Method for detecting plant ALKBH enzyme activity and application

Abstract

The invention belongs to the technical field of enzyme activity detection, and particularly relates to a method for detecting plant ALKBH enzyme activity and application. The method for detecting the enzyme activity of the plant ALKBH comprises the following steps: expressing and purifying by using an expression system to obtain a recombinant ALKBH protein; incubating the recombinant ALKBH protein and a nucleic acid molecule substrate, and then carrying out enzyme digestion to obtain an enzyme digestion product; and carrying out electrophoresis migration and nucleic acid protein interaction analysis on the enzyme digestion product, and representing the plant ALKBH enzyme activity according to the number and definition of bands of an image. The method disclosed by the invention is high in safety and simple to operate, can effectively detect the activity of the ALKBH enzyme in the plant, and can be used as a plant ALKBH enzyme activity detection method which is wide in application range, high in practicability and high in stability.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme activity detection, and specifically relates to a method for detecting plant ALKBH enzyme activity and application. Background Art

[0002] ALKBH enzymes belong to the Fe(II)-α-ketoglutarate-dependent dioxygenase family and can repair methylation damage to DNA and RNA in the genome, thus affecting the integrity and stability of the plant genome. Studies on the ALKBH2 protein in Arabidopsis thaliana have shown that the protein has the activity to repair oligonucleotide methylation damage. At the same time, when the gene is mutated and missing, the plants show sensitivity to MMS (alkylating agent), such as deformed and slow growth, low seed germination rate and other phenotypes. ALKBH protein can use molecular oxygen to oxidize the alkyl groups on alkylated damaged nucleic acid bases, such as 1-methyladenine (m1A), 3-methylcytosine (m3C) and 1-n6-ethyleneadenine (εA); the oxidized alkyl groups are then released as aldehydes and regenerated into undamaged bases. Therefore, studying the activity of ALKBH enzymes is of great significance to the study of plant growth, development and metabolic regulation. However, the current detection of ALKB enzyme activity is done by 32'phosphorus labeling. The isotope labeling method requires special display instruments and has certain radioactivity, which is harmful to the human body. In addition, the method requires a special operating room and the operation process is complicated. Therefore, it is particularly important to provide a non-radioactive and simple-to-operate ALKBH enzyme activity detection method. Summary of the invention

[0003] The purpose of the present invention is to provide a method and application for detecting plant ALKBH enzyme activity. The method of the present invention has high safety and can effectively detect the activity of ALKBH enzyme in plants.

[0004] The present invention provides a method for detecting plant ALKBH enzyme activity, comprising the following steps:

[0005] The recombinant ALKBH protein was expressed and purified using the expression system;

[0006] The recombinant ALKBH protein is incubated with a nucleic acid molecule substrate, and then enzymatically digested to obtain an enzymatic digestion product; the enzymatic digestion site of the nucleic acid molecule substrate has methylation damage; and the 5' end of the nucleic acid molecule substrate has a biotin label;

[0007] The enzyme cleavage products were subjected to electrophoretic migration and nucleic acid-protein interaction analysis, and the plant ALKBH enzyme activity was characterized according to the number and clarity of the bands in the image.

[0008] As a preferred embodiment, the nucleic acid molecule substrate includes a single-stranded DNA substrate and a double-stranded DNA substrate; when the nucleic acid molecule substrate is a double-stranded DNA substrate, the double-stranded DNA substrate is formed by annealing two reverse complementary single strands of a sense strand and an antisense strand.

[0009] As a preferred embodiment, the incubation system in 50 μL includes: 50 mM Tris-HCl, 2 mM L-ascorbic acid, 40 μM FeSO4, 100 μM dimethyl 2-oxoglutarate, 10 mM MgCl2, 1 μM double-stranded DNA substrate, 12-90 pM ALKBH protein and the balance water.

[0010] As a preferred embodiment, the incubation temperature is 36°C to 38°C; and the incubation time is 30min to 60min.

[0011] As a preferred embodiment, the restriction endonuclease selected for the enzyme cleavage is a restriction endonuclease sensitive to methylation sites.

[0012] As a preferred embodiment, the temperature of the enzyme cleavage is 36°C to 38°C; the time of the enzyme cleavage is 30min to 60min.

[0013] As a preferred solution, the gel used for the electrophoretic migration is a 15-20% denatured SDS-PAGE gel; the voltage of the electrophoretic migration is 100V-120V; and the time of the electrophoretic migration is 35min-45min.

[0014] The present invention also provides application of the method for detecting plant ALKBH enzyme activity in preparing a product and / or a kit for detecting plant ALKBH enzyme activity.

[0015] The present invention also provides a kit for detecting plant ALKBH enzyme activity, wherein the kit comprises a nucleic acid molecule substrate and a nucleic acid-protein interaction color developing reagent.

[0016] As a preferred embodiment, the restriction site of the nucleic acid molecule substrate carries methylation damage; and the 5' end of the nucleic acid molecule substrate carries a biotin tag.

[0017] Beneficial effects: The present invention provides a method for detecting plant ALKBH enzyme activity, and the method for detecting plant ALKBH enzyme activity comprises the following steps: expressing and purifying a recombinant ALKBH protein using an expression system; incubating the recombinant ALKBH protein with a nucleic acid molecule substrate, performing enzyme cleavage after incubation, and obtaining an enzyme cleavage product after enzyme cleavage; performing electrophoretic migration and nucleic acid-protein interaction analysis on the enzyme cleavage product, and characterizing the plant ALKBH enzyme activity according to the number of bands and the clarity of the bands in the image. The nucleic acid molecule substrate of the present invention carries methylation damage. After incubating the substrate with the ALKBH enzyme, if the ALKBH enzyme has a repairing effect on the methylation in the substrate, the restriction endonuclease will cleave the substrate to form two fragments, showing two bands. If the ALKBH enzyme does not have a repairing effect on the methylation in the substrate, the substrate will not be cut open, showing a single band. At the same time, the substrate designed in the present invention carries a biotin label, and the chemiluminescent nucleic acid detection module kit of the present invention can achieve the purpose of detecting the biotin-labeled nucleic acid by coupling the biotin-labeled nucleic acid with horseradish peroxidase (HRP). Compared with the isotope radioactive phosphorus labeling method used before, it is more convenient, fast and safe. The method of the present invention can effectively detect the activity of the ALKBH enzyme in plants, and can be used as a detection method for the plant ALKBH enzyme activity with a wide range of applications, strong practicality and high stability.

[0018] The chemiluminescent nucleic acid detection module kit used in the present invention includes an enhanced luminol substrate for horseradish peroxidase (HRP). When the prior art detects ALKBH enzyme activity, 32'phosphorus labeling is used. The isotope labeling method requires a special display instrument and has certain radioactivity, which is harmful to the human body. In the experiment of the present invention, since the designed substrate is labeled with biotin, it can be detected by a horseradish peroxidase (HRP) conjugate. The chemiluminescent nucleic acid detection module kit is more convenient, faster and safer than the isotope radioactive phosphorus labeling method used before. The method of the present invention has high safety, simple operation, and is of great significance to the study of plant growth and development and metabolic regulation. It is highly practical and has great application value.

[0019] The method of the present invention has the advantages of wide application range, easy operation, high efficiency and high stability for detecting ALKBH enzyme activity. In the process of using the method to detect enzyme activity, the biotin label is not easy to degrade and can stably perform chemiluminescence, which provides a more effective method and approach for detecting ALKBH enzyme activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0021] Figure 1 This is a diagram of the constructed ALKBH protein expression vector;

[0022] Figure 2 Schematic diagram of double-stranded DNA synthesis;

[0023] Figure 3 is the result of methylation repair, where 0, 12, 30, and 90 pM are the concentrations of added protein. DETAILED DESCRIPTION

[0024] The present invention provides a method for detecting plant ALKBH enzyme activity, comprising the following steps:

[0025] The recombinant ALKBH protein is expressed and purified using an expression system. As a specific embodiment, taking Physcomitrella patens as an example, the PMAL-C2X vector (Li DH, Xi H, Yu XB, Cai YP. Molecular cloning and characterization of a subtilisin-like protease from Arabid opsisthaliana. Genet Mol Res. 2015 Dec 9; 14(4): 16535-45. doi: 10.4238 / 2015. December. 9. 25. PMID: 26662452.) can be used. PCR amplification was performed using primers pMAL+11520_rec_F and pMAL+11520_rec_R and genomic DNA of Physcomitrella patens as a template. After recovery, the PCR product was connected with the linearized vector PMAL-C2X and transformed into Escherichia coli DH5α (Shanghai Weidi-DL1001M). The grown monoclonal colonies were positively identified, and the plasmids were extracted from the positive bacterial liquid by shaking the bacteria to obtain the PMAL-C2X+ALKBH plasmid, which was transferred into DE3 competent medium (Shanghai Weidi-EC1014), and colony PCR identification was performed again, and the positive bacterial liquid was expanded for culture. The DE3 strain carrying the PMAL-C2X+ALKBH plasmid was expanded and cultured for 3 hours, cultured 250 mL, induced by adding 1 / 1000 IPTG for 24 hours, centrifuged to obtain the bacterial cells, added the breaking buffer, and the supernatant obtained after ultrasonic breaking was purified using an MB P column (Smart-Lifesciences-SA077025), and the protein concentration was measured using a BCA kit (Biyuntian-P0010S) to obtain the recombinant ALKBH protein. The sequence of the pMAL+11520_rec_F can be shown in SEQ ID NO.1: AGGATTTCAGAATTCGGATCCATGCCAGTTCATTC TTGTCGTGG; the sequence of the pMAL+11520_rec_R can be shown in SEQ ID NO.2: CAGGTCGACTCTAGAGGATCCCTCAGTGATGGTCTGCTCCATCA.

[0026] The recombinant ALKBH protein is incubated with a nucleic acid molecule substrate, and then enzymatic cleavage is performed after incubation to obtain an enzymatic cleavage product. The enzymatic cleavage site of the nucleic acid molecule substrate has methylation damage; the 5' end of the nucleic acid molecule substrate has a biotin label. The biotin label of the present invention is not easy to degrade, can stably perform chemiluminescence, and provides a more effective method and approach for detecting ALKBH enzyme activity.

[0027] The nucleic acid molecule substrate of the present invention includes a single-stranded DNA substrate and a double-stranded DNA substrate. The nucleic acid molecule substrate in the embodiment of the present invention is a double-stranded DNA substrate. The restriction site of the double-stranded DNA substrate of the present invention carries methylation damage. The restriction site of the double-stranded DNA substrate of the present invention may carry a methylation mark 1-meA, or may carry other Dam types of methylation. The double-stranded DNA substrate of the present invention is formed by annealing two reverse complementary single strands of a sense strand and an antisense strand. As a specific embodiment, the sequence of the sense strand of the double-stranded DNA substrate may be as shown in SEQ ID NO.3: TAGACATTGCCATTCTCGATAGG / 1-meA / TCCGGTCAAACCTAGACGAATTCCG, and the sequence of the antisense strand may be as shown in SEQ ID NO.4: CGGAATTCGTCTAGGTTTGACCGGATCCTATC GAGAATGGCAATGTCTA. As a specific implementation method, the same volume of 10 μM sense strand and 10 μM antisense strand can be added to an ep tube, placed in boiling water, and cooled to room temperature to anneal and form a double-stranded DNA substrate.

[0028] The incubation system of the present invention is based on 50 μL, including: 50 mM Tris-HCl, 2 mM L-ascorbic acid, 40 μM FeSO4, 100 μM dimethyl 2-oxoglutarate, 10 mM MgCl2, 1 μM double-stranded DNA substrate, 12-90 pM ALKBH protein and the rest of water. When the ALKBH enzyme in the plant is inactive, the methylation damage in the substrate cannot be repaired, so it cannot be cut by the restriction endonuclease, showing a band. When the ALKBH enzyme activity in the plant is low, the methylation damage in the substrate is repaired less, so the substrate cut by the restriction endonuclease is also less, and the band is not obvious, indicating that the enzyme does have repair activity for the methylation damage of the substrate, but the activity is low. When the ALKBH enzyme activity in the plant is high, more methylation damage in the substrate will be repaired, so more substrates will be cut by the restriction endonuclease, and the bands will be more obvious, indicating that the enzyme does have a high activity to repair the methylation damage of the substrate. This shows that the method of the present invention can detect the activity of ALKBH in plants to repair methylation damage.

[0029] The incubation temperature of the present invention can be 36° C. to 38° C., such as 36° C., 37° C. and 38° C. If the incubation temperature is too high or too low, the activity of the ALKBH enzyme will be affected, thereby affecting the results of the experiment.

[0030] The incubation time of the present invention can be 30min to 60min, for example 30min, 31min, 32min, 33min, 34min, 35min, 36min, 37min, 38min, 39min, 40min, 41min, 42min, 43min, 44min, 45min, 46min, 47min, 48min, 49min, 50min, 51min, 52min, 53min, 54min, 55min, 56min, 57min, 58min, 59min and 60min. If the incubation time is too short, the reaction will be insufficient, thereby affecting the result of the experiment.

[0031] The restriction endonuclease selected for the enzyme cutting of the present invention can be a restriction endonuclease that is sensitive to methylation sites. As a specific embodiment, the restriction endonuclease can be Dpn II. The double-stranded DNA substrate of the present invention carries methylation damage. After incubating the substrate with the ALKBH enzyme, if the ALKBH enzyme has a repair effect on the methylation in the substrate, the restriction endonuclease Dpn II will cut the substrate to form two fragments, showing two bands. If the ALKBH enzyme does not have a repair effect on the methylation in the substrate, the substrate will not be cut, and therefore only one band will be shown.

[0032] The temperature of the enzyme cutting of the present invention is determined according to the temperature of the selected restriction endonuclease. In a specific embodiment of the present invention, it can be 36° C. to 38° C., for example, 36° C., 37° C. and 38° C. If the temperature of the enzyme cutting is too high or too low, the activity of the restriction endonuclease will be affected, thereby affecting the results of the experiment.

[0033] The time of the enzyme cutting of the present invention can be 30min to 60min, for example 30min, 31min, 32min, 33min, 34min, 35min, 36min, 37min, 38min, 39min, 40min, 41min, 42min, 43min, 44min, 45min, 46min, 47min, 48min, 49min, 50min, 51min, 52min, 53min, 54min, 55min, 56min, 57min, 58min, 59min and 60min. If the time of the enzyme cutting is too short, the reaction will be insufficient, thereby affecting the result of the experiment.

[0034] The enzyme cleavage product is subjected to electrophoretic migration and nucleic acid protein interaction analysis, and the plant ALKBH enzyme activity is characterized according to the number of bands and the clarity of the bands in the image. As a specific embodiment, after obtaining the enzyme cleavage product, the enzyme cleavage product can be run on a gel, transferred to a membrane, and ultraviolet cross-linked. After ultraviolet cross-linking, a chemiluminescent nucleic acid detection module kit is used for blocking, staining, washing the membrane, and luminescent color development, and then the image is collected, and the plant ALKBH enzyme activity is characterized according to the number of bands and the clarity of the bands in the image. The chemiluminescent nucleic acid detection module kit (Thermo Scientific-89880) used in the present invention is used to detect biotin-labeled nucleic acid probes in various membrane blotting applications, and almost all biotinylated probes (DNA or RNA) methods based on nitrocellulose or nylon membranes can be detected. The module includes key detection components for Thermo Scientific North2South kits and ThermoScientific LightShift EMSA kits. The system includes an enhanced luminol substrate for horseradish peroxidase (HRP), with optimized blocking and washing buffers, which can be quickly and trouble-free detected on the membrane. Obtain publication-level blots with excellent signal and low background. Features of the chemiluminescent nucleic acid detection module: (1) Fast and sensitive - the same expected speed and detection level can be obtained using the kit; (2) Universal - Suitable for any nucleic acid detection system containing biotin: Northern, Southern, EMSA, RPA and colony transfer; (3) Flexible - the kit only contains key detection components and is suitable for detection with biotin-labeled probes. The prior art uses 32' phosphorus labeling method when detecting ALKBH enzyme activity. The isotope labeling method requires special display instruments and has certain radioactivity, which is harmful to the human body. The chemiluminescent nucleic acid detection module kit used in the present invention is more convenient, faster and safer than the isotope radioactive phosphorus labeling method used previously.

[0035] The gel used for the electrophoretic migration of the present invention can be a 15% to 20% denatured SDS-PAGE gel, such as a 15% denatured SDS-PAGE gel, a 16% denatured SDS-PAGE gel, a 17% denatured SDS-PAGE gel, a 18% denatured SDS-PAGE gel, a 19% denatured SDS-PAGE gel and a 20% denatured SDS-PAGE gel; the voltage of the electrophoretic migration of the present invention can be 100V to 120V, such as 100V, 101V, 102V, 103V, 104V, 105V, 106V, 107V, 108V, 109V, 110V, 111V, 112V, 113V, 114V, 115V, 116V, 117V, 118V, 119V and 120V; the time of electrophoretic migration of the present invention can be 35min to 45min, for example 35min, 36min, 37min, 38min, 39min, 40min, 41min, 42min, 43min, 44min and 45min.

[0036] When only one band is shown in the image, it indicates that the ALKBH enzyme in the plant is inactive; when two bands are shown in the image but the bands are not obvious, it indicates that the ALKBH enzyme activity in the plant is low; when two bands are shown in the image and the bands are clear and obvious, it indicates that the ALKBH enzyme activity in the plant is high.

[0037] The present invention also provides application of the method for detecting plant ALKBH enzyme activity in preparing a product and / or a kit for detecting plant ALKBH enzyme activity.

[0038] The present invention also provides a kit for detecting plant ALKBH enzyme activity, wherein the kit comprises a nucleic acid molecule substrate and a nucleic acid-protein interaction color developing reagent.

[0039] The restriction site of the nucleic acid molecule substrate of the present invention has methylation damage; the 5' end of the nucleic acid molecule substrate has a biotin label.

[0040] In order to further illustrate the present invention, a method and application for detecting plant ALKBH enzyme activity provided by the present invention are described in detail below in combination with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example

[0042] a. ALKBH gene of Physcomitrella patens (gene ID: Pp3c2_11520) was amplified by PCR in vitro to construct a protein expression vector. The vector PMAL-C2X (Li DH, Xi H, Yu XB, Cai YP. Molecular cloning and characterization of a subtilisin-like protease from Arabidopsisthaliana. Genet Mol Res. 2015 Dec 9; 14(4): 16535-45. doi: 10.4238 / 2015. December. 9.25. PMID: 26662452.) was used to construct the expression vector. PCR amplification was performed using the primer sequences in Table 1 and the genomic DNA of Physcomitrella patens as a template. After the PCR product was recovered, it was connected with the linearized vector PMAL-C2X and transformed into Escherichia coli DH5α (Shanghai Weidi-DL1001M). The monoclonal colonies grown were positively identified. The positive bacterial liquid was shaken to extract the plasmid to obtain the PMAL-C2X+ALKBH plasmid (i.e., the constructed ALKBH protein expression vector, the plasmid map of which is shown in FIG. Figure 1 As shown), transfer into DE3 competent medium (Shanghai Weidi-EC1014), perform colony PCR identification again, and expand the positive bacterial solution for culture.

[0043] Table 1 Primer sequences

[0044]

[0045] b. To express the protein in large quantities in prokaryotes, the DE3 strain carrying the PMAL-C2X+ALKBH plasmid was expanded and cultured for 3 h. After culturing 250 mL, 1 / 1000 IPTG was added for induction for 24 h. The bacteria were obtained by centrifugation, and a breaking buffer was added. The supernatant obtained after ultrasonic breaking of the bacteria was purified using an MBP column (Smart-Lifesciences-SA077025). The protein concentration was measured using a BCA kit (Biyuntian-P0010S) and was 3.83 mg / mL.

[0046] c. Design and synthesize a 49 bp oligonucleotide sequence, the middle restriction site has a methylation mark 1-me A (or other Dam type methylation is acceptable), the 5' end has a biotin tag, the sequence of the positive chain is TAGACATTGCCATTCTCGATAGG / 1-meA / TCCGGTCAAACCTAGACGAATTCC G (sequence name is SEQ ID NO.3), and the sequence of the antisense chain is CGGAATTCGTCTAGGTTT GACCGGATCCTATCGAGAATGGCAATGTCTA (sequence name is SEQ ID NO.4).

[0047] Take the same volume of 10μM sense strand and 10μM antisense strand and add them to the ep tube, place it in boiling water, wait for it to cool to room temperature, and anneal to form a double-stranded DNA substrate (the schematic diagram of the substrate is shown in Figure 2 shown).

[0048] d. Prepare the buffer for ALKBH dioxygenase to repair DNA methylation damage, with a reaction system of 50 μL;

[0049] The buffer mainly includes: 50mM Tris-HCl (pH 8.0), 2mM L-ascorbic acid, 40μM FeSO4, 100μM dimethyl 2-oxoglutarate, 10mM MgCl2, 1μM double-stranded DNA substrate, 0 or 12 or 30 or 90pM ALKBH enzyme, and the rest is made up to 50μl with water.

[0050] e. Incubate the ALKBH enzyme and the double-stranded DNA substrate with methylation damage in a buffer system at 37°C for 1 h.

[0051] f. Incubate the system at 65°C for 15 min to inactivate it, then add Dpn II (NEB R0543S) restriction endonuclease for digestion at 37°C for 1 h.

[0052] Enzyme digestion system: 50 μL of the above incubation system, 1 μL of Dpn II, 6 μL of Buffer, and 3 μL of H2O.

[0053] g. Prepare 20% denatured SDS-PAGE gel, add DNA Loading Buffer to the above reaction system and inactivate it, incubate at 85℃ for 15min. Take 20μL of the system and run the gel at 110V for 40min.

[0054] h. Transfer the membrane. Remove the gel block and transfer the membrane using a positively charged nylon membrane at 380 mA for 30 min.

[0055] i. After the transfer, UV crosslinking was performed for 15 min, and the chemiluminescent nucleic acid detection module kit (ThermoScientific-89880) was used for subsequent blocking, staining, membrane washing and luminescence color development.

[0056] j. Expose and collect images on a CCD imaging system or chemiluminescence instrument.

[0057] According to the experimental design, the substrate contains methylation damage. After incubating the substrate with the ALKBH enzyme, if the ALKBH enzyme has a repair effect on the methylation in the substrate, the restriction endonuclease Dpn II will cut the substrate to form two fragments, showing two bands. If the ALKBH enzyme does not have a repair effect on the methylation in the substrate, the substrate will not be cut, so only one band will be shown.

[0058] Results Figure 3 , no reaction reagent was added to the control group in the collected image, which was used as a negative control to determine that the experimental substrate could be developed by biotin. Through the analysis of the collected images, it can be seen that when the concentration of ALKBH is 0PM, the methylation damage in the substrate cannot be repaired, so it cannot be cut by the restriction endonuclease, showing a band; as the concentration of the added enzyme increases, more methylation damage in the substrate will be repaired, so more substrates will be cut by the restriction endonuclease, and the band will be more obvious, indicating that the enzyme does have repair activity for the methylation damage of the substrate.

[0059] By detecting the ALKBH enzyme of known enzyme activity of Physcomitrella patens with different concentrations, it is shown that the method of the present invention can effectively detect the activity of the ALKBH enzyme in plants. When the ALKBH enzyme in the plant is inactive, the methylation damage in the substrate cannot be repaired, and only one band can be displayed. When the ALKBH enzyme activity in the plant is low, the methylation damage in the substrate is repaired less, and the substrate cut by the restriction endonuclease is also less, and two bands can be displayed, but the bands are not obvious. When the ALKBH enzyme activity in the plant is high, the methylation damage in the substrate will be repaired more, and the substrate cut by the restriction endonuclease is more, and the bands are more obvious, indicating that the enzyme does have repair activity for the methylation damage of the substrate, and the activity is high.

[0060] It can be seen that the detection of ALKBH enzyme activity according to the method of the present invention has the advantages of high safety, wide application range, easy operation, high efficiency and high stability. In the process of detecting enzyme activity using this method, the biotin label is not easy to degrade and can stably perform chemiluminescence, which provides a more effective method and approach for detecting ALKBH enzyme activity.

[0061] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for detecting plant ALKBH enzyme activity, characterized in that: The following steps are involved: The recombinant ALKBH protein was expressed and purified using the expression system; The recombinant ALKBH protein is incubated with a nucleic acid molecule substrate, and then enzymatically digested to obtain an enzymatic digestion product; the enzymatic digestion site of the nucleic acid molecule substrate has methylation damage; and the 5' end of the nucleic acid molecule substrate has a biotin label; The enzyme cleavage products were subjected to electrophoretic migration and nucleic acid-protein interaction analysis, and the plant ALKBH enzyme activity was characterized according to the number and clarity of the bands in the image.

2. The method according to claim 1, characterized in that The nucleic acid molecule substrate includes a single-stranded DNA substrate and a double-stranded DNA substrate; when the nucleic acid molecule substrate is a double-stranded DNA substrate, the double-stranded DNA substrate is formed by annealing two reverse complementary single strands of a sense strand and an antisense strand.

3. The method according to claim 2, characterized in that The incubation system, in 50 μL, includes: 50 mM Tris-HCl, 2 mM L-ascorbic acid, 40 μM FeSO4, 100 μM dimethyl 2-oxoglutarate, 10 mM MgCl2, 1 μM double-stranded DNA substrate, 12-90 pM ALKBH protein and the balance water.

4. The method according to claim 3, characterized in that The incubation temperature is 36° C. to 38° C.; the incubation time is 30 min to 60 min.

5. The method according to claim 4, characterized in that The restriction endonuclease selected for the enzyme cutting is a restriction endonuclease sensitive to methylation sites.

6. The method according to claim 5, characterized in that The temperature of the enzyme cutting is 36° C. to 38° C.; the time of the enzyme cutting is 30 min to 60 min.

7. The method according to claim 6, characterized in that The gel used for the electrophoretic migration is 15-20% denatured SDS-PAGE gel; the voltage of the electrophoretic migration is 100V-120V; and the time of the electrophoretic migration is 35min-45min.

8. Use of the method according to any one of claims 1 to 7 in the preparation of a product and / or a kit for detecting plant ALKBH enzyme activity.

9. A kit for detecting plant ALKBH enzyme activity, characterized in that: The kit comprises a nucleic acid molecule substrate and a nucleic acid-protein interaction color developing reagent.

10. The kit according to claim 9, characterized in that The restriction site of the nucleic acid molecule substrate has methylation damage; the 5' end of the nucleic acid molecule substrate has a biotin label.

Images