Use of smad6 in the auxiliary diagnosis and prognosis evaluation of tgct

Abstract

This invention relates to the application of SMAD6 in the auxiliary diagnosis and prognostic assessment of TGCT. Based on TGCT samples, this invention identifies a novel TGCT prognostic biomarker (SMAD6) through differential analysis, Cox regression, and survival analysis. Subsequently, the expression level of SMAD6 in normal testicular tissue and TGCT was assessed by immunohistochemical staining. Finally, the relationship between SMAD6 and biological characteristics, mutant landscape, immune cell infiltration, and immunotherapy response was investigated. This invention clarifies that SMAD6 is a risk factor for poor prognosis in TGCT. Immunohistochemical results show that SMAD6 is highly expressed in TGCT tissues. GSEA indicates that SMAD6 is associated with the activation of tumor-related pathways and the inhibition of immune-related pathways. Furthermore, high SMAD6 expression is associated with lower CD8 levels. + T-cell infiltration is associated with low SMAD6 expression, and patients with low SMAD6 expression benefit more from immunotherapy.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to the application of SMAD6 in TGCT-assisted diagnosis and prognostic assessment. Background Technology

[0002] Testicular germ cell tumor (TGCT) is a rare malignant tumor, accounting for less than 1% of all adult cancers. Nevertheless, it is one of the most common solid tumors in men aged 15 to 44. In recent years, the global incidence of TGCT has shown a gradual upward trend, particularly in Europe and the Americas, where the incidence is generally high. The development of TGCT is influenced by both genetic and environmental factors, with cryptorchidism being the primary risk factor, related to the impact of exposure to certain exogenous substances during pregnancy on fetal testicular development. TGCT is mainly divided into seminoma and non-seminomatous tumors. Non-seminomatous tumors include embryonal cell carcinoma, choriocarcinoma, yolk sac tumor, teratoma, and trophoblastoma. If multiple tumor cell components are present in TGCT, it is called a mixed germ cell tumor. Different histological subtypes of TGCT exhibit different biological characteristics, clinical manifestations, and prognoses, leading to different treatment options. Seminomas are highly sensitive to chemotherapy and radiotherapy, while non-seminomatous tumors are usually treated with surgery and chemotherapy. Early-stage TGCT patients respond well to orchiectomy and adjuvant radiotherapy or chemotherapy; stage I patients with surgical resection alone have a five-year survival rate of up to 95%. However, 12%–30% of patients may experience recurrence and metastasis even after orchiectomy, and the prognosis for these patients is generally poor.

[0003] Currently, prognostic assessment of TGCT primarily relies on traditional serum tumor markers (STMs), such as lactate dehydrogenase (LDH), β-human chorionic gonadotropin (β-HCG), and alpha-fetoprotein (AFP). However, these markers can produce false-positive or false-negative results. LDH, as a non-specific marker of cell turnover, may be associated with increased levels of inflammation, infection, or other tumors; β-HCG may be elevated in various conditions such as hyperthyroidism and hypogonadism; and AFP may also produce false-positive results in cases of inherited persistence of alpha-fetoprotein or liver dysfunction. Approximately half of TGCT patients may have STM levels below the clinical detection threshold, leading to false-negative results. Therefore, these STMs lack sufficient sensitivity and specificity for predicting the prognosis of TGCT patients. In conclusion, it is particularly urgent and necessary to conduct in-depth research on tumor heterogeneity, combine bioinformatics and multi-omics analysis methods to explore and identify new biomarkers, and further explore and develop new prognostic biomarkers with higher sensitivity and specificity related to TGCT. This will help provide more accurate prognostic assessment and support clinical decision-making. Summary of the Invention

[0004] The purpose of this invention is to address the problems existing in the prior art, thereby providing a biomarker, SMAD6, that is highly correlated with testicular germ cell tumors. By using SMAD6 as a biomarker, the incidence and prognosis of testicular germ cell tumors can be effectively predicted, significantly reducing the probability and severity of the disease and minimizing harm to human health.

[0005] To solve the above-mentioned technical problems, the present invention is achieved through the following technical solution.

[0006] The first aspect of this invention provides the use of a reagent for detecting SMAD6 expression levels in the preparation of products for the auxiliary diagnosis and / or prognostic assessment of testicular germ cell tumors.

[0007] Preferably, the reagent for detecting SMAD6 expression level includes primers for detecting SMAD6 gene level and / or reagents for detecting SMAD6 protein level.

[0008] Preferably, the primers for detecting SMAD6 gene levels are selected from at least one of the following primer pairs:

[0009] Primer pair 1: Upstream sequence as shown in SEQ ID NO: 1 (5'-GCAACCCCTACCACTTCAGC-3'), downstream sequence as shown in SEQ ID NO: 2 (5'-GTGGCTTGTACTGGTCAGGAG-3');

[0010] Primer pair 2: The upstream sequence is shown in SEQ ID NO: 3 (5'-CTCCCTCATCACTGCTCCGGG T-3'), and the downstream sequence is shown in SEQ ID NO: 4 (5'-GGTGCTCCCAGTACGCCACG-3');

[0011] Primer pair 3: The upstream sequence is shown in SEQ ID NO: 5 (5'-GGGCCCGAATCTCCGC-3'), and the downstream sequence is shown in SEQ ID NO: 6 (5'-AGAATTCACCCGGAGCAGTG-3').

[0012] Preferably, the reagent for detecting SMAD6 protein levels is selected from anti-SMAD6 antibody (ProteinTech Group, Inc., YT4338).

[0013] It should be understood that, unless otherwise specified, in the context of this invention, the primers and / or primer pairs refer to PCR primers used to synthesize the SMAD6 gene cDNA strand in PCR, thereby detecting the expression level of the SMAD6 gene mRNA. In addition to the primers, primer pairs, and / or antibodies listed in this invention, those skilled in the art are fully capable of designing corresponding primers, primer pairs, and antibodies based on the SMAD6 gene sequence using conventional methods and techniques in the field, including but not limited to molecular biology, and screening the designed primers, primer pairs, and antibodies using conventional experimental methods, or using commercially available primers, as long as they can specifically detect the SMAD6 expression level.

[0014] A second aspect of the present invention provides the use of SMAD6 inhibitors in the preparation of medicaments for the prevention and / or treatment of testicular germ cell tumors.

[0015] Preferably, the SMAD6 inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the SMAD6 gene.

[0016] Preferably, the SMAD6 inhibitor is selected from shRNA designed based on the SMAD6 gene; more preferably, the shRNA sequence designed based on the SMAD6 gene is selected from one or more of SEQ ID NO: 7 (5'-CCGGCG GCGACTTTGGCGAAGTCGTCTCGAGACGACTTCGCCAAAGTCGCCGTTTTT-3'), SEQ ID NO: 8 (5'-CCGGCTTACACTGAAACGGAGGCTACTCGAGTAGCCTCCGTTTCAGTGTAAGTTTTT-3'), and SEQ ID NO: 9 (5'-CCGGGGATTCCCAGCAGCTCTTTGGCTCGAGCCAAGAGCTGCTGGGAAT CCTTTTTG-3').

[0017] It should be understood that, unless otherwise specified, in the context of this invention, the SMAD6 inhibitor refers to a substance capable of specifically downregulating the expression level of SMAD6 and / or the transcriptional level of its mature mRNA and / or the expression level or activity of SMAD6 protein. Examples include small molecule compounds, antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA erasers, target masking, and / or multi-target methods to downregulate SMAD6 expression level and / or activity. Those skilled in the art can design inhibitory agents based on the SMAD6 gene sequence to suppress its expression level, or these agents can be obtained commercially, as long as they can reduce the level and / or activity of SMAD6.

[0018] A third aspect of the present invention provides a kit for the auxiliary diagnosis and / or prognostic assessment of testicular germ cell tumors, including reagents for detecting SMAD6 expression levels.

[0019] Preferably, the reagents for detecting SMAD6 expression levels include primers for detecting SMAD6 gene levels and / or reagents for detecting SMAD6 protein levels.

[0020] Preferably, the primers for detecting SMAD6 gene levels are selected from at least one of the following primer pairs:

[0021] Primer pair 1: The upstream sequence is shown in SEQ ID NO: 1, and the downstream sequence is shown in SEQ ID NO: 2;

[0022] Primer pair 2: The upstream sequence is shown in SEQ ID NO: 3, and the downstream sequence is shown in SEQ ID NO: 4;

[0023] Primer pair 3: The upstream sequence is shown in SEQ ID NO: 5, and the downstream sequence is shown in SEQ ID NO: 6.

[0024] Preferably, the reagent for detecting SMAD6 protein levels is selected from anti-SMAD6 antibody (ProteinTech Group, Inc., YT4338).

[0025] Preferably, the kit further includes one or more of PCR enzyme, PCR buffer, dNTPs, and fluorescent substrate.

[0026] Preferably, the fluorescent substrate is selected from Syber Green or fluorescently labeled probes.

[0027] A fourth aspect of the present invention provides a pharmaceutical composition for the prevention and / or treatment of testicular germ cell tumors, comprising an SMAD6 inhibitor and a pharmaceutically acceptable carrier.

[0028] Preferably, the SMAD6 inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the SMAD6 gene.

[0029] Preferably, the SMAD6 inhibitor is selected from shRNA designed based on the SMAD6 gene; more preferably, the shRNA sequence designed based on the SMAD6 gene is selected from one or more of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

[0030] The fifth aspect of this invention provides the use of SMAD6 inhibitors in the preparation of medicaments that enhance the immunotherapeutic activity of testicular germ cell tumors.

[0031] Preferably, the SMAD6 inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the SMAD6 gene.

[0032] Preferably, the SMAD6 inhibitor is selected from shRNA designed based on the SMAD6 gene; more preferably, the shRNA sequence designed based on the SMAD6 gene is selected from one or more of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

[0033] Preferably, the immunotherapy is selected from one or more of anti-PD-1 antibody therapy, anti-PD-L1 antibody therapy, and CA RT therapy.

[0034] Most patients with TGCT show significantly improved prognosis after surgical resection, supplemented with chemotherapy or radiotherapy. Although the five-year survival rate for TGCT is relatively high, statistics show that up to 30% of advanced-stage patients relapse after treatment. For these patients, prognostic assessment is a crucial part of developing a treatment strategy, but this process remains complex and challenging, especially for refractory patients. Immunotherapy may offer an effective treatment option for these patients. Studies have shown that some refractory TGCT patients may benefit from PD-L1 inhibitors, but predictive biomarkers related to tumor response remain unclear. Therefore, finding new indicators that can improve the accuracy of predicting immunotherapy response is particularly urgent and important.

[0035] Existing research indicates that the SMAD protein family is a class of classic transcription factors that, by activating serine / threonine kinase receptors, transmit signals from transforming growth factor-β (TGF-β) ligands. These signals significantly influence the epithelial-to-mesenchymal transition (EMT) process, thereby regulating the migration and invasion capabilities of tumor cells. Among them, SMAD6, as a key regulator of the TGF-β signaling pathway, plays a crucial role in promoting tumor growth, spread, and metastasis. During EMT, epithelial cells lose their typical epithelial characteristics and transform into mesenchymal cells with migratory and invasive capabilities, which is considered an important mechanism driving tumor metastasis. Studies have shown that SMAD6 regulates the EMT process in non-small cell lung cancer by blocking the growth inhibition mediated by the TGF-β signaling pathway, thereby promoting tumor development and leading to poor patient prognosis. Similarly, multiple studies have also shown that SMAD6 promotes the proliferation, progression, and EMT process of various cancers. However, the role and mechanism of SMAD6 in TGCT still require further investigation.

[0036] This invention validated SMAD6 as a risk factor for TGCT through extensive experiments. First, a comprehensive analysis of the PFI and OS cohorts of TGCT showed that high SMAD6 expression was significantly associated with poorer patient prognosis. Subsequently, high SMAD6 expression in TGCT was confirmed by IHC staining. These results indicate that SMAD6 has the potential to serve as a prognostic biomarker for TGCT. To elucidate the important potential function of SMAD6 in TGCT, GSEA enrichment analysis was performed. The results showed that SMAD6 activates the EMT pathway associated with tumor invasion and metastasis.

[0037] Notably, in GSEA enrichment analysis, this invention also found that SMAD6 significantly inhibited immune-related pathways, suggesting that SMAD6 may play a role in the tumor immune microenvironment. The tumor microenvironment is composed of tumor cells, immune cells, stromal cells, vascular endothelial cells and their secreted cytokines and extracellular matrix, etc. These components play important roles in tumor occurrence, development, and metastasis, especially the abnormal activation of immune cells, which significantly affects the clinical prognosis of patients. Studies have shown that in the TGCT tumor microenvironment, the degree of infiltration of immune cells, especially T cells, is significantly correlated with the pathological grade and metastasis / recurrence of the tumor. In this invention, immune infiltration analysis preliminarily identified SMAD6 expression and CD8... + The negative correlation between the degree of T cell infiltration and the tumor immune microenvironment was verified by IHC staining. This important finding suggests that SMAD6 may promote the immune escape ability of tumor cells by regulating the tumor immune microenvironment, ultimately having an adverse impact on patient prognosis.

[0038] This invention clarifies that in cohorts receiving anti-PD-L1 immunotherapy and CAR-T therapy, patients with low SMAD6 expression responded better to immunotherapy and had longer survival after immunotherapy. In summary, SMAD6 expression may affect the degree of immune cell infiltration and immunotherapy response in TGCT, ultimately influencing patient prognosis. Furthermore, this invention observed significant differences in the mutation frequencies of the KIT and KRAS genes between the high and low SMAD6 expression groups. The KIT gene encodes a receptor tyrosine kinase that plays a crucial role in cell survival and proliferation in TGCT. KRAS gene mutations are common in TGCT and many other tumors, affecting intracellular GTPase activity and promoting cell growth. In addition, chromosome 12p amplification is the most common copy number variation in TGCT. These differences in gene mutations may be one of the reasons for the prognostic differences in the SMAD6 subset.

[0039] In summary, this invention, based on multicenter TGCT samples, identified a novel prognostic biomarker, SMAD6, through differential analysis, Cox regression, and survival analysis. Immunohistochemical staining was used to assess SMAD6 expression levels in normal testicular tissue and TGCT. Finally, the relationship between SMAD6 and biological characteristics, mutant landscape, immune cell infiltration, and immunotherapy response was investigated. This invention clarifies that SMAD6 is a risk factor for poor prognosis in TGC-T. Immunohistochemical results showed high expression of SMAD6 in TGCT tissues. GSEA indicated that SMAD6 is associated with activation of tumor-associated pathways and inhibition of immune-associated pathways. Furthermore, high SMAD6 expression is associated with lower CD8 levels. +T-cell infiltration is associated with SMAD6 expression. In cohorts receiving anti-PD-L1 immunotherapy and CAR-T therapy, patients with low SMAD6 expression responded better to immunotherapy and had longer survival after immunotherapy, indicating that SMAD6 expression may affect the degree of immune cell infiltration and immunotherapy response in TGCT. By detecting SMAD6 in subjects and obtaining its expression level, the probability of subjects developing TGCT can be reasonably predicted; the progression of tumors in TGCT patients can also be reasonably predicted, thereby providing personalized treatment plans to improve clinical treatment outcomes; and the prognosis of patients can be reasonably assessed, providing reasonable and effective guidance for treatment and rehabilitation. This invention fully reveals the potential of SMAD6 as a biomarker for TGCT prognosis and immunotherapy response, providing new scientific evidence and theoretical basis for personalized treatment of TGCT. Attached Figure Description

[0040] Figure 1 This is a schematic diagram of the principal component analysis (PCA) results in the GSE18155 dataset.

[0041] Figure 2 This is a volcano plot of DEGs in the GSE18155 dataset.

[0042] Figure 3 This is a schematic diagram of the GO enrichment analysis results.

[0043] Figure 4 Venn diagrams of prognostic genes between GPL96 and GPL97 platforms in the GSE3218 and GSE10783 datasets.

[0044] Figure 5 This diagram illustrates the results of cross-intersection analysis between DEGs and prognostic genes to obtain the target prognostic gene.

[0045] Figure 6 This is a schematic diagram of the Kaplan-Meier survival analysis results for all cohorts with progression-free interval (PFI) and overall survival (OS) as the outcome events.

[0046] Figure 7 This is a schematic diagram of the Cox regression analysis results for PFI and OS in patients with TCGA-TGCT, GSE3218, and GSE10783.

[0047] Figure 8 This is a schematic diagram showing the results of immunohistochemical analysis of SMAD6 expression in normal testicular tissue and TGCT tissue.

[0048] Figure 9 This is a schematic diagram showing the SMAD6 IHC score results in TGCT tissue and normal testicular tissue.

[0049] Figure 10 This represents the area under the ROC curve of SMAD6.

[0050] Figure 11 This is a schematic diagram of the GO enrichment analysis results using the GSEA algorithm.

[0051] Figure 12 The top 10 activated pathways are sorted by normalized enrichment score (NES).

[0052] Figure 13 The top 10 suppressed pathways are sorted by NES.

[0053] Figure 14 This is a schematic diagram showing the correlation between immune cell infiltration score and SMAD6 expression.

[0054] Figure 15 SMAD6 expression and CD8 + Scatter plot showing the correlation between T cell infiltration levels.

[0055] Figure 16 Kaplan-Meier survival curves between SMAD6 expression subgroups in the immunotherapy datasets (GSE135222 and GSE100797).

[0056] Figure 17 ROC curves for the immunotherapy datasets (GSE135222 and GSE100797).

[0057] Figure 18 This is a schematic diagram showing the results of immunohistochemical analysis of CD8 expression in seminoma patients with different SMAD6 expression levels.

[0058] Figure 19 This is a schematic diagram of the Spearman correlation analysis results between SMAD6 and CD8.

[0059] Figure 20 This is a schematic diagram showing the FMG analysis results for the SMAD6 low expression group and the high expression group.

[0060] Figure 21 This is a schematic diagram of the FMG analysis results for the wild-type and mutant SMAD6 groups.

[0061] Figure 22 This is a schematic diagram showing the variation frequency analysis results of the top 10 amplified and deleted chromosomal segments between the SMAD6 low expression group and the high expression group.

[0062] Figure 23 This is a schematic diagram showing the results of the differential expression analysis of SMAD6 in the first 10 amplified and deleted CNV chromosomal segments in the mutant and non-mutant groups. Detailed Implementation

[0063] To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention will be further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0064] Unless otherwise specified, all reagents used in this invention context are commercially available. The experimental methods used in this invention are conventional methods and techniques in the art. Representative results from biological experimental replicates are presented in the contextual figures, with data displayed as mean ± SD and mean ± SEM as specified in the figures. The R package (version 4.3.3) was used for statistical analysis and visualization of the data; some charts were generated by Sangerbox (http: / / vip.sangerbox.com / ). Spearman correlation coefficients were used for correlation testing. Kaplan-Meier analysis was performed using the "survival" R package. Wilcoxon rank-sum tests were applied to compare differences between the two groups. AUC values ​​were used to predict the accuracy of SMAD6. All p-values ​​were two-tailed, and values ​​less than 0.05 were considered statistically significant. The intracellular / in vivo expression level of SMAD6 can be detected using conventional methods in the art (e.g., PCR, Western blot, etc.). This invention has verified the specificity of the primer pairs (primer pair 1-primer pair 3) and antibody YT4338 described in this invention for detecting SMAD6 expression levels through specific experiments. Regarding the inhibition of SMAD6, this invention has also verified its ability to specifically inhibit SMAD6 expression levels using the designed shRNA (sequences shown in SEQ ID NO 7-9). However, given that the detection and inhibition of specific gene / protein expression levels are conventional methods in the art and not the main focus of this invention, the relevant detection results are not specifically presented in this invention. Those skilled in the art can perform detection and verification according to the experimental methods described in this invention or other conventional methods in the prior art as needed. In addition to the primer pairs, antibodies, and shRNAs listed in this invention, those skilled in the art can also design relevant primer pairs / antibodies and shRNAs based on the SMAD6 gene sequence and / or protein structure, or obtain commercially available reagents to detect or inhibit SMAD6 expression levels. Therefore, the specific information on primer pairs, antibodies, shRNAs, etc., listed in the context of this invention does not constitute a limitation on the actual scope of protection of this invention.

[0065] Example 1

[0066] First, five independent TGCT cohorts were obtained from the GEO database (http: / / www.ncbi.nlm.nih.gov / geo / ), namely GSE18155, GSE3218 (GPL96, GPL97), and GSE10783 (GPL96, GPL97). The raw data obtained from GEO were processed using the robust multi-array average (RMA) algorithm from the “affy” R package 14. The GSE18155 cohort (n=28) was analyzed to investigate differential expression between normal testicular samples and tumor samples. PCA results showed significant differences between normal testicular samples and tumor samples in GSE18155 (see [link to PCA results]). Figure 1 ).

[0067] Subsequently, differentially expressed genes (DEGs) were identified using the aforementioned cohort. Differential gene analysis was performed using the "limma" R package (version 3.58.1) to screen for DEGs between normal testicular and tumor samples. The threshold for DEGs was set to |log2 FC| > 1, p < 0.05. The results showed that a total of 2486 differentially expressed genes were identified in this cohort, including 1710 downregulated DEGs and 776 upregulated DEGs (see [link to relevant documentation]). Figure 2 ).

[0068] To investigate the biological functions of these DEGs in TGCT, GO enrichment analysis was performed on upregulated and downregulated DEGs using the "clusterProfiler" R package (version 4.10.0) to analyze their biological processes, cellular components, and molecular functions. Pathways with p < 0.05 were considered statistically significant. The results showed that upregulated DEGs were mainly enriched in collagen-containing extracellular matrix, regulation of cell-cell adhesion, and regulation of leukocyte-cell adhesion, while downregulated DEGs were mainly enriched in cellular processes of multicellular reproduction, spermatocyte differentiation, spermatogenesis, and ciliary motility (see [link to relevant documentation]). Figure 3 The above results indicate that these genes may be involved in the development and progression of tumors, as well as the biological processes of cancer cell proliferation, migration, and invasion.

[0069] Example 2

[0070] To investigate prognostic genes in TGCT, univariate Cox regression analysis was first performed on five cohorts, including TCGA-TGCT, GSE3218 (GPL96, GPL97), and GSE10783 (GPL96, GPL97), using the "survival" R package (version 3.5.8) to screen for genes associated with progression-free survival (PFI) and overall survival (OS). For comprehensive screening of prognostic genes, prognostic genes screened from the GSE3218 dataset from two different platforms were integrated; the same method was applied to the GSE10783 dataset. The threshold for prognostic genes was set to hazard ratio (HR) > 1 or < 1, with p < 0.05. GSE3218 identified 2900 prognostic genes, and GSE10783 identified 3699 prognostic genes (see [link to relevant documentation]). Figure 4 ). Figure 5 The study presented genes associated with OS in the GSE10783 cohort, genes associated with OS in the GSE3218 cohort, genes associated with PFI in the TCGA cohort, and DEGs in the GSE18155 cohort. By intersecting these four gene sets, a differentially expressed gene closely related to prognosis, SMAD6, was ultimately identified.

[0071] To investigate the prognostic value of SMAD6 in patients with TGCT, patients were divided into high-SMAD6 expression and low-SMAD6 expression groups based on the optimal cut-off value determined by the "survminer" R package (vers ion 0.4.9). Kaplan-Meier survival analysis, as well as univariate and multivariate Cox regression analyses, were then used to assess the prognostic value of SMAD6. Results showed that in survival analysis across all cohorts, higher SMAD6 expression was significantly associated with shorter prognostic free fraction (PFI) and overall survival (OS) (see [link to relevant documentation]). Figure 6 (p < 0.0001). Univariate and multivariate Cox regression analyses showed that SMAD6 not only played a significant role in predicting OS and PFI, but also remained an independent prognostic factor for TGCT patients after adjusting for other clinical characteristics (see [link to relevant documentation]). Figure 7 ).

[0072] Example 3

[0073] First, clinical samples were used to validate the expression level of SMAD6. Given the large proportion of seminomas in TGCT, representative seminoma samples were selected for testing. IHC staining of testicular tissues (8 normal testicular tissues and 33 seminoma tissues) was performed using an anti-SMAD6 antibody (ProteinTech Group, Inc., YT4338) to assess the difference in SMAD6 expression between normal and tumor tissues. The staining percentage scoring criteria were: 0 (<5%), 1 (5–25%), 2 (25–50%), 3 (50–75%), 4 (>75%); the staining intensity scoring criteria were: 0 (negative), 1 (weakly positive), 2 (moderately positive), 3 (strongly positive). The IHC score was derived by summing the percentage of positive cells and the staining intensity score. Subsequently, receiver operating characteristic (ROC) curves and the area under the ROC curve (AUC) were used to estimate the predictive accuracy of SMAD6. A higher AUC value indicated better accuracy. Generally, an AUC > 0.7 indicates good predictive performance. The results showed that SMAD6 expression levels in seminoma tissue were significantly higher than in normal testicular tissue, and it was mainly localized in the cytoplasm (see [link to study]). Figure 8 The SMAD6IHC score in seminoma tissue was significantly higher than that in normal testicular tissue (see [link]). Figure 9 The ROC curve showed that SMAD6 protein had a good ability to distinguish between normal testicular tissue and seminoma tissue (AUC = 0.91). Figure 10 The above results indicate that there are significant differences in the expression levels of SMAD6 protein between normal testicular tissue and tumor tissue, and that SMAD6 has good predictive performance for testicular germ cell tumors.

[0074] To explore the biological characteristics of SMAD6, a GSEA analysis was subsequently performed (see [link to GSEA analysis]). Figure 11 Based on the absolute value of the Normalized Enrichment Score (NES), the top 10 activated and inhibited pathways were selected. Activation of pathways associated with tumor progression was observed, including epithelial-mesenchymal transition (EMT) and mesenchymal cell differentiation (see [link to relevant documentation]). Figure 12 And immune-related pathways are suppressed, including MHC protein complexes, lymphocyte-mediated immunity, natural killer cell-mediated immunity, B cell receptor signaling pathways, etc. (see...) Figure 13 These results indicate that SMAD6 may activate pathways associated with tumor cell proliferation and inhibit processes associated with antigen presentation and immune cell activation, demonstrating its crucial role in the progression of TGCT and the immune microenvironment.

[0075] Based on the GSEA results, it is clear that SMAD6 expression level is closely related to tumor immune-related pathways. To further investigate this finding, the correlation between SMAD6 expression and immune-infiltrating cells in TGCT was analyzed using various algorithms (see [link to GSEA results]). Figure 14 Analysis results of four algorithms show that SMAD6 expression is similar to CD8. + A significant negative correlation was found between T cell immune infiltration scores (see [link]). Figure 15 These results suggest that SMAD6 may inhibit CD8 in the tumor microenvironment. + T-cell infiltration leads to a poor prognosis in patients with TGCT.

[0076] Given the potential association between SMAD6 and the tumor immune microenvironment, to assess the predictive value of SMAD6 for immunotherapy response, a survival analysis was further performed on patients in two cohorts, GSE135222 and GSE100797, who received anti-PD-L1 immunotherapy and CAR-T therapy, respectively. The results showed that patients in the SMAD6 low expression group had a better prognosis after receiving immunotherapy (see [link to study]). Figure 16 The ROC curves demonstrate that SMAD6 performs well in predicting responses to immunotherapy (see [link]). Figure 17 These results suggest that patients with low SMAD6 expression may achieve better outcomes with anti-PD-L1 immunotherapy and CAR-T therapy.

[0077] Example 4

[0078] To study SMAD6 and CD8 +The relationship between T cells was investigated using IHC staining to observe CD8 expression in tumor tissues at different SMAD6 expression levels, and Spearman correlation analysis was used to assess the correlation between SMAD6 and CD8 expression. Specifically, the degree of immune cell infiltration in TGCT samples was quantified using the "IOBR" R package (version 0.99.8). First, GSE3218 and GSE10783 samples were merged into the GSE3218_10783 cohort after batch effect removal, and normal samples were excluded. Then, the data from the TCGA-TGCT and GSE3218_10783 cohorts were analyzed using TIMER, EPIC, MCPcounter, xCell, and CIBERSORT algorithms, ultimately obtaining 22 immune cell infiltration scores. Simultaneously, Spearman correlation analysis was used to explore the correlation between SMAD6 gene expression and various immune cell infiltration levels. In addition, data from GSE135222 and GSE100797, cohorts that received anti-PD-L1 immunotherapy and CAR-T therapy, respectively, were extracted from the BEST database. Kaplan-Meier survival analysis and ROC curve analysis were then used to evaluate the prognostic and efficacy predictive value of SMAD6 in immunotherapy.

[0079] Immune infiltration analysis revealed that SMAD6 may inhibit tumor CD8. + T cell infiltration. Therefore, this finding was validated by comparing the expression levels of SMAD6 and CD8 in seminoma samples. IHC staining showed that CD8 expression was significantly reduced in samples with high SMAD6 expression compared to seminoma samples with low SMAD6 expression (see [link to study]). Figure 18 Furthermore, Spearman correlation analysis showed a significant negative correlation between SMAD6 and CD8 expression (r = -0.61, p = 1.7e-4) (see [link to study]). Figure 19 ).

[0080] Subsequently, the role of SMAD6 in TGCT was investigated from a multi-omics perspective. Specifically, the mutation frequencies of the top 10 most frequently mutated genes in the TCGA-TGCT cohort were analyzed in the SMAD6 high- and low-expression groups using the "maftools" (version 2.18.0)21 and "ComplexHeatmap" (version 2.16.0) R packages. Simultaneously, the copy number variation (CNV) landscape of the top 10 amplified and deleted chromosomal segments in TCGA-TGCT was mapped using the "ComplexHeatmap" R package. Then, the differences in high-frequency mutated genes (FMGs) and CNVs between the SMAD6 high- and low-expression groups were compared using the chi-square test. The results showed that the mutation frequencies of KIT and KRAS were significantly higher in the SMAD6 low-expression group (see [link to relevant documentation]). Figure 20 Significant differences in SMAD6 expression were observed between the mutant and wild-type groups of KIT and KRAS (see [link to relevant documentation]). Figure 21 ).

[0081] Furthermore, the CNV status of the top 10 amplified and deleted chromosomal segments was compared between the high-expression and low-expression SMAD6 groups using the Wilcoxon test to assess the correlation between these 10 gene mutation states and the CNV status of the 10 amplified and deleted chromosomal segments with SMAD6 expression. The results showed that amplifications of 8q12.1, 8q11.23, and 8q23.3, and deletions of 11q12.2 and 11p15.5, had higher mutation frequencies in the low-expression SMAD6 group (see [link to original text]). Figure 22 SMAD6 expression levels also showed statistically significant differences between the amplified 8q12.1, 8q11.23, 8q13.3, and 8q23.3 groups, and between the deleted 11q12.2, 11p15.5 and the non-variant groups (see [link to relevant documentation]). Figure 23 ).

[0082] In summary, this invention, based on multicenter TGCT samples, identified a novel prognostic biomarker, SMAD6, through differential analysis, Cox regression, and survival analysis. Immunohistochemical staining was used to assess SMAD6 expression levels in normal testicular tissue and TGCT. Finally, the relationship between SMAD6 and biological characteristics, mutant landscape, immune cell infiltration, and immunotherapy response was investigated. This invention clarifies that SMAD6 is a risk factor for poor prognosis in TGC-T. Immunohistochemical results showed high expression of SMAD6 in TGCT tissues. GSEA indicated that SMAD6 is associated with activation of tumor-associated pathways and inhibition of immune-associated pathways. Furthermore, high SMAD6 expression is associated with lower CD8 levels. +T-cell infiltration is associated with lower SMAD6 expression, leading to better response to immunotherapy and longer survival after immunotherapy. This suggests that SMAD6 expression may influence the degree of immune cell infiltration and immunotherapy response in TGCT. By detecting SMAD6 expression levels in subjects, this invention can effectively predict the probability of developing TGCT; it can also predict tumor progression in TGCT patients, providing personalized treatment plans to improve clinical outcomes; and it can also provide reasonable prognostic assessments, offering rational and effective guidance for treatment and rehabilitation. This invention clarifies that SMAD6 can inhibit CD8+ in the TGCT microenvironment. + T-cell infiltration leads to poor prognosis. However, inhibiting SMAD6 expression can improve the efficacy of immunotherapy in TGCT patients, and the potential of SMAD6 expression levels as a predictor of immunotherapy response highlights its importance in personalized treatment strategies. This invention fully reveals the potential of SMAD6 as a biomarker for TGCT prognosis and immunotherapy response, providing new scientific evidence and theoretical basis for personalized treatment of TGCT.

[0083] The above detailed embodiments provide a specific description of the analytical methods involved in this invention. It should be noted that the above description is only intended to help those skilled in the art better understand the methods and ideas of this invention, and is not intended to limit the scope of the invention. Without departing from the principles of this invention, those skilled in the art can make appropriate adjustments or modifications to this invention, and such adjustments and modifications should also fall within the protection scope of this invention.

Claims

1. Application of reagents for detecting SMAD6 expression levels in the preparation of products for the auxiliary diagnosis of seminoma.

2. The application according to claim 1, characterized in that, The reagents for detecting SMAD6 expression levels include primers for detecting SMAD6 gene levels and / or reagents for detecting SMAD6 protein levels.

3. The application according to claim 2, characterized in that, The primers used to detect SMAD6 gene levels are selected from at least one of the following primer pairs: Primer pair 1: The upstream sequence is shown in SEQ ID NO: 1, and the downstream sequence is shown in SEQ ID NO: 2; Primer pair 2: The upstream sequence is shown in SEQ ID NO: 3, and the downstream sequence is shown in SEQ ID NO:

4.

4. The application according to claim 2, characterized in that, The reagent used to detect SMAD6 protein levels was selected from anti-SMAD6 antibodies.

Images