cas9.

[0007] In order to achieve the above objectives, this application adopts the following technical solutions:

[0008] The first aspect of the present application discloses a method for gene knockout based on CRISPR-Cas9, comprising adding sgRNA targeting a target gene, sgRNA-Q targeting a Donor plasmid, and a Donor plasmid containing a screening marker gene into a gene knockout system; using sgRNA to cut a gap in the target gene, and using sgRNA-Q to linearize the Donor plasmid containing the screening marker gene, at which time the linearized Donor plasmid is inserted into the target gene excision gap and expresses the screening marker gene; due to the insertion of the linearized Donor plasmid, the normal expression of the target gene is blocked, thereby achieving knockout of the target gene, and using the screening marker gene to achieve screening of gene knockout cells.

[0009] It should be noted that this application is based on the gene knockout method of CRISPR-Cas9, and creatively inserts a Donor plasmid containing a screening marker gene into the excision gap of the target gene, which blocks the normal expression of the target gene, thereby achieving the knockout of the target gene; and, because the Donor plasmid contains a screening marker gene, it can quickly screen and distinguish between gene-knocked cells and non-knocked cells, and obtain a knockout cell line in a shorter time. Furthermore, because the expression of the screening marker gene must synchronize the termination of the target gene, it is possible to achieve accurate gene knockout of the target gene.

[0010] In one implementation of the present application, the target gene is the GBA1 (gene ID: 2629) gene.

[0011] It should be noted that the knockout of the GBA1 gene is only a specific application of the gene knockout method of the present application in one implementation of the present application. Under the inventive concept of the present application, it is not excluded that other target genes can also be knocked out.

[0012] In one implementation of the present application, the sgRNA is the sequence shown in Seq ID No.1 or the sequence shown in Seq ID No.2;

[0013] Seq ID No.1: 5'-CGACGGATGGAGCTGAGTAT-3';

[0014] Seq ID No. 2: 5'-TACACGCAGTGGGCGACGGA-3'.

[0015] In one implementation of the present application, sgRNA-Q is the sequence shown in Seq ID No.3;

[0016] Seq ID No. 3: 5'-GTTCGAGCTTGCATGCCTGC-3'.

[0017] In one implementation of the present application, the screening marker resistance is at least one of Puromycin, Hygromycin B, Geneticin (G418), Blasticidin, MTS (Methotrexate), and MSX (L-Methionine-DL-sulfoximine).

[0018] Another aspect of the present application discloses a kit for gene knockout based on CRISPR-Cas9, comprising sgRNA targeting a target gene, sgRNA-Q targeting a Donor plasmid, and a Donor plasmid containing a screening marker gene.

[0019] It should be noted that the kit of the present application actually combines the sgRNA, sgRNA-Q and the Donor plasmid containing the screening marker gene used in the gene knockout method of the present application together for easy use. It is understood that, in principle, these sgRNAs can be synthesized separately in a biotechnology company, and the Donor plasmid containing the screening marker gene can also be purchased separately.

[0020] Due to the adoption of the above technical solution, the beneficial effects of this application are:

[0021] The present invention discloses a method for gene knockout based on CRISPR-Cas9, which can accurately knock out the target gene, and utilizes the expression of screening marker genes to efficiently, quickly and accurately obtain gene knockout cell lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a knockout PCR identification diagram in the example of this application;

[0023] Figure 2 This is a diagram showing the gene knockout sequence alignment results in the examples of this application;

[0024] Figure 3 and Figure 4 It is the homologous recombination PCR identification result in the embodiment of this application;

[0025] Figure 5 This is a diagram showing the gene knockout sequence alignment results in the examples of this application;

[0026] Figure 6 It is a Western Blot diagram in the examples of this application;

[0027] Figure 7 This is the result of homologous recombination enzyme activity in HeLa cells in the examples of this application;

[0028] Figure 8 This is a result diagram of GBA1 knockout in the examples of this application;

[0029] Fig. 9 This is a result diagram of transfection of pCL-GFP-RAB5B plasmid in the example of the present application;

[0030] Fig.10 It is a confocal image of the plasmid and mRNA with GBA1 gene added in the example of the present application;

[0031] Fig.11 is the plasmid map of pCL-Cas9 in the examples of this application;

[0032] Fig.12is the plasmid map of pCL-GBA1-KO-Donor in the examples of this application;

[0033] Fig.13 is the plasmid map of pCL-Cas9-sgRNA-Q in the embodiment of the present application;

[0034] Fig.14 This is the plasmid map of pCL-GFP-RAB5B in the examples of this application. DETAILED DESCRIPTION

[0035] The existing cell model for knocking out GBA1 in HeLa cells using CRISPR-Cas9 has a long experimental cycle and a low success rate.

[0036] The purpose of this application is to provide a more efficient method than the existing sp-Cas9, which can achieve efficient gene knockout on genes with low sp-Cas9 cutting efficiency, shorten the construction time of the tool cell line, and accurately edit a specific genome. Based on the previous use of a single sp-Cas9, this application innovatively adds a Donor system to develop a gene knockout method with three plasmids or two plasmids inserted into a screening marker protein. A cell model for knocking out GBA1 in 293T cells using a three-plasmid system, in which sgRNA1 was verified by confocal microscopy to successfully knock out GBA1.

[0037] Based on the above research and understanding, the present application provides a method for gene knockout based on CRISPR-Cas9, including adding sgRNA targeting the target gene, sgRNA-Q targeting the Donor plasmid and a Donor plasmid containing a screening marker gene to the gene knockout system; using sgRNA to cut a gap in the target gene, and using sgRNA-Q to linearize the Donor plasmid, at which time the linearized Donor plasmid is inserted into the excision gap of the target gene and expresses the screening marker gene; due to the insertion of the linearized Donor plasmid, the normal expression of the target gene is blocked, thereby achieving the knockout of the target gene, and using the screening marker gene to achieve screening of gene knockout cells.

[0038] In one implementation of the present application, for the GBA1 gene, the present application specifically uses an sgRNA (sgRNA1 or sgRNA2) targeting the human target gene GBA1, and further adds sgRNA-Q (sgRNA targeting the pCL-Puro-Donor plasmid) and pCL-Puro-Donor (providing the selection marker gene Puromycin to the knockout cells), the purpose of which is that after the sgRNA of GBA1 cuts the gap, the pCL-Puro-Donor linearized by sgRNA-Q is inserted into the genome of GBA1, and the resistance gene Puromycin is expressed. Since the tail end of Puromycin contains multiple termination codons TGA, TAA, etc., the normal GBA1 gene expression is blocked, thereby achieving the knockout of GBA1. The presence of exogenous linearized pCL-Puro-Donor makes the repair of broken genes not limited by the cell division cycle, so the efficiency of editing and knocking out is higher, and editing can be achieved on genes that are difficult to edit. At the same time, in the cells finally inserted with pCL-Puro-Donor, Puromycin resistance protein was expressed and GBA1 protein was knocked out. Using Puromycin as a screening drug, edited cells and unedited cells can be screened and distinguished more quickly, and knocked-out cell lines can be obtained in a shorter time. The two-plasmid system is a gene knockout method designed based on the principle of DNA homologous recombination repair. The homologous recombination repair method has higher fidelity. The sgRNA1 or sgRNA2 plasmid targeting GBA1 is used as a guide for targeted cutting. The recombinant Donor plasmid has 50-2000bp homologous arms at both ends of Puromycin and the stop codon. When the cell divides, the cut genomic DNA will be repaired into the GBA1 genome under the action of the homologous recombination enzyme, so that the Puromycin resistance gene is expressed and the GBA1 gene is terminated, resulting in the knockout of the GBA1 gene. It provides a precise gene knockout method.

[0039] In HeLa cells, this application uses a homologous recombination donor, which reduces the three plasmid transfections in the conventional method. This application uses two plasmids, donor plasmids, and sgRNA (sgRNA1 or sgRNA2) plasmids to construct a knockout cell model. Through sequencing and enzyme activity detection, the sgRNA2 plasmid successfully knocked out the GBA1 gene of HeLa, and the enzyme activity of GBA1 was reduced by about 80% compared with the negative control group.

[0040] In the present application, sgRNA1 refers to the sgRNA of the sequence shown in Seq ID No.1, and sgRNA2 refers to the sgRNA of the sequence shown in Seq ID No.2.

[0041] The present application is further described in detail below by specific examples. The following examples are only further described for the present application and should not be construed as limiting the present application. In the following embodiments, many detailed descriptions are intended to enable the present application to be better understood. However, those skilled in the art can effortlessly recognize that some of the features can be omitted in different situations, or can be replaced by other kits, materials, and methods. In some cases, some operations related to the present application are not shown or described in the specification, and this is to avoid the core part of the present application being overwhelmed by too much description, and for those skilled in the art, it is not necessary to describe these related operations in detail, and the related operations can be fully understood according to the description in the specification and the general technical knowledge in the art. In the following embodiments, the experimental method without specifying specific conditions is usually in accordance with conventional conditions, or in accordance with the conditions recommended by the manufacturer. In the following embodiments, the materials, reagents, or instruments used, if not otherwise specified, can all be purchased from commercial sources.

[0042] Example

[0043] 1. sgRNA design

[0044] Knockout of GBA1 using CRISPR / Cas9 in 293T cells (Wuhan Pronocell Biotechnology Co., Ltd.):

[0045] Enter GBA1 on the chopchop website and design the sgRNA sequence. In this example, two sgRNAs targeting GBA1 are specifically designed, namely sgRNA1 and sgRNA2. sgRNA1 is the sequence shown in Seq ID No.1, and sgRNA2 is the sequence shown in Seq ID No.2.

[0046] Seq ID No.1: 5'-CGACGGATGGAGCTGAGTAT-3';

[0047] Seq ID No. 2: 5'-TACACGCAGTGGGCGACGGA-3'.

[0048] According to sgRNA1 and sgRNA2, the corresponding annealing primers sgRNA-1-F / R and sgRNA-2-F / R were designed, and their sequences are shown in Table 1.

[0049] sgRNA1, sgRNA2 and annealing primers were synthesized by Shenzhen Qingke Biotechnology Co., Ltd.

[0050] Table 1 Primer sequences

[0051] Primer name Sequence (5'to3') Seq ID No. sgRNA-1-F CACCGCGACGGATGGAGCTGAGTAT 4 sgRNA-1-R AAACATACTCAGCTCCATCCGTCGC 5 sgRNA-2-F CACCGTACACGCAGTGGGCGACGGA 6 sgRNA-2-R AAACTCCGTCGCCCACTGCGTGTAC 7

[0052] For information on pCL-Cas9 vectors, see the pCL-Cas9 plasmid map ( Fig.11 ), which contains the cas9 sequence.

[0053] 2. Plasmid Construction and Detection

[0054] 2.1 Preparation of sgRNA1 and sgRNA2

[0055] 2.1.1 Reaction system

[0056] Table 2 Annealing reaction system

[0057] name sgRNA1 sgRNA2 F(10μM) 1μL 1μL R(10μM) 1μL 1μL NEBufferTM 3.1 5μL 5μL <![CDATA[ddH2O]]> 43μL 43μL Total volume 50μL 50μL

[0058] 2.1.2 Annealing conditions

[0059] Denature at 95°C for 5 min and cool directly to room temperature.

[0060] 2.2 pCL-Cas9 vector digestion and recovery

[0061] 2.2.1 pCL-Cas9 vector digestion

[0062] The pCL-Cas9 vector was digested with BbSI-HF, and the digestion system is shown in Table 3.

[0063] Table 3 Enzyme digestion system

[0064] Plasmid name pCL-Cas9 1 μL, 1 μg / μL BbSI-HF 1μL <![CDATA[rCutSmart TM Buffer]]> 2μL <![CDATA[H20]]> 16μL

[0065] Enzyme digestion conditions: 37℃2h

[0066] 2.2.2 Agarose gel electrophoresis

[0067] Prepare 1% agarose gel: weigh 0.5g agarose and place it in a conical flask, add 50mL 1×TAE, and turn the flask upside down with a small beaker. Heat and boil in a microwave oven for 3 times until the agarose is completely melted, shake well, and the 1.0% agarose gel solution is obtained. Cool to about 65℃ and add 5μL Gel-Red

[0068] Preparation of gel plate: Take the organic glass inner tank (gel tank), wash it, dry it, put the gel plate in it and then put the comb in place. Mix the agarose gel solution cooled to about 65℃, carefully pour it onto the inner tank glass plate, and slowly spread the gel solution until a uniform gel layer is formed on the entire surface of the glass plate. Let it stand at room temperature until the gel is completely solidified, pull the comb vertically and gently, take out the gel plate with the inner tank, and put the gel and the inner tank into the electrophoresis tank, and add 1×TAE electrophoresis buffer until the gel plate is submerged.

[0069] Run the gel, add loading buffer to the sample DNA, slowly and carefully add the DNA sample to the gel sample slot, leave one well for adding DNA standard, and record the sample spotting order and loading amount.

[0070] Install the electrode wires, black to black, red to red, and place one end of the sample hole close to the negative electrode. Turn on the power supply and adjust the voltage to 100V for 30 minutes. When the blue band moves to 1-2cm away from the front of the gel, stop electrophoresis.

[0071] After electrophoresis, photos were taken using Tanon 4100.

[0072] 2.2.3 DNA gel recovery

[0073] The agarose gel DNA recovery kit used in this experiment was purchased from Tiangen Biotechnology. Before the first use, add 80 mL of anhydrous ethanol to dilute Buffer GW as indicated on the label of the Buffer GW reagent bottle and store it at room temperature.

[0074] After DNA electrophoresis, quickly cut the gel containing the target DNA fragment under UV light. It is recommended to use a paper towel to absorb the liquid on the surface of the gel and cut it into pieces, and try to remove excess gel. Weigh the gel (excluding the weight of the empty tube). 100 mg of gel is equivalent to 100 μL volume, which is considered as a gel volume.

[0075] Add an equal volume of Buffer GDP. Incubate at 50-55℃ in a water bath for 7-10 minutes. Adjust the time appropriately according to the size of the gel to ensure that the gel is completely dissolved. Invert and mix twice during the water bath to accelerate the dissolution.

[0076] Centrifuge briefly to collect the droplets on the tube wall. Place the Fast Pure DNA Mini Columns-G adsorption column in the Collection Tubes 2ml collection tube, transfer the sol to the adsorption column, and centrifuge at 12,000rpm for 30-60sec.

[0077] Discard the filtrate and place the adsorption column in a collection tube. Add 300μL Buffer GDP to the adsorption column. Let stand for 1min. Centrifuge at 12,000rpm for 30-60sec.

[0078] Discard the filtrate and place the adsorption column in a collection tube. Add 700 μL of Buffer GW (with anhydrous ethanol) to the adsorption column. Centrifuge at 12,000 rpm for 30-60 seconds.

[0079] Discard the filtrate and place the adsorption column in a collection tube. Add 700 μL of Buffer GW (with anhydrous ethanol) to the adsorption column. Centrifuge at 12,000 rpm for 30-60 seconds.

[0080] Discard the filtrate and place the adsorption column back into the collection tube. Centrifuge at 12,000 rpm for 2 min.

[0081] Place the adsorption column in a 1.5 mL sterilized centrifuge tube, add 20 μL ddH2O to the center of the adsorption column, and place for 2 minutes. Centrifuge at 12,000 rpm for 1 minute. Discard the adsorption column and store the DNA at -20°C.

[0082] 2.3 Connection

[0083] The product of “2.1 Preparation of sgRNA1 and sgRNA2” was connected with the product of “2.2 Enzyme digestion and recovery of pCL-Cas9 vector”. The connection reaction system is shown in Table 4.

[0084] Table 4 Connection system

[0085] name Volume (μL) Vector (pCL-Cas9 gel extraction recovery) (25-30ng) 1 Fragment (after annealing of sgRNA1 / after annealing of sgRNA2) 1 10*T4 DNA buffer 1 T4 DNA enzyme 1 <![CDATA[H2O]]> 6 Total volume 10

[0086] 2.4 Conversion

[0087] (1) Take 50 μL of E. coli competent cells DH5a (Shanghai Biotechnology Co., Ltd.) and dissolve for 5 min;

[0088] (2) Add appropriate amount of plasmid (volume should not exceed 5 μL) and place on ice for 30 min;

[0089] (3) Heat shock at 42°C for 45-60 seconds, immediately return to ice and place on ice for 2 minutes; add 700 μL LB medium and culture in a shaker at 37°C for 45-60 minutes;

[0090] (4) Take 50-100 μL of the solution and spread it on LB solid medium containing ampicillin (100 μg / mL) and culture it upside down at 37°C overnight.

[0091] After overnight culture, pick a single colony, put it into a 15mL centrifuge tube, add 2mL of LB medium containing ampicillin, culture it at 37℃ overnight, and use 50% glycerol to preserve the bacteria. Half of it is sent for sequencing, put it into a 1.5mL centrifuge tube, add 500μL of LB medium containing ampicillin, shake it at 37℃ for 3h, and send it to Shenzhen Qingke Biological Company for sequencing. The sequencing results are compared with DNA MAN to confirm that the sequence is correct; the other half is kept for future use.

[0092] 2.5 Shaking bacteria

[0093] Take 15 μL of sgRNA1 and sgRNA2 strains, add them to 5 mL of LB medium containing ampicillin, shake at 37°C for 6 h, then add them to 150 mL of LB medium containing ampicillin, with an ampicillin concentration of 50 μg / mL, and shake at 37°C overnight.

[0094] 2.6 Plasmid extraction

[0095] In this case, a plasmid extraction kit purchased from Tiangen Biotechnology was used for plasmid extraction, which specifically includes:

[0096] (1) Take 150-200 mL of overnight culture solution and centrifuge at about 11,000 rpm (12,000 × g) for 1-2 min. Discard the supernatant and collect the cells.

[0097] (2) Add 7.5 mL of Buffer P1 (please check whether RNase A has been added to Buffer P1) to the centrifuge tube containing the bacterial pellet and mix by pipetting or vortexing.

[0098] (3) Add 7.5 mL of Buffer P2 to the bacterial suspension in step (2), mix gently by inverting the tube 6-8 times, and leave at room temperature for 4-5 min.

[0099] (4) Add 7.5 mL of Buffer P4 to the bacterial suspension in step (3), and immediately and gently invert the solution 6-8 times to completely neutralize Buffer P2. A white flocculent precipitate should appear at this time. Centrifuge at about 11,000 rpm (12,000 × g) for 10-15 min, and carefully pipette the supernatant into a new 50 mL round-bottom tube, avoiding the floating white precipitate.

[0100] (5) Add 0.1 times the volume (10% of the volume of the supernatant, about 2.2 mL) of endotoxin scavenger to the supernatant obtained in step 4, mix by inversion, and place in an ice bath or in crushed ice (or in the freezer) for 5 min, until the solution becomes clear and transparent (or still slightly turbid), mixing occasionally several times.

[0101] (6) Place at room temperature (above 25°C) for 10-15 minutes. After the temperature returns to room temperature, the solution quickly becomes turbid again and is mixed by inversion.

[0102] (7) Centrifuge at room temperature at about 11,000 rpm for 10 min to separate the phases. The temperature must be greater than 25°C. The upper aqueous phase contains DNA, and the lower blue oily phase contains endotoxin and other impurities. Transfer the upper aqueous phase containing DNA to a new tube and discard the oily phase.

[0103] (8) Add 0.5 times the volume of isopropanol (about 10 mL) to the upper aqueous phase, mix thoroughly by inversion, and transfer to the adsorption column several times. Place the adsorption column in a collection tube and centrifuge at about 11,000 rpm for 1 min. Pour away the waste liquid in the collection tube until all the mixed solution passes through the adsorption column.

[0104] (9) Add 10 mL of rinse solution PW, centrifuge at about 11,000 rpm for 1 min, and discard the waste liquid. Return the adsorption column to the collection tube, add another 10 mL of rinse solution PW, and repeat the rinse once.

[0105] (10) Use a pipette to remove any ethanol that may remain between the inner ring and the column wall. Place the adsorption column back into the empty collection tube and centrifuge at maximum speed (12,000 × g) for 3 min to dry any ethanol remaining on the matrix membrane. Open the lid and let dry at room temperature for 3–5 min.

[0106] (11) Remove the adsorption column and place it in a clean centrifuge tube. Add 1-2 mL of Buffer TB to the middle of the adsorption membrane. Incubate at room temperature for 3 min. Centrifuge at approximately 11,000 rpm for 3 min to elute the plasmid.

[0107] (12) The extracted sgRNA1 and sgRNA2 plasmids were named pCL-Cas9-sgRNA 1 and pCL-Cas9-sgRNA 2, respectively, and the plasmid concentration and quality were tested.

[0108] 2.7 Cell transfection

[0109] Material preparation: DMEM complete culture medium, that is, DMEM culture medium containing 10% fetal bovine serum (Australian fetal bovine serum purchased from Gibco) and 1% double antibody (penicillin-streptomycin double antibody, purchased from Yisheng Biotechnology).

[0110] Cell culture: 293T cells in 100 mm culture dishes were digested, centrifuged and resuspended in 10 mL of DMEM complete medium, counted, and passaged into 6-well culture dishes, with 2 × 10 cells per plate. 5 One group was transfected and the other group was used as a control group without transfection. 3 mL of DMEM complete medium was added and cultured overnight in a CO2 incubator at 37°C until the density reached 60% to 70%.

[0111] In this case, EZ Trans (Shanghai Liji Biotechnology) transfection reagent was used for cell transfection, and Opti-MEM Medium was used.

[0112] The specific experimental steps include:

[0113] (1) Prepare transfection solution

[0114] Solution A: Dilute 9 μL EZ Trans with 100 μL Opti-MEM.

[0115] Solution B: Dilute 1 μg pCL-Cas9-sgRNA 1, 1 μg pCL-Cas9-sgRNA-Q, and 2 μg pCL-GBA1-KO-Donor plasmid with 100 μL Opti-MEM.

[0116] Solution C: Dilute 1 μg of pCL-Cas9-sgRNA 2, 1 μg of pCL-Cas9-sgRNA-Q, and 2 μg of pCL-GBA1-KO-Donor plasmid with 100 μL Opti-MEM.

[0117] Among them, sgRNA-Q is the sequence shown in Seq ID No.3;

[0118] Seq ID No. 3: 5'-GGGCCAGTACCCAAAAAGGG-3'.

[0119] (2) Add all of Solution B to Solution A and mix gently to make transfection mixture 1. Let stand at room temperature for 15 min.

[0120] Add all of Solution C to Solution A, mix gently to make transfection mixture 2, and let stand at room temperature for 15 minutes.

[0121] (3) The culture medium in the plate was replaced with 800 μL of DMEM medium without serum and double antibody.

[0122] (4) Gently mix the transfection mixtures 1 and 2 prepared in step (2) and add 200 μL of each mixture to different wells of a 6-well plate.

[0123] (5) Place the cells in a 37°C CO2 incubator and culture for 48 hours after 6 hours.

[0124] (6) Add 3 μg / mL of puromycin and sterilize for 3-5 days.

[0125] (7) Observe the cell status. When all cells in the blank well control group without plasmid are dead, start to culture with DMEM medium containing 10% serum. When the cells fill the 6-well plate, subculture. Separate half of the cells for counting, centrifuge at 1000 rpm for 5 min, mix with 1 mL of PBS for detection of knockout efficiency; continue to culture the other half.

[0126] 2.8 Genomic DNA extraction

[0127] DNA was extracted using the Bio-Tech Genomic DNA Mini-Extraction Kit (universal, centrifugal column type) according to the instructions.

[0128] (1) Collect 2×10 5Add 100 μL of PBS to resuspend cells.

[0129] (2) Add 20 μL of proteinase K and vortex to mix.

[0130] (3) Add 200 μL of sample lysis buffer B, vortex to mix, and incubate at 70°C for 10 min.

[0131] (4) Add 200 μL of anhydrous ethanol and vortex to mix.

[0132] (5) Add the mixture from step (4) to the DNA purification column. Centrifuge at 6000 g for 1 minute and discard the liquid in the waste collection tube.

[0133] (6) Add 500 μL of washing solution I, centrifuge at 12,000 r / min for 1 minute, and discard the liquid in the waste liquid collection tube.

[0134] (7) Add 600 μL of washing solution II, centrifuge at 12,000 r / min for 1 min, and discard the liquid in the waste liquid collection tube.

[0135] (8) Centrifuge at 12000r / min to remove residual ethanol.

[0136] (9) Place the DNA purification column in a clean 1.5 ml centrifuge tube, add 50-200 μL of elution buffer, leave at room temperature for 1-3 minutes, and centrifuge at 12000 r for 1 minute. The resulting liquid is the purified total DNA.

[0137] 2.9 PCR detection

[0138] The reaction system for PCR detection is shown in Table 5.

[0139] Table 5 PCR reaction system

[0140] name sgRNA1 volume (μL) sgRNA2 volume (μL) Q5 2×Master Mix 25 25 Primer F (10 μM) 2.5 2.5 Primer R (10 μM) 2.5 2.5 The genomic DNA extracted in step 2.7 was used as a template 1 1 <![CDATA[H2O]]> 19 19 Total volume 50 50

[0141] Among them, primer F and primer R are shown in Table 6.

[0142] Table 6 PCR amplification primers

[0143] Primer Name Base sequence (5' to 3') Seq ID No. TF TCTCTCTCTCTCCGGCTCGC 8 TR GACTGGGGTGGCTTACCGTG 9

[0144] PCR procedure:

[0145] Denature at 98°C for 3 min, then enter 30 cycles: 95°C for 10 s, 55°C for 30 s, 72°C for 5 min. After the cycle, extend at 72°C for 5 min, and finally wait at 4°C.

[0146] After the PCR reaction is completed, take 5 μL of the reaction product for DNA agarose gel electrophoresis detection, the same as "2.2.2 Agarose gel electrophoresis", the results are shown in Figure 1. Figure 1 The results showed that the molecular weight of the successful knockout was 9175bp. The electrophoresis diagram confirmed that the target gene was successfully knocked out.

[0147] The remaining 45 μL of PCR amplification product was sent to Shenzhen Qingke Biotechnology Co., Ltd. for sequencing. The sequencing primers are shown in Table 7.

[0148] Table 7 Sequencing primers

[0149] Primer Name Base sequence (5' to 3') Seq ID No. sgRNA-1-SF TGTGTCCATTCTCCATGTCTTC 10 sgRNA-1-SR AGGGGTGTAATGGTTACCTGTG 11 sgRNA-2-SF TGTGTCCATTCTCCATGTCTTC 12 sgRNA-2-SR AGGGGTGTAATGGTTACCTGTG 13

[0150] The sequencing results were compared using snapGene software. Figure 2 . Figure 2 The sequencing results showed that sgRNA2-#1 had a frameshift mutation.

[0151] Single cell sorting:

[0152] For the cells of "2.7 Cell Transfection", digest and count them, sort them into 96-well plates, with an average of 1 cell per well, and sort three 96-well plates in total. Continue to culture for 2 weeks, and when single cells fill the 96-well plate, digest the 293T cells and subculture them into 6-well plates. When the cells fill the 6-well plate, digest them with 500μL of trypsin, add 2mL of DMEM complete medium, 1000rpm, 5min, and discard the supernatant. Resuspend with 1mL of PBS, divide the cells into two parts, one for Western blot detection, and the other for continued culture.

[0153] 2.10 Western blot detection

[0154] Preparation of working solution: According to the number of samples, prepare an appropriate amount of BCA working solution by mixing working solution A and working solution B in the BCA protein concentration assay kit at a ratio of 50:1.

[0155] Preparation of protein standards and experimental samples: Add 0, 1, 2, 4, 8, 12, 16, and 20 μL of the diluted standard solution (0.5 mg / mL) to the standard wells of a 96-well plate and make up to 20 μL with PBS, which is equivalent to standard concentrations of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively; add 2 μL of protein sample to the sample wells of a 96-well plate and make up to 20 μL with PBS.

[0156] Add 200 μL of BCA working solution to each well and place at 37°C for 30 minutes. Note: Alternatively, place at room temperature for 2 hours or at 60°C for 30 minutes. Use an ELISA reader to measure the absorbance of A562 or the absorbance at wavelengths between 540-595 nm. Draw a standard curve and calculate the protein concentration of the sample based on the sample volume used.

[0157] Take 20 μL of sample, add 5 μL, 5× loading buffer, and place in 95-100℃ metal bath for 10 min. Then, load the sample for electrophoresis, load 10 μL of protein, and use GenScript ExpressPlus precast gel TM Protein precast gel. Electrophoresis conditions: 4-20% SDS-PAGE (BYT), 60V 140min.

[0158] After the electrophoresis is completed, transfer is performed. Specifically, a PVDF membrane is used, which is soaked in anhydrous methanol before use; a sponge gasket, glue, membrane, and sponge gasket are placed on the transfer device from the negative electrode to the positive electrode. The transfer instrument uses the eBlot L1 fast wet transfer instrument. Then, blocking is performed. Specifically, a 5% BSA solution is used for blocking at room temperature for 2 hours; after blocking, TBST is used to wash three times, each time for 5 minutes. Then, primary antibody incubation is performed. In this example, GBA1 is incubated with a 1:10000 HRP-labeled antibody for 1 hour and washed three times with TBST, each time for 5 minutes. Then, incubation with a colorimetric solution is performed. In this example, BIO-RAD Clarity Western ECL Substrate is used, A solution: B solution = 1:1, and it is prepared and used immediately. Finally, the gel imaging system is used for detection, and the results are as follows Figure 6 As shown, 293T was used as blank control and GBA1 antibody was used.

[0159] Figure 6 The results showed that sgRNA1-#1 was obtained by conventional knockout method, which partially knocked out the gene but not completely. Further single-cell sorting method was used to obtain No. 25 and No. 26. GBA1 could not be detected by Western Blot method, indicating that the knockout was relatively thorough. This method is feasible, but the cycle is relatively long, requiring 1 month.

[0160] 2.11 ZEISS LSM 980 laser confocal microscope photography

[0161] Cell plating (1.5-2.0) × 10 524-well glass-bottom plates were used for immunofluorescence. The pCL-GFP-RAB5B plasmid was co-transfected with GBA1, T07 plasmid, and T07-m (T07 mRNA) respectively. For the sample group, empty cells were used as the negative control group. After transfection for 16-18 hours, the culture medium was discarded, and the cells were washed once with 300 μL of PBS, and the PBS was discarded. 300 μL of 4% paraformaldehyde was added to fix the cells, and incubated at room temperature for 15 minutes. The paraformaldehyde was discarded, and the cells were washed once with 300 μL PBS, and the PBS was discarded. 300 μL / well of 0.04% TritonX-100 permeabilization solution (diluted with PBS) was added, and incubated at room temperature for 5 minutes. After the incubation was completed, the blocking solution was treated, that is, 300 μL / well of 4% BSA (diluted with PBS) was added, and incubated at room temperature for 30 minutes. Discard 4% BSA and add 200 μL of antibody / well that binds to FLAG tag: DYKDDDDK tag Monoclonal antibody (Binds to tag epitope), dilute the antibody bound to the FLAG tag with blocking solution at a ratio of 1:600, and incubate at room temperature for 1 hour. Take out the antibody and recover it. Wash once with 300μL PBS, discard PBS, and add secondary antibody: Goat anti-Mouse IgG (H+L) Cross-Adsorbed SecondaryAntibody, Alexa Fluor 568Invitrogen. Dilute with PBS at a ratio of 1:1000. Incubate at room temperature for 1 hour. Wash once with 300μL PBS, discard PBS, and add 300μL DAPI dye for 5 minutes. Aspirate DAPI, wash once with 300μL PBS, discard PBS, and add 300μL PBS to protect from light. Take pictures with a ZEISS LSM 980 laser confocal microscope, and process the experimental results with ImageJ, then combine the pictures. The results are shown in Figure 8 , Fig. 9 and Fig.10 .

[0162] The GBA1 gene was knocked out in 293T and HeLa cells by homologous recombination (protection pCL-GBA1-KO-Donor). Figure 8 It can be seen that in 293T cells, single cell sorting No. 26, there is almost no GBA1 antibody staining, indicating that the knockout is relatively successful. Fig. 9 The results showed that KO-26 knockout of the GBA1 gene caused lysosomes to accumulate around the cell nucleus.

[0163] Fig.10In the figure, the first vertical row shows GBA1 gene expression, the second vertical row RAB5B shows lysosomes and the in vivo system, and KO-#26 shows that the lysosomes become the same as the 293T negative control. The 293T cells into which the therapeutic plasmid and the therapeutic mRNA were transferred are relatively scattered, indicating that both the plasmid of the therapeutic gene and its mRNA transfection methods have a certain therapeutic effect on lysosomal storage.

[0164] The pCL-GBA1-KO-Donor plasmid structure can be found in Fig.12 (pCL-GBA1-KO-Donor plasmid map), which contains the GBA1 homologous recombination binding sequence, puro and sgRNA-Q recognition site sequence. The pCL-Cas9-sgRNA-Q plasmid structure can be found in Fig.13 The pCL-GFP-RAB5B plasmid structure can be found in Fig.14 , including EGFP sequences and RAB5B.

[0165] 3. Enzyme activity verification of gene knockout

[0166] 3.1 Plasmid extraction

[0167] Plasmid extraction is the same as “2.6 Plasmid extraction”.

[0168] 3.2 Transfection

[0169] Cell culture: 293T cells in 100 mm culture dishes were digested, centrifuged and resuspended in 10 mL of DMEM complete medium, counted, and passaged into 6-well culture dishes, with 2 × 10 cells per plate. 5 Each well was divided into two groups, one group was transfected and the other group was not transfected as a control group, and 3 mL of DMEM complete medium was added. The cells were cultured overnight in a CO2 incubator at 37°C until the density reached 60% to 70%.

[0170] In this case, EZ Trans (Shanghai Liji Biotechnology) transfection reagent was used for cell transfection, and Opti-MEM Medium was used.

[0171] The specific experimental steps include:

[0172] (1) Prepare transfection solution

[0173] Solution A: Dilute 9 μL EZ Trans with 100 μL Opti-MEM.

[0174] Solution B: Dilute 1 μg pCL-Cas9-sgRNA 1 and 1 μg pCL-GBA1-KO-Donor plasmid with 100 μL Opti-MEM.

[0175] Solution C: Dilute 1 μg pCL-Cas9-sgRNA 2 and 1 μg pCL-GBA1-KO-Donor plasmid with 100 μL Opti-MEM.

[0176] (2) Add all of Solution B to Solution A and mix gently to make transfection mixture 1. Let stand at room temperature for 15 min.

[0177] Add all of Solution C to Solution A, mix gently to make transfection mixture 2, and let stand at room temperature for 15 minutes.

[0178] (3) The culture medium in the plate was replaced with 800 μL of DMEM medium without serum and double antibody.

[0179] (4) Gently mix the transfection mixtures 1 and 2 evenly and add 200 μL of each solution to different wells of a 6-well plate.

[0180] (5) Place the cells in a 37°C CO2 incubator and culture for 48 hours after 6 hours.

[0181] (6) Add 3 μg / mL of puromycin and sterilize for 3-5 days.

[0182] (7) Observe the cell status. When all cells in the blank well control group without plasmid are dead, start to culture with DMEM medium containing 10% serum. When the cells fill the 6-well plate, subculture. Separate half of the cells for counting, centrifuge at 1000 rpm for 5 min, mix with 1 ml of PBS for detection of knockout efficiency; continue to culture the other half.

[0183] 3.3 Genomic DNA extraction

[0184] The extraction of genomic DNA is the same as “2.8 Genomic DNA extraction”.

[0185] 3.4 PCR detection

[0186] PCR test is the same as "2.9 PCR test", and the test results are as follows Figure 3 and Figure 4 shown.

[0187] Figure 3 and Figure 4 In the first lane, DNA marker 15000bp was used. Figure 3 The 2nd to 11th lanes are numbered #1, #2, #3, #6, #7, #18, #10, #11, #15, and #14, respectively. Figure 4 The 2nd to 10th lanes are numbered #17, #4, #5, #8, #9, #12, #13, #19, and #16 respectively. Figure 3#1 is 293T empty sgRNA, #2 is 293T sgRNA1, #3 is 293T sgRNA1, #6 is 293T sgRNA2, #7 is 293T sgRNA2, #18 is 293T empty, #10 is 293TsgRNA1, #11 is 293T sgRNA2, #15 is HeLa empty, and #14 is HeLa sgRNA1; Figure 4 #17 is HeLa sgRNA2, #4 is HeLa sgRNA2, #5 is HeLasgRNA2, #8 is HeLa empty sgRNA, #9 is HeLa sgRNA1, #12 is HeLa sgRNA2, #13 is 293T sgRNA1, #19 is HeLa empty sgRNA, and #16 is HeLa empty sgRNA.

[0188] 3.5 Sequencing results comparison

[0189] Sequence alignment was performed using snapgene software, and the results are shown in Figure 5 .

[0190] A set of sequence comparison results showed that one HeLa sample successfully inserted the target gene sequence, destroying the original GBA1 sequence, while other samples inserted 1-2 bases, destroying the original GBA1 sequence.

[0191] 3.6 Enzyme activity detection

[0192] (1) Gcase enzyme activity buffer (Assay buffer): 0.1M sodium phosphate dibasicdihydrate, 0.05M Citric Acid, pH 5.0.

[0193] (2) Gcase enzyme active substrate 4MUG (4-meThyl-umbelliferyl-β-D-Glucopyr Anoside): 10 mM.

[0194] (3) Gcase enzyme activity reaction stop buffer: 0.3 M Glycine, 0.2 M sodium Carbone, pH 10.7.

[0195] Negative group: PBS group plus 5μL RIPA lysis buffer, sample group: PBS and 5μL sample, set up three replicate wells. After 45 minutes at room temperature, add 50μLassay buffer and 70μL 4MUG to each well; then, after 2 hours at 37℃, add 100μL stop buffer. Use a fluorescence microplate reader to measure fluorescence at 350 / 450nm.

[0196] The enzyme activity was calculated as follows:

[0197] Enzyme activity = (average fluorescence of samples - average fluorescence of negative controls) / protein concentration μg / mL

[0198] The results are as follows Figure 7 shown. Figure 7 The results showed that HeLa sgRNA2 reduced GBA1 activity by about 80%, and HeLa sgRNA1 reduced GBA1 activity by about 55%.

[0199] The above contents are further detailed descriptions of the present application in combination with specific implementation methods, and it cannot be determined that the specific implementation of the present application is limited to these descriptions. For ordinary technicians in the technical field to which the present application belongs, several simple deductions or substitutions can be made without departing from the concept of the present application.

Claims

1. A method for gene knockout based on CRISPR-Cas9, characterized in that: It includes adding sgRNA targeting the target gene, sgRNA-Q targeting the Donor plasmid, and the Donor plasmid containing the selection marker gene into the gene knockout system; Use sgRNA to cut the target gene, and use sgRNA-Q to linearize the Donor plasmid containing the screening marker gene. At this time, the linearized Donor plasmid is inserted into the target gene excision gap and expresses the screening marker gene. Due to the insertion of the linearized Donor plasmid, the normal expression of the target gene is blocked, thereby achieving the knockout of the target gene, and the selection marker gene is used to realize the screening of gene knockout cells.

2. The method according to claim 1, characterized in that: The target gene is the GBA1 gene.

3. The method according to claim 2, characterized in that: The sgRNA is the sequence shown in Seq ID No.1 or the sequence shown in Seq ID No.2; Seq ID No.1: 5'-CGACGGATGGAGCTGAGTAT-3'; Seq ID No. 2: 5'-TACACGCAGTGGGCGACGGA-3'.

4. The method according to any one of claims 1 to 3, characterized in that: The sgRNA-Q is the sequence shown in Seq ID No.3; Seq ID No. 3: 5'-GTTCGAGCTTGCATGCCTGC-3'.

5. The method according to any one of claims 1 to 3, characterized in that: The screening markers are Puromycin, Hygromycin B, Geneticin (G418), Blasticidin, MTS (Methotrexate), MSX At least one of (L-methionine-DL-sulfoximine).

6. A kit for gene knockout based on CRISPR-Cas9, characterized in that: It includes sgRNA targeting the target gene, sgRNA-Q targeting the Donor plasmid, and the Donor plasmid containing the selection marker gene.

7. The kit according to claim 6, characterized in that: The target gene is the GBA1 gene.

8. The kit according to claim 7, characterized in that: The sgRNA is the sequence shown in Seq ID No.1 or the sequence shown in Seq ID No.2; Seq ID No.1: 5'-CGACGGATGGAGCTGAGTAT-3'; Seq ID No. 2: 5'-TACACGCAGTGGGCGACGGA-3'.

9. The kit according to any one of claims 6 to 8, characterized in that: The sgRNA-Q is the sequence shown in Seq ID No.3; Seq ID No. 3: 5'-GTTCGAGCTTGCATGCCTGC-3'.

10. The kit according to any one of claims 6 to 8, characterized in that: The screening markers are Puromycin, Hygromycin B, Geneticin (G418), Blasticidin, MTS (Methotrexate), MSX At least one of (L-methionine-DL-sulfoximine).

Images