Method for inserting exogenous genes into chicken primordial germ cells at fixed points

Abstract

The invention discloses a method for inserting exogenous genes into chicken primordial germ cells at fixed points. Belongs to the technical field of biology. The method comprises the following steps: culturing and counting chicken primordial germ cells; constructing a gene editing plasmid and a donor plasmid which are inserted into the exogenous gene at a fixed point; mixing the counted chicken primordial germ cells with an electroporation transfection buffer solution, gene editing plasmids and donor plasmids to obtain an electrotransfection system; transferring the electrotransfection system into an electrode cup for transfection; and 7 days after transfection, sorting positive cells by flow cytometry. Compared with the prior art, the method disclosed by the invention has the beneficial effects that the efficiency of inserting exogenous genes into the chicken primordial germ cells at fixed points is greatly improved, the primordial germ cells subjected to fixed-point integration of the exogenous genes are low in apoptosis rate and good in cell viability, and the pluripotency is not influenced; a large number of chicken primordial germ cells with fixed-point insertion of exogenous genes can be quickly obtained to meet the requirements of subsequent in-vitro cell experiments and preparation of gene editing chickens.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and more particularly to a method for inserting foreign genes into chicken primordial germ cells at specific locations. Background Art

[0002] Primordial germ cells (PGCs) are the precursors of eggs and sperm and are the first group of germ cells in the development process. Chicken is one of the few species that can isolate PGCs from developing embryos and proliferate in vitro. Chicken PGCs are the most ideal technology for combining the CRISPR system to conduct genome editing bird model research. Chicken PGCs can be genetically modified in vitro and then microinjected into chicken embryos to prepare genetically modified chickens. The production of gene knock-in or knock-out chicken models by targeted modification of the genome of PGCs based on CRISPR technology will help us further explore the gene functions of birds. At present, genetically modified chickens obtained based on chicken PGCs technology are mainly used for in vitro seed preservation, precision breeding and sex control, which is of great significance to the poultry industry.

[0003] However, the DNA transfection efficiency in PGCs is low, which limits the creation of genetically modified chickens. The current mainstream stable transfection methods are biochemical transfection and physical methods. The biochemical transfection method is the most commonly used transfection method in the laboratory. The principle is that the transfection reagent forms a complex with the nucleic acid and is presented into the cell through membrane fusion or endocytosis. Due to the differences in the cell membranes of different cells, the effects of biochemical transfection vary greatly, especially the membrane structure and function of primary cells are more complex, and the transfection effect is often not ideal. For some suspended cells, the cluster growth and non-fixedness of suspended cells reduce the probability of stable contact between the complex and the cell membrane, and the transfection effect is also unsatisfactory. The physical method is to deliver the vector into the cell by injection or electric pulse. Microinjection prepares transgenic animals by injecting exogenous gene fragments into fertilized eggs, but this method is not suitable for birds. The electrotransfection method is applicable to various cell types, including mammalian cell lines, plant cell lines, etc., as well as primary cells and stem cells that are difficult to transfect.

[0004] Chicken PGCs are a type of suspension cells. Since biochemical transfection reagents need to be transfected in a larger culture system, such as adding 125 μL of transfection mixture (about 10 μL of transfection reagent) to a 5 mL culture system, the randomness of the contact between the transfection reagent and the suspension cells is very large. Different models and brands of biochemical transfection reagents have very different transient transfection efficiencies and the efficiency of site-specific insertion of exogenous genes. The efficiency of transient transfection varies from 1 to 64%, and the efficiency of site-specific insertion of exogenous genes is even lower, generally less than 6%. Therefore, the use of existing methods to prepare gene-modified PGCs to produce gene-edited chickens requires a large amount of initial PGCs, which requires a lot of economic and energy. If the number of initial PGCs is insufficient, the number of cells obtained by flow cytometry sorting is small, and it takes more than 15 days or even longer to culture to meet the amount of cells required for chicken embryo injection, which is inefficient.

[0005] In summary, how to improve the transfection efficiency of site-specific insertion of exogenous genes in chicken PGCs is an urgent problem to be solved by technical personnel in this field. Summary of the invention

[0006] In view of this, the present invention provides a method for site-specific insertion of exogenous genes into chicken primordial germ cells.

[0007] When using biochemical transfection reagents, 1×10 6 Each PGCs needs to be transfected in 5 mL of culture medium. The characteristics of suspended cells make them less likely to come into contact with plasmids. Using the electroporation transfection method, 1×10 6 Each PGCs only needs to be transfected in 100 μL buffer, which greatly increases the contact rate between cells and plasmids. In addition, upstream homology arms and downstream homology arms are added to the donor plasmid to improve the efficiency of site-specific insertion.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] A method for inserting exogenous genes into chicken primordial germ cells at specific locations, comprising the following steps:

[0010] (1) Cultivation and counting of chicken primordial germ cells;

[0011] (2) Construction of gene editing plasmids and donor plasmids for site-specific insertion of exogenous genes;

[0012] The gene editing plasmid is an editing plasmid into which gRNA is inserted;

[0013] The donor plasmid is obtained by adding an upstream homology arm and a downstream homology arm to the plasmid pB-PGK-EGFP;

[0014] (3) mixing the counted chicken primordial germ cells with electroporation transfection buffer, gene editing plasmid, and donor plasmid to obtain an electroporation transfection system;

[0015] (4) transferring the electrotransfection system to an electrode cup for transfection;

[0016] (5) 7 days after transfection, positive cells were sorted by flow cytometry.

[0017] Furthermore, the editing plasmid is PX459.

[0018] Furthermore, the nucleotide sequence of the gRNA is shown in SEQ ID NO.1;

[0019] TGCGGCCCTGAAGTTAAACA, SEQ ID NO.1.

[0020] Further, the primers that make gRNA form a double strand of gRNA template are as follows:

[0021] gRNA-F: caccgTGCGGCCCTGAAGTTAAACA, SEQ ID NO.2;

[0022] gRNA-R: aaacTGTTTAACTTCAGGGCCGCA, SEQ ID NO. 3.

[0023] Furthermore, the plasmid pB-PGK-EGFP uses pEGFP-N1 as the original skeleton and replaces the PGK promoter.

[0024] Furthermore, about 800 bp upstream and downstream of the gRNA in the chicken genome were used as homology arms.

[0025] Further, the primers for amplifying the homology arms are as follows:

[0026] L-ARM-F: gtacaattcacgcgtgataggagggccatcataca, SEQ ID NO.4;

[0027] L-ARM-R: cattcttgttcctgccctgttctagataattctac, SEQ ID NO.5;

[0028] R-ARM-F: caggcatgctggggattaacttcagggccgcaact, SEQ ID NO.6;

[0029] R-ARM-R: cacagaatcgcagaaccatggcggccgcaggaacc, SEQ ID NO.7.

[0030] Furthermore, the electroporation transfection buffer is EntransterTM -E.

[0031] Furthermore, the usage ratio of the chicken primordial germ cells, electroporation transfection buffer, and plasmid is: 1×10 6 pcs: 100μL: 4μg;

[0032] The plasmid includes a gene editing plasmid and a donor plasmid, and the mass ratio between the two is 1:1.

[0033] Furthermore, the transfection was performed by electrofection using a Lonza AAD-1001S cell nuclear transfection instrument with a parameter of B16.

[0034] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0035] The method of the present invention greatly improves the efficiency of site-specific insertion of exogenous genes into chicken primordial germ cells. At the same time, the primordial germ cells into which the exogenous genes are site-specifically integrated have a low apoptosis rate, good cell activity, and unaffected pluripotency. A large number of chicken primordial germ cells into which the exogenous genes are site-specifically inserted can be quickly obtained to meet the needs of subsequent in vitro cell experiments and the preparation of gene-edited chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0037] Figure 1 The results of the electrotransfection method described in Example 3 of the present invention after 48 hours, wherein A is the flow cytometry analysis result and B is the corresponding fluorescence microscopy observation result (n=3);

[0038] Figure 2 The best detection result after 7 days of electrotransfection according to the method described in Example 4 of the present invention, wherein A is the flow sorting result, and B is the fluorescence microscopic observation result of the corresponding cells after sorting (n=3);

[0039] Figure 3 The results of the electrotransfection 7 days after the method described in Comparative Example 1 of the present invention are shown in Figure 1, wherein A is the flow cytometry result and B is the corresponding fluorescence microscopy result (n=3);

[0040] Figure 4 The results of the electrotransfection 48 hours after the method described in Comparative Example 2 of the present invention are shown in Figure 2, wherein A is the flow cytometry result and B is the corresponding fluorescence microscopy result (n=3);

[0041] Figure 5 The results of the electrotransfection 48 hours after the method described in Comparative Example 3 of the present invention are shown in Figure 3, wherein A is the flow cytometry result and B is the corresponding fluorescence microscopy result (n=3);

[0042] Figure 6 These are the test results 48 hours after electroporation using the method described in Experiment 1 of the present invention, wherein A is the flow cytometry result of apoptosis detection, B is the corresponding statistical result, and C to G are the quantitative results of DAZL, DDX4, NANOG, POU5 and PTEN, respectively (n=3, P<0.05). DETAILED DESCRIPTION

[0043] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] The materials used in the following examples are as follows:

[0045] Sample source

[0046] Chicken embryos were white Leghorn chickens from the original breeder farm of the Animal Science Institute of Guangdong Academy of Agricultural Sciences. They were incubated in a RcomPRO 50 incubator (Rutoex) at 38.5°C and 60% relative humidity until 6.5 days old.

[0047] Main reagents

[0048] PBS, 0.25% trypsin, DMEM, 10% albumin, NEAA, β-mercaptoethanol, heparin sodium, transferrin, B27, nucleosides, Activin, FGF2, EDTA, KnockOut serum replacement, Entranster TM -E, Lipofectamine TM 3000.

[0049] Instruments and equipment

[0050] Cell culture incubator, Lonza AAD-1001S cell nuclear transfection instrument, Bio-Rad cell nuclear transfection instrument, electrophoresis instrument, fluorescence microscope, flow cytometry instrument.

[0051] Example 1

[0052] Gene editing plasmid construction

[0053] (1) Based on the non-coding sequences before the SUM1 and DNAJA1 loci, gRNA was designed using the online website https: / / cctop.cos.uni-heidelberg.de:8043 / index.html. The gRNA sequence is as follows: TGCGGCCCTGAAGTTAAACA, SEQ ID NO.1.

[0054] The non-coding sequences are as follows:

[0055]

[0056] (2) Design primers based on gRNA as follows:

[0057] gRNA-F: caccgTGCGGCCCTGAAGTTAAACA, SEQ ID NO.2;

[0058] gRNA-R: aaacTGTTTAACTTCAGGGCCGCA, SEQ ID NO. 3.

[0059] Primers were mixed in equal volumes of 3.5 μL at a working concentration of 10 μM and annealed to form a double-stranded gRNA template.

[0060] (3) One-step ligation was performed into the editing plasmid PX459. The ligation system was as follows: PX459 vector 100 ng, gRNA template double-stranded 7 μL, 10×FastDigestBuffe 1 μL, BbiI restriction endonuclease 0.5 μL, 10×T4 DNA Ligasebuffe 1 μL, T4 ligase 0.5 μL. One-step ligation was performed according to the following procedure: 37°C for 5 min; 22°C for 5 min; cycled 5 times. The resulting plasmid was named PX459-gRNA.

[0061] (4) Add 5 μL of the ligation product to 50 μL of the competent cell suspension, mix well, and place in an ice bath for 30 min. Place in a 42°C water bath for 90 s, then quickly transfer to an ice bath to cool the cells for 2 to 3 min. Add 450 μL of sterile LB medium, shake and culture at 37°C at 180 rpm / min for 1 h. Pipette 100 μL of the transformed competent cells and add to LB solid agar medium containing the antibiotic Amp and culture at 37°C for 12 h.

[0062] (5) Single clone colonies were selected and sent to a sequencing company for sequencing to verify the accuracy of gRNA insertion. The positive colonies identified by sequencing were used to extract plasmids in large quantities using the Omega plasmid extraction kit (D6915) according to the instructions.

[0063] Example 2

[0064] Donor plasmid construction without homology arms

[0065] Using pEGFP-N1 as the original backbone and replacing it with the PGK promoter, the construction steps are as follows:

[0066] (1) Design PGK promoter amplification primers, which contain 15 bp pEGFP-N1 vector homology sequence and gene homology arm amplification sequence, and the sequence is as follows:

[0067] PGK-F:TCCCTCGAGCCTACCGGGTAGGGGAGGCGCTTTTC, SEQ ID NO.9;

[0068] PGK-R: ATATTGGCTGCAGGTCGAAAGGCCCGGAGATGAGG, SEQ ID NO. 10.

[0069] (2) Use the pGL3-U6-sgRNA-PGK-puromycin plasmid as a template to amplify the PGK promoter by qPCR, and recover the PCR product by DNA gel electrophoresis at 120V for 30min. Cut the correct band with a blade, and the correct size of the PGK promoter is about 500bp. The chopped gel blocks are transferred to EP tubes and recovered using the Tiangen Agarose Gel DNA Recovery Kit (DP219). Weigh the gel blocks, add an equal volume of sol solution, dissolve at 55℃ for 10min, cool and add to the adsorption column, wash, elute with 40μL ddH2O, and measure the concentration.

[0070] (3) Use BamHI and SnaBI to linearize pEGFP-N1. The enzyme digestion system is as follows: 5 μg of pEGFP-N1 vector, 5 μL of 10×NEBuffer, 1 μL of BamHI restriction endonuclease, 1 μL of SnaBI restriction endonuclease, and 50 μL of ddH2O. Incubate at 37°C for 1 hour; cut the correct band with a blade: the vector backbone size is about 4200 bp. The chopped gel blocks are transferred to EP tubes and recovered using the Tiangen Agarose Gel DNA Recovery Kit (DP219). Weigh the gel blocks, add an equal volume of sol solution, dissolve at 55°C for 10 minutes, cool and add to the adsorption column, wash, elute with 40 μL ddH2O to obtain the vector backbone DNA, and measure the concentration.

[0071] (4) Use Hieff Plus Multi One Step Cloning Kit clones the donor plasmid by one-step ligation. The ligation system is 2×Hieff MultiS Enzyme Premix 10 μL, vector backbone 0.03 pmol, PGK promoter 0.03 pmol, ddH2O supplemented to 20 μL. Incubate at 50°C for 50 min. The resulting plasmid was named pB-PGK-EGFP.

[0072] (5) Transformation and identification are the same as steps (4) and (5) of Example 1.

[0073] Construction of donor plasmid carrying homology arms

[0074] (1) Based on the gRNA about 800 bp upstream and downstream of the chicken genomic DNA as the homology arm, the amplification primers were designed. The primers contained a 15 bp vector homology sequence and a gene homology arm amplification sequence. The sequence is as follows:

[0075] L-ARM-F: gtacaattcacgcgtgataggagggccatcataca, SEQ ID NO.4;

[0076] L-ARM-R: cattcttgttcctgccctgttctagataattctac, SEQ ID NO.5;

[0077] R-ARM-F: caggcatgctggggattaacttcagggccgcaact, SEQ ID NO.6;

[0078] R-ARM-R: cacagaatcgcagaaccatggcggccgcaggaacc, SEQ ID NO.7.

[0079] The upstream homology arm sequence is as follows (807 bp):

[0080] gataggagggccatcatacaggcctcaaggacatgcgttgtcctcctggagcactgctcatgattatgggacagtaagcagtcgcaacaccagactacaaagccatgagcccagggtggtacagaggagatgcagcagtcctcaactcatttcactgatcagtgtggtaggagatgaaacataaggccattttgatggtagaaaacatacagtaggaagaaaatgaaggttctgcggaggcgaataaatacagtaggtgcaaggctgcactgaaaaacactgccaaatgaaagcaagcaccagcaagaaggacccaacccttagagtttcaagcatgatacatgaggcttcttccaagaatcacagttctccagtgatactctgagcacaatacacttatagcaagcagcaaaacactgtcccacaaacacgaaacaggacaattttttttctgactacttaccatttatgtaggatagacaactgagaaaactgacaacagagcagtacagaatagctgcttccatgactacctgcatcgtgatcctgcatctgatcaactgagttgacatttacaatcatcttggcagtgtttcagaatttaagaacaccaaattcacagtcaaaagtttatggtccattacagtgattcttaccactctgcatcaggcaggtggaggactgacttttagttttttccccaggaatctggcacgcatccactctgtacagagttttcctgttaaactgagaattgcccctgtagcattttttagcaatgtgcaatcattcttgttcctgccctgt, SEQ ID NO.11。

[0081] The downstream homologous arm sequence is as follows (799bp):

[0082] ttaacttcagggccgcaactgtcctctcttccccatgctttgtccacctgctgtccagcagcagtgtaggaaatttgctcagctcacaggtacaccacatgatcccagtgtgcccaaagagaagcaaggaacttgctctgtatgttttccattggcagtttcccctgggaaggcaatttgctacttgtatttgtgactggctggcactcaagtattagtaaggcacagtgagggaagcaaagttacatataagctccacttttccaaaactaaaaagaaatgccagttccatattttcttaagagataggtattataattcccaaatcgggggtagcactgcaaaacgtaacagtatcaggaggttcctgagatggacgctgaaaagtctcacataccaaatgccatcctccacttcagtctttttactagcaatgcctgcttcaggaatgccctggtcctggagaccaggggtgattatgtgtagcaaaggcaggtggaccctcagcggaagaggataaagctgcaaatattttagtaaacttaattatggaagtatgtaagtcttatgtatacgtacatccctgtgccctgatgagatgcatccacaactgaaggagttggcaggtgtgattgcaaggtcatacagtcacgtttgattgtggcacctgggaggagtccccaaagactggaagaaagcagccctgtcttcaagcagggcaagaaagaggacccacgacacaactaaccagccagactcaccttgattcctgaggtgatcacagaatcgcagaaccatg,SEQ ID NO.12。

[0083] (2) Use the Meiji DNA Extraction Kit (D3018-03) to extract chicken genomic DNA according to the instructions, amplify the upstream and downstream homology arm sequences by qPCR, and recover the PCR products by DNA gel electrophoresis. The electrophoresis conditions are 120V and 30min. Cut the correct band with a blade: the size of the upstream homology arm is 807bp, and the size of the downstream homology arm is 799bp. The chopped gel blocks are transferred to EP tubes and recovered using the Tiangen Agarose Gel DNA Recovery Kit (DP219). Weigh the gel blocks, add an equal volume of sol solution, dissolve at 55℃ for 10min, cool and add to the adsorption column, wash, elute with 40μL ddH2O, and measure the concentration.

[0084] (3) XbaI and NotI were used to linearize the donor plasmid pB-PGK-EGFP without homology arms. The enzyme digestion system was as follows: 5 μg of pB-PGK-EGFP vector, 5 μL of 10×NEBuffer, 1 μL of XbaI restriction endonuclease, 1 μL of NotI restriction endonuclease, and 50 μL of ddH2O. Incubate at 37°C for 1 hour; use a blade to cut the correct band: the vector backbone size is 2879 bp, and the PGK-EGFP fragment size is 1243 bp. The chopped gel blocks were transferred to EP tubes and recovered using the Tiangen Agarose Gel DNA Recovery Kit (DP219). Weigh the gel blocks, add an equal volume of sol solution, dissolve at 55°C for 10 min, cool and add to the adsorption column, wash, elute with 40 μL ddH2O, and measure the concentration.

[0085] The vector backbone sequence is as follows:

[0086]

[0087] The PGK-EGFP sequence is as follows:

[0088]

[0089] (4) Use Hieff Plus Multi One Step Cloning Kit clones the donor plasmid by one-step ligation. The amount of vector backbone, upstream homology arm, downstream homology arm and PGK-EGFP fragment is 0.03 pmol per fragment, and the ligation system is 2×Hieff MultiS Enzyme Premix 10 μL, vector backbone 0.03 pmol, upstream homology arm 0.03 pmol, downstream homology arm 0.03 pmol, PGK-EGFP fragment 0.03 pmol, ddH2O supplemented to 20 μL. Incubate at 50°C for 50 min. Obtain the donor plasmid carrying the homology arm, named pB-PGK-EGFP-ARM.

[0090] (5) Transformation and identification are the same as steps (4) and (5) of Example 1.

[0091] Example 3

[0092] Detection of transient transfection efficiency of PGCs

[0093] The PGCs in this embodiment are Bailaihang PGCs, and the acquisition method is as follows:

[0094] Gonads were removed from 6.5-day-old chicken embryos, washed with 100 μL PBS, centrifuged at 500 × g for 5 min, the supernatant was removed, 100 μL 0.25% trypsin was added, digested at 37°C for 7 min, an equal volume of trypsin and complete medium were added to terminate the digestion, the mixture was repeatedly blown with a pipette until the tissue disappeared, centrifuged at 500 × g for 5 min, the supernatant was removed, 400 μL complete medium was added, and cultured at 37°C for 3 h, the suspended cells were transferred to new wells (suspended cells were PGCs, and adherent cells were fibroblasts), and the culture was continued to be expanded.

[0095] This embodiment uses Entranster TM -E is the electrofection buffer, and the electrofection is performed using the Lonza AAD-1001S cell nuclear transfection instrument, including the following steps:

[0096] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;

[0097] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results.6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;

[0098] (3) Add 100 μL Entranster to the cell pellet TM -E electrofection buffer, add 4 μg of donor plasmid pB-PGK-EGFP without homology arms, and mix evenly by gently pipetting;

[0099] (4) The above transfection system was transferred to an electrode cup and electro-transfected using the B16 program of the Lonza AAD-1001S cell nuclear transfection instrument;

[0100] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 48 h, the fluorescence signal was observed and detected and counted by flow cytometry.

[0101] Depend on Figure 1 It can be seen that the transfection efficiency of PGCs reached a maximum of 81.5% after 48 hours using the B16 electroporation program of the Lonza AAD-1001S cell nuclear transfection instrument.

[0102] Example 4

[0103] Detection of efficiency of exogenous gene insertion into PGCs

[0104] The PGCs in this embodiment are Bai Laihang PGCs, and the acquisition method is the same as that in Example 3.

[0105] This embodiment uses Entranster TM -E is the electrofection buffer, and the electrofection is performed using the Lonza AAD-1001S cell nuclear transfection instrument, including the following steps:

[0106] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;

[0107] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;

[0108] (3) Add 100 μL Entranster to the cell pellet TM-E electrotransfection buffer, 2 μg PX459-gRNA and 2 μg pB-PGK-EGFP-ARM, mix evenly by gently pipetting;

[0109] (4) The above transfection system was transferred to an electrode cup and electro-transfected using the B16 program of the Lonza AAD-1001S cell nuclear transfection instrument;

[0110] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 7 days, flow cytometry was performed.

[0111] Depend on Figure 2 It can be seen that after 7 days of transfection using the B16 electroporation program of the Lonza AAD-1001S cell nuclear transfection instrument, the efficiency of site-specific insertion of exogenous genes into PGCs reached 15.4%, and the cell activity was good. 2×10 5 The cells can be cultured for 7 days and then grow to 2×10 6 cells, which meets the cell amount required for chicken embryo injection.

[0112] Comparative Example 1

[0113] Efficiency detection of site-specific insertion of foreign genes into PGCs using donor plasmids without homology arms

[0114] The PGCs in this comparative example are Bailaihang PGCs, and the acquisition method is the same as that in Example 3.

[0115] This comparative example uses Entranster TM -E is the electrofection buffer, and the electrofection is performed using the Lonza AAD-1001S cell nuclear transfection instrument, including the following steps:

[0116] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;

[0117] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;

[0118] (3) Add 100 μL Entranster to the cell pellet TM -E electrotransfection buffer, 2 μg PX459-gRNA and 2 μg pB-PGK-EGFP, mix evenly by gently pipetting;

[0119] (4) The above transfection system was transferred to an electrode cup and electro-transfected using the B16 program of the Lonza AAD-1001S cell nuclear transfection instrument;

[0120] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 7 days, flow cytometry was performed.

[0121] The efficiency of site-specific insertion of vectors without homology arms is extremely low, and the number of cells expressing green fluorescence gradually decreases with the increase of culture time. After 7 days, green fluorescence is almost invisible under the fluorescence field of view. Figure 3 It can be seen that after 7 days of transfection using the B16 electroporation program of the Lonza AAD-1001S cell nuclear transfection instrument, the efficiency of site-specific insertion of exogenous genes without homology arms into PGCs was 0.088%, indicating that the DNA fragment was basically not site-specifically inserted into the genome.

[0122] Comparative Example 2

[0123] Detection of transient transfection efficiency of PGCs based on Bio-Rad electroporator

[0124] The PGCs in this comparative example are Bailaihang PGCs, and the acquisition method is the same as that in Example 3.

[0125] This comparative example uses a cell nucleofection instrument from Bio-Rad, and includes the following steps:

[0126] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;

[0127] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;

[0128] (3) Add 100 μL Entranster to the cell pellet TM -E buffer, and add 4 μg of donor plasmid without homology arms, and mix evenly by gently pipetting;

[0129] (4) The above transfection system was transferred to an electrode cup and electro-transfected using a Bio-Rad electro-transfection system under the conditions of 140 V, 25 ms, and 1 pulse number;

[0130] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 48 h, the fluorescence signal was observed and detected and counted by flow cytometry.

[0131] Depend on Figure 4 It can be seen that when the transfection was performed using the Bio-Rad cell nuclear transfection instrument (electroporation program 140V, 25ms, pulse number 1), the transfection efficiency of PGCs was 31.3% after 48 hours, and a large number of cells died.

[0132] Comparative Example 3

[0133] Detection of PGCs liposome transfection efficiency

[0134] The PGCs in this comparative example are Bailaihang PGCs, and the acquisition method is the same as that in Example 3.

[0135] This comparative example uses Lipofectamine from Thermo TM Transient transfection was performed using the 3000 transfection kit, which included the following steps:

[0136] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;

[0137] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed and re-plated in a 6-well plate;

[0138] (3) Add 4 μg of donor plasmid pB-PGK-EGFP without homology arms and 8 μL P3000 to 125 μL Opti-MEM serum-free medium. TM ;

[0139] (4) Dilute 5 μL Lipofectamine using 125 μL Opti-MEM serum-free medium TM 3000;

[0140] (5) Add the mixed system in step (3) to the mixed system in step (4), mix well, and incubate at room temperature for 15 minutes;

[0141] (6) Add the system of step (5) to the cell culture system, mix well, continue to culture at 37° C., observe and detect the fluorescence signal after 48 hours and count it by flow cytometry.

[0142] Depend on Figure 5 It is known that the use of Lipofectamine TM The transfection efficiency of PGCs transfected with 3000 liposomes for 48 hours was 0.27%.

[0143] Experiment 1

[0144] Analysis of cell viability, pluripotency gene and marker gene expression by different transfection procedures

[0145] The PGCs in this experiment are Bailaihang PGCs, and the acquisition method is the same as that in Example 3.

[0146] Since the cells were in poor condition and showed obvious death after transfection with the Bio-Rad system, this method was not suitable for preparing PGCs cell lines with site-specific insertion of exogenous genes, and this transfection system was excluded in subsequent comparisons.

[0147] The transfection method of this experiment is the same as that of Example 3 and Comparative Example 3. Two transient transfection methods without homology arms, cells were collected 48 hours after transfection, divided into two parts, and the following two experiments were performed.

[0148] (1) Cell activity cycle: centrifuge at 300×g for 5 min, remove the culture medium, add about 1 ml of ice-cold PBS to each well for resuspending, centrifuge at 300×g for 5 min, remove the PBS, add 1 ml of ice-cold 70% ethanol to fix at 4℃ for 1 h. Use BD's PEAnnexin V Apoptosis Detection Kit to prepare the staining solution according to the following system: 10×Annexin VBindingBuffer 10μL, ddH2O 90μL, PE Annexin V 5μL, 7-AAD 5μL, incubate at room temperature and avoid light for 15 min, and use flow cytometry for detection and analysis.

[0149] (2) Total RNA was extracted using Takara RNA extraction reagent RNAiso Plus according to the instructions, and PrimeScript TM RT reagent Kit with gDNA Eraser for cDNA reverse transcription and quantification. The quantitative primers are as follows:

[0150] DAZL-F:TCCCAGAGCCCACACAGATG, SEQ ID NO.15;

[0151] DAZL-R: AAGTGATGCGCCCTCCTCTC, SEQ ID NO.16;

[0152] DDX4-F: TCCATCTTTGCATGTTATCAGTCAGG, SEQ ID NO.17;

[0153] DDX4-R: AATCCCGCCCTGCTTGTATAACAG, SEQ ID NO.18;

[0154] NANOG-F: AGCAGACCTCTCCTTGACCA, SEQ ID NO.19;

[0155] NANOG-R: TTCCTTGTCCCACTCTCACC, SEQ ID NO.20;

[0156] POU5-F: GGCTCAATGAGGCAGAGAAC, SEQ ID NO.21;

[0157] POU5-R: GGACTGGGCTTCACACATTT, SEQ ID NO.22;

[0158] PTEN-F: CAGTGGCGGAACTTGCAATC, SEQ ID NO.23;

[0159] PTEN-R: ATACCGGCAAAGGTTGAGGG, SEQ ID NO. 24.

[0160] The results are as follows Figure 6 As shown. Figure 6 A. Figure 6 B shows that Lipofectamine TM The Annexin V positive rates of 3000 and Lonza electroporation systems at 48 h were 16.99±0.52% and 21.27±1.54%, respectively. Among all genes tested (DAZL, DDX4, NANOG, POU5 and PTEN), there was no significant difference between the Lonza electroporation system and the control group (P<0.05), while Lipofectamine TM 3000 groups of POU5F3, DDX4 and NANOG genes increased and decreased to varying degrees ( Figure 6 C~ Figure 6 E). In summary, the Lonza electroporation system combines high transfection efficiency, low cell apoptosis rate, and does not affect the expression of PGC marker genes and pluripotency genes. It is the optimal transfection method for preparing PGCs for site-specific insertion of exogenous genes.

[0161] According to literature reports, the transfection efficiency of using Lipofectamine to insert exogenous genes into PGCs cultured without feeder layer and serum by homologous recombination is about 0.1-6% (PGCs were cultured for 4 days after transfection). The low efficiency of site-specific editing affects the efficient use of gene editing technology. TM -E is used as a transfection buffer, and the buffer contains components for guiding the vector into the nucleus and repairing the cell membrane, making it easier to deliver DNA into the nucleus while reducing the adverse effects caused by electric shock. At the same time, the present invention adds two homology arms to the donor plasmid to improve the efficiency of fixed-point insertion. The present invention uses the B16 program on this system to obtain a good transfection effect, with an instantaneous transfection efficiency of 81.5%, and a fixed-point insertion efficiency of exogenous genes of up to 15.4% (PGCs continue to be cultured for 7 days after transfection). At the same time, it was detected that the apoptosis rate of PGCs after transfection was low, and pluripotency was not affected. The cells obtained by flow sorting had good activity and grew rapidly, meeting the needs of subsequent in vitro or chicken embryo injection tests, and had the advantages of simple and convenient operation, high efficiency, and good effect. In this specification, each embodiment is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same and similar parts between the embodiments can be referred to each other.

[0162] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0163] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for inserting exogenous genes into chicken primordial germ cells, characterized in that: The steps include: (1) Cultivation and counting of chicken primordial germ cells; (2) Construction of gene editing plasmids and donor plasmids for site-specific insertion of exogenous genes; The gene editing plasmid is an editing plasmid into which gRNA is inserted; The donor plasmid is obtained by adding an upstream homology arm and a downstream homology arm to the plasmid pB-PGK-EGFP; (3) mixing the counted chicken primordial germ cells with electroporation transfection buffer, gene editing plasmid, and donor plasmid to obtain an electroporation transfection system; (4) transferring the electrotransfection system to an electrode cup for transfection; (5) 7 days after transfection, positive cells were sorted by flow cytometry.

2. The method according to claim 1, characterized in that The editing plasmid is PX459.

3. The method according to claim 1, characterized in that The nucleotide sequence of the gRNA is shown in SEQ ID NO.1; TGCGGCCCTGAAGTTAAACA, SEQ ID NO.

1.

4. The method according to claim 3, characterized in that The primers that make gRNA form gRNA template double strands are as follows: gRNA-F: caccgTGCGGCCCTGAAGTTAAACA, SEQ ID NO.2; gRNA-R: aaacTGTTTAACTTCAGGGCCGCA, SEQ ID NO.

3.

5. The method according to claim 1, characterized in that The plasmid pB-PGK-EGFP uses pEGFP-N1 as the original skeleton and replaces the PGK promoter.

6. The method according to claim 1, characterized in that According to the gRNA, about 800bp upstream and downstream of the chicken genome were used as homology arms.

7. The method according to claim 6, characterized in that The primers for amplifying the homology arms are as follows: L-ARM-F: gtacaattcacgcgtgataggagggccatcataca, SEQ ID NO.4; L-ARM-R: cattcttgttcctgccctgttctagataattctac, SEQ ID NO.5; R-ARM-F: caggcatgctggggattaacttcagggccgcaact, SEQ ID NO.6; R-ARM-R: cacagaatcgcagaaccatggcggccgcaggaacc, SEQ ID NO.

7.

8. The method according to claim 1, characterized in that The electroporation transfection buffer is Entranster TM -E.

9. The method according to claim 1, characterized in that The dosage ratio of the chicken primordial germ cells, electroporation transfection buffer and plasmid is: 1×10 6 pcs: 100μL: 4μg; The plasmid includes a gene editing plasmid and a donor plasmid, and the mass ratio between the two is 1:

1.

10. The method according to claim 1, characterized in that The transfection was performed by electrofection using a Lonza AAD-1001S cell nuclear transfection instrument with a parameter of B16.

Images