Editable cell line

Abstract

The present disclosure provides editable cell lines, including the use of gene editing proteins to produce the cell lines. The editable cell lines are capable of expressing antibody constant regions, which may act as a platform for antibody variable regions to produce customized antibodies.

Description

Technical Field

[0001] The present disclosure provides editable cell lines, including the use of gene editing proteins to produce the cell lines. By preparing editable cell lines, the editable cell lines have the ability to be further modified to produce the desired antibodies alone, which can reduce the cost and time of the antibody preparation process. Background Art

[0002] As clinical adoption of advanced antibody therapeutics begins to gain traction, more attention is turning to the underlying manufacturing strategies that will make these therapies available to patients worldwide. While antibody therapeutics hold great promise in the clinic, the high manufacturing cost relative to reimbursement is a significant barrier to commercialization.

[0003] One of the challenges facing antibody therapy is the multi-stage and complex preparation process to produce the desired antibodies. The current preparation process relies on the introduction of vectors to construct cell lines to express the gene of interest and obtain the desired antibody. This process requires the construction of vectors for each new antibody to be expressed, followed by gene introduction and pool recovery. This process further requires clonal selection to find high-yield clones, which is time-consuming, where each clone needs to be evaluated for stability and can lead to deviations and failures.

[0004] What is needed to overcome these challenges is a method to shorten and simplify the production process. Editable cell lines are able to express antibody constant regions, and can serve as a platform for antibody variable regions and remove the need for vector construction, and provide a reliable antibody production platform. The present invention meets these needs. Summary of the invention

[0005] In some embodiments, the present disclosure provides a cell comprising a genomic nucleic acid sequence, the genomic nucleic acid sequence comprising a first sequence, the first sequence encoding antibody heavy chain constant regions 1, 2 and 3, wherein the first sequence is not flanked by a sequence encoding an antibody heavy chain variable region, and a second sequence, the second sequence encoding an antibody light chain constant region 1, wherein the second sequence is not flanked by a sequence encoding an antibody light chain variable region.

[0006] In another embodiment, a method for producing editable cells is provided, the method comprising: providing a cell that stably expresses a genomic nucleic acid sequence of an antibody, the genomic nucleic acid sequence comprising a variable heavy chain region sequence, constant heavy chain region 1, 2 and 3 sequences, a variable light chain region sequence and a constant light chain region 1 sequence, excising a sequence encoding the variable heavy chain region with a gene editing protein, and excising the variable light chain region sequence with the gene editing protein.

[0007] Also provided herein is a method for preparing an editable cell that produces an antibody, the method comprising: providing a cell comprising a genomic nucleic acid sequence, the genomic nucleic acid sequence comprising a first sequence, the first sequence encoding antibody heavy chain constant regions 1, 2 and 3, wherein the first sequence is not flanked by a sequence encoding an antibody heavy chain variable region, and a second sequence, the second sequence encoding an antibody light chain constant region 1, wherein the second sequence is not flanked by a sequence encoding an antibody light chain variable region, introducing the sequence encoding the antibody heavy chain variable region into the cell; and introducing the sequence encoding the antibody light chain variable region into the cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 Schematic diagram showing how an intermediate headless antibody can be modified by introducing antibody variable regions to generate a desired custom antibody.

[0009] Figure 2A-2B An exemplary diagram of generating editable cells in which the antibody heavy chain variable region and the antibody light chain variable region are excised from the genomic antibody sequence is shown.

[0010] Figure 3 An exemplary representation of a genomic nucleic acid sequence into which a sequence encoding a gene editing protein is introduced is shown.

[0011] Figure 4 The knockout efficiency of various guide RNAs is shown.

[0012] Figures 5A-5C Shown are excision efficiencies determined by PCR, FACS, and NGS.

[0013] Figure 6 The editing efficiency of various guide RNAs is shown.

[0014] Figures 7A-7C Integration efficiency determined by PCR, FACS, and NGS.

[0015] Figure 8 Shown is the cell viability assessment performed using the Vi-Cell device.

[0016] Fig. 9 Shown are transfection efficiencies determined by PCR.

[0017] Figures 10A-10C Integration efficiency determined by PCR, FACS and NGS is shown.

[0018] Figures 11A-11B Shown are the light chain variable region knockout efficiencies of various gRNAs analyzed using TIDE (11A) and PCR validation of excision of the light chain variable region from existing antibodies (11B).

[0019] Figures 12A-12C Heavy chain variable region knockout efficiency of various gRNAs analyzed using TIDE (12A), PCR validation of heavy chain variable region excision from δVL antibody (12B), and PCR validation of heavy chain variable regions from existing antibodies (12C).

[0020] Fig.13 A schematic diagram of the generation of headless cell lines from a vector (BOB SSI) is shown.

[0021] Figures 14A-14B Recovery of cells after transfection with a vector to generate a headless cell line is shown (14A), and FACS analysis showing integration of the cassette into BOB cells using the SSI system is shown (14B).

[0022] Figures 15A-15C PCR validation of the headless cell line generation (15A), WB validation of the headless cell line generation (15B), and FACS analysis validation of the headless cell line generation (15C) are shown.

[0023] Fig.16 A schematic representation of the DNA template for heavy chain variable region-puromycin integration is shown.

[0024] Figures 17A-17B Recovery of cells after heavy chain variable region transfection and puromycin antibiotic selection is shown (17A) and PCR verification of integration of the heavy chain variable region is shown (17B).

[0025] Fig.18 A schematic representation of the DNA template for light chain variable region-blasticidin integration is shown.

[0026] Figures 19A-19B Shown is the recovery of cells after light chain variable region transfection and blasticidin antibiotic selection in δVH cells (19A) and PCR verification of integration of the light chain variable region in δVH cells (19B).

[0027] Figures 20A-20D Shown are successful transduction, selection, proliferation and cell banking of the inducible Cas9 BOB (SSI) cell line (20A), RT-PCR analysis showing Cas9 mRNA expression after induction with DOX (20B), ELISA analysis showing Cas9 protein expression after induction with DOX (20C), and WB showing Cas9 protein expression after induction with DOX (20D).

[0028] Figures 21A-21B PCR validation showing successful integration of the δVL iBOB cell line (21A) and FACS analysis validating successful integration of the δVL iBOB cell line (21B) are shown.

[0029] Fig. 21C PCR validation of seamless integration of the light chain variable region into δVL cells for production of intact antibodies in the iCas9 BOB cell line is shown. DETAILED DESCRIPTION

[0030] In the claims and / or the specification, use of the words "a / an" when used in conjunction with the term "comprising" may mean "one", but is also consistent with "one or more", "at least one", and "one or more than one".

[0031] Throughout this application, the term "about" is used to indicate that a value includes the inherent error variation of the method / device used to determine the value. Typically, the term is meant to encompass about or less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% variability, as the case may be.

[0032] Use of the term "or" in the claims is intended to mean "and / or" unless explicitly stated to refer to only alternatives or the alternatives are mutually exclusive, although the present disclosure supports definitions referring to only alternatives and to "and / or."

[0033] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, system, host cell, expression vector, and / or composition of the invention. In addition, the compositions, systems, cells, and / or nucleic acids of the invention can be used to implement any of the methods as described herein.

[0034] As described throughout, the subject of the present disclosure is an editable cell line that is stable in an embodiment and highly productive in another embodiment, capable of being further modified to produce a desired custom antibody individually. The editable cell line includes the use of a gene editing protein to further modify the genomic sequence encoding the headless antibody structure. The editable cell line may or may not express the headless antibody structure because the headless antibody structure is an intermediate. However, once the editable cell line is completely modified by the antibody variable region, the cell line can be expressed to produce a completely customized antibody protein.

[0035] As used herein, "headless antibody" refers to an antibody protein without antibody variable regions, but including constant heavy chain regions and light chain regions. The antibody variable region includes the heavy chain and light chain variable regions that define the antigen binding site of the antibody protein. See, e.g. Figure 1 , which shows a schematic representation of an antibody including heavy and light chain constant regions. The headless antibody structure can be modified and is only an intermediate into which antibody variable regions can be introduced to produce a custom antibody protein.

[0036] As used herein, "genomic nucleic acid" or "genomic sequence" means a nucleic acid that is integrated into the genome of a cell. The term "genome" refers to a complete set of genetic information in the chromosomes of a cell.

[0037] As used herein, "nucleic acid", "nucleic acid molecule" or "oligonucleotide" means a polymeric compound comprising covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, gRNA, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA or MIRNA.

[0038] As used herein, "gene" refers to an assembly of nucleotides encoding a polypeptide and includes cDNA and genomic DNA nucleic acid molecules. "Gene" also refers to a nucleic acid fragment that can serve as a regulatory sequence before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. In some embodiments, the gene is integrated with multiple copies. In some embodiments, the gene is integrated with a predefined copy number.

[0039] As used herein, "stable" means that cell lines can use conventional storage methods to maintain cell integrity, and cells can maintain the function of producing antibodies during multiple cell divisions. In an embodiment, cell lines described herein are stable cell lines. As used herein, "high yield" or "high expression" means producing the molecule of interest with an amount of at least about 1g / L. It is considered that the amount of high yield will depend on the molecule of interest produced, and can be about 2g / L, about 3g / L, about 4g / L, about 5g / L, about 6g / L, about 7g / L, about 8g / L, about 9g / L, about 10g / L, about 15g / L, about 20g / L or higher. In an embodiment, the cell provided herein is a stable high expression cell.

[0040] Figure 1 Schematic diagram showing how an intermediate headless antibody can be modified by introducing antibody variable regions to generate a desired custom antibody. Figure 1 In the present invention, the overlapping antibody structure represents what is encoded and produced by expressing the DNA sequence. Therefore, initially the sequence represents a headless antibody. Then the antibody variable region is introduced into the genome. Finally, the complete structure of the customized antibody is expressed. Various methods for generating such headless antibody structures are described herein.

[0041] The editable cell lines disclosed herein do not appropriately require the use of DNA vectors to introduce genetic sequences encoding antibodies produced by each antibody. A commonly used method for producing antibodies requires the use of recombinant DNA vectors, which are created, cloned, and introduced into host cells in each antibody production cycle. However, this general method depends on the random / semi-random integration of DNA vectors into host cells.

[0042] Editable cell lines can reduce the time and cost of commonly used antibody production methods by eliminating the need to generate DNA vectors, introducing the vectors into host cells, and selecting host cells with DNA vectors to produce antibodies. In the disclosed editable cell lines, the sequence encoding the headless antibody is integrated into the genomic sequence of the host cell. Therefore, once the editable cells are modified to produce complete antibodies, the cells can be selected and cloned to produce antibodies.

[0043] Editable cell lines can be generated by using existing cell lines that produce high levels of antibodies, in which the sequences encoding the variable regions of the antibodies are removed from the genomic sequence. The resulting cell lines still contain the sequences encoding the rest of the antibody structure, which is a headless antibody.

[0044] In some embodiments, provided herein is a method of generating an editable cell, wherein a sequence encoding a variable heavy chain region and a sequence encoding a variable light chain region are excised from a genomic sequence encoding a complete antibody that is suitably stable and, in embodiments, highly expressing in cells.

[0045] In some embodiments, a method for producing editable cells is provided herein, the method comprising: providing a cell stably expressing a genomic nucleic acid sequence of an antibody, the genomic nucleic acid sequence comprising a variable heavy chain region sequence, a constant heavy chain region 1, 2 and 3 sequence, a variable light chain region sequence and a constant light chain region 1 sequence, excising the sequence encoding the variable heavy chain region with a gene editing protein, and excising the variable light chain region sequence with the gene editing protein. In some embodiments, before excising the sequence encoding the variable light chain region, the sequence encoding the variable heavy chain region is excised with a gene editing protein. In some embodiments, before excising the sequence encoding the variable heavy chain region, the sequence encoding the variable light chain region is excised with a gene editing protein. In some embodiments, the sequence encoding the variable heavy chain region and the sequence encoding the variable light chain region are excised simultaneously.

[0046] Editable cell lines can also be generated by using targeting vectors encoding headless antibodies to integrate sequences into the genomic sequence of existing cells that produce high levels of antibodies. The resulting cells can be selected and cloned to generate cell lines capable of expressing headless antibodies and modified to produce complete antibodies.

[0047] In some embodiments, the present invention provides a method for producing editable cells, wherein a sequence encoding a headless antibody is integrated into the genomic sequence of a suitably stable and, in embodiments, highly expressed cell. In some embodiments, the sequence encoding the headless antibody is integrated into the genomic sequence of the cell by site-specific integration of a vector containing the sequence.

[0048] In some embodiments, a method for producing editable cells is provided herein, the method further comprising: before excision of the sequence encoding the variable heavy chain region and the variable light chain region, the sequence encoding the gene editing protein is introduced into the genomic nucleic acid sequence; and before excision of the variable heavy chain region and the variable light chain region, the gene editing protein is expressed. In some embodiments, a method for producing editable cells is provided herein, the method further comprising: before the excision of the sequence encoding the variable heavy chain region and the variable light chain region, a ribonucleoprotein (RNP) of a suitable gene editing protein is introduced. In some embodiments, a method for producing editable cells is provided herein, the method further comprising: before excision of the sequence encoding the variable heavy chain region and the variable light chain region, a plasmid containing a sequence encoding the gene editing protein is introduced into the cell; and before excision of the variable heavy chain region and the variable light chain region, a gene editing protein sequence is expressed in a plasmid.

[0049] As used herein, the terms "engineered nuclease," "engineered gene editing protein," or "gene editing protein" refer to a nuclease that has been isolated, modified, mutated, and / or altered from its native state as a nuclease. "Nuclease" refers to an enzyme that is capable of cleaving DNA and / or RNA molecules. By engineering the nuclease, the specific location of the cleavage can be designed and customized based on the desired cell type and / or gene of interest.

[0050] Exemplary engineered nucleases (produced by integrated genomic nucleic acid, virus or other non-genomic nucleic acid, or produced as RNP) that can be inserted into cells include, for example, large nucleases, methyltransferases, zinc finger nucleases, nucleases based on transcription activator-like effectors (TALENS), FokI nucleases and CRISPR-related (Cas) nucleases. In general, engineered nucleases use DNA binding proteins with the desired catalytic activity and the ability to bind to the desired target sequence in a manner similar to a restriction enzyme through protein-nucleic acid interactions. Examples include large-range nucleases, zinc finger nucleases (ZFNs) or transcription activator-like nucleases (TALENs) of naturally occurring or engineered rare sequence cutting enzymes, which contain FokI catalytic nuclease subunits connected to a modified DNA binding domain, and can each cut a predetermined sequence. In ZFN, the binding domain comprises an amino acid chain folded into a custom zinc finger domain. Similarly, in TALEN, 34 amino acid repeats derived from transcription factors are folded into a huge DNA binding domain. In the case of gene targeting, these enzymes can cut genomic DNA to form double-strand breaks (DSBs) or generate nicks, which can be repaired by one of two repair pathways, non-homologous end joining (NHEJ) or homologous recombination (HR). The NHEJ pathway may cause specific mutations, deletions, insertions, or substitution events. The HR pathway causes the targeted sequence to be replaced by the supplied donor sequence. An exemplary FokI and methyltransferase-based system is described in U.S. Pat. No. 10,220,052, the disclosure of which is incorporated herein by reference in its entirety.

[0051] The clustered regularly interspaced short palindromic repeats (CRISPR) and associated proteins (CRISPR-associated nucleases or Cas proteins) comprising the CRISPR-Cas system were first identified in selected bacterial species and form part of the prokaryotic adaptive immune system. See Sorek et al., "CRISPR-a widespread system that provides acquired resistance against phages in bacteria and archaea" Nature Review: Microbiology (Nat. Rev. Microbiol.) 6 (3) 181-6 (2008), which is incorporated herein by reference in its entirety. The CRISPR-Cas system is mainly classified into three types: type I, type II and type III. The main defining feature of the individual types is the various Cas genes used and the corresponding proteins encoded therein. The cas1 gene and cas2 gene appear to be universal across the three main types, while cas3, cas9 and cas10 are considered to be specific to type I, type II and type III systems, respectively. See, e.g., Barrangou, R. and Marraffini, LA, “CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity,” Mol. Cell. 54(2):234-44 (2014), which is incorporated herein by reference in its entirety.

[0052] Typically, CRISPR-Cas systems function by capturing short regions of invading viral or plasmid DNA and integrating the captured DNA into the host genome to form a so-called CRISPR array, which is spaced apart by repetitive sequences within the CRISPR locus. DNA is collected into the CRISPR array and subsequently transcribed and processed into RNA.

[0053] Depending on the bacterial species, the CRISPR RNA processing performed is also different. For example, in the type II system originally described in the bacterium Streptococcus pyogenes, the transcribed RNA is paired with a trans-activating RNA (tracrRNA) and then cut by RNase III to form a single CRISPR-RNA (crRNA). The crRNA is further processed after binding to the Cas9 nuclease to produce mature crRNA. The crRNA / Cas9 complex is then combined with a DNA containing a sequence complementary to the captured region (referred to as a protospacer). The Cas9 protein then cuts the two chains of the DNA in a site-specific manner, thereby forming a double-strand break (DSB). This provides a DNA-based memory, so that the virus or plasmid DNA is rapidly degraded when repeatedly exposed and / or infected.

[0054] Since its initial discovery, multiple groups have conducted extensive research on the potential applications of the CRISPR system in genetic engineering, including gene editing (Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity," Science 337(6096):816-21 (2012); Cong et al., "Multiplex genome engineering using CRISPR / Cas systems," Science 339(6121):819-23 (2013); and Mali et al., "RNA-guided human genome engineering via Cas9," Science 339(6121):823-26; each of which is incorporated herein by reference in its entirety). A major development is to use chimeric RNA to target Cas9 protein, which is designed around a single unit from a CRISPR array fused to tracrRNA. This will produce a single RNA species, referred to as a small guide RNA (gRNA), in which the sequence in the original spacer region is modified to target the Cas9 protein site-specifically. Considerable work has been done to understand the nature of the base pairing interaction between chimeric RNA and the target site and its tolerance to mismatches, which is highly relevant to predicting and evaluating off-target effects (see, for example, Fu et al., "Improving CRISPR-Cas nucleases using truncated guide RNAs", Nature Biotechnology 32 (3): 279-84 (2014), and supporting materials, the document is incorporated herein by reference in its entirety).

[0055] The CRISPR-Cas9 gene editing system has been successfully used in a variety of organisms and cell lines, and can use wild-type Cas9 protein to induce double-strand break formation, or can use a mutant protein called Cas9n / Cas9 D10A to cut a single DNA strand (see, for example, Mali et al., (2013) and Sander and Joung, "CRISPR-Cas systems for editing, regulating and targeting genomes", Nature Biotechnology 32(4): 347-55 (2014), each of which is incorporated herein by reference in its entirety). Although double-strand break (DSB) formation can lead to small insertions and deletions (indels) that may disrupt gene function, Cas9 wild-type and Cas9n / Cas9 D10A nickases can avoid indels (results of repair by non-homologous end joining) while stimulating endogenous homologous recombination mechanisms. Therefore, these systems can be used to insert DNA regions into the genome with high fidelity.

[0056] In some embodiments, there is provided herein a method for producing editable cells, wherein the gene editing protein used in the method for excising the variable region is a CRISPR-related gene editing protein. In a suitable embodiment, CRISPR-related (Cas) nuclease is a Cas9 nuclease, or may be other Cas nucleases (such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a), etc.). In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity, as disclosed in the U.S. Patent Application No. 2018-0319850, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the gene editing protein is a zinc finger nuclease. In some embodiments, the gene editing protein is a TALENS. In some embodiments, the gene editing protein is a FokI nuclease.

[0057] In addition to the Cas9 nuclease, Cas12, Cas13, Cas14 and MAD7 (Cas12a) nucleases can also be used in the methods described herein. Cas12 produces staggered cuts in dsDNA (5 nucleotides of 5' protruding end dsDNA breaks). Cas12 processes its own guide RNA, thereby improving multiplexing capabilities. Cas13t targets RNA, not DNA. Once it is activated by a ssRNA sequence complementary to its crRNA spacer, it releases nonspecific RNA enzyme activity and destroys all nearby RNAs, regardless of its sequence. See, for example, Yan et al., "CRISPR-Cas12 and Cas13: the lesser known siblings of CRISPRCas9", Cell Biology and Toxicology, pp. 1-4 (August 29, 2019), the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the Cas12i2 nuclease can also be used in the methods described herein, such as the methods disclosed in U.S. Pat. No. 10,808,245, the disclosure of which is incorporated herein by reference in its entirety.

[0058] In further embodiments, a method for producing an editable cell is provided herein, wherein a gene editing protein is used to excise a sequence from the genomic sequence of the cell. In some embodiments, excision of a sequence encoding a variable heavy chain region with a gene editing protein occurs at a first guide RNA target sequence and a second guide RNA target sequence; and excision of a variable light chain region sequence with a gene editing protein occurs at a third guide RNA target sequence and a fourth guide RNA target sequence. In some embodiments, the method further comprises introducing a first guide RNA and a second guide RNA. In some embodiments, the method further comprises introducing a third guide RNA and a fourth guide RNA. In some embodiments, the method further comprises introducing a guide RNA by a plasmid that transiently expresses the guide RNA.

[0059] Figure 2A-2B A method for generating editable cells by excising sequences encoding antibody variable regions from genomic antibody sequences is shown. VH represents a sequence encoding a variable heavy chain region, and VL represents a sequence encoding a variable light chain region of an antibody. CH1, CH2, and CH3 represent sequences encoding constant heavy regions 1, 2, and 3 of an antibody, respectively. L represents the sequence encoding the constant light region of the antibody. CMV represents an exemplary promoter sequence, and the arrow indicates the direction of gene expression. Figure 2AAs indicated, by using a gene editing protein to excise the sequence encoding the antibody variable region from the genomic sequence, the first gRNA and the second gRNA target sequence are appropriately targeted to excise VH, and the third gRNA and the fourth gRNA target sequence are targeted to excise VL. Figure 2B In the embodiment, the antibody is not expressed because the promoter region has been removed. In other embodiments, depending on the selection of the corresponding gene editing protein, no guide RNA sequence is required.

[0060] In some embodiments, there is provided herein a method for producing editable cells, wherein a sequence encoding a gene editing protein (genome integrated) is operably connected to an inducible promoter. By placing the gene editing protein under the control of an inducible promoter, the nuclease can remain dormant or silent before its desired use as a gene editing tool. In some embodiments, the inducible promoter is a TET-on system.

[0061] As used herein, "promoter", "promoter sequence" or "promoter region" refers to a DNA regulatory region / sequence that can bind RNA polymerase and initiate transcription of downstream coding or non-coding gene sequences. In other words, the promoter is operably combined or operably connected to the gene. As mentioned herein, the terms "in an operable combination", "in an operable order", "operably connected" and "operably linked" refer to nucleic acid sequences that are connected in a manner that produces a promoter that can guide the transcription of a given gene and / or the synthesis of a desired protein molecule. The term also refers to connecting amino acid sequences in a manner that produces a protein.

[0062] In some examples of the present disclosure, the promoter sequence includes a transcription start site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at a detectable level above background. In some embodiments, the promoter sequence includes a transcription start site and a protein binding domain responsible for binding RNA polymerase. Eukaryotic promoters will often, but not always, contain a "TATA" box and a "CAT" box.

[0063] Various promoters can be used to drive gene expression. In some embodiments, the promoter is an "inducible promoter", i.e., the promoter does not constitutively express any gene product as described herein and is activated in response to a specific stimulus that can be turned on or off, depending on the desired control of the gene under the control of the promoter. In other embodiments as described herein, the promoter is a constitutive promoter that initiates mRNA synthesis without being affected by external regulation.

[0064] Suitably, the promoter for controlling engineered nuclease is a derepressible promoter. As used herein, "derepressible promoter" refers to a structure comprising a functional promoter and other elements or sequences that can bind to a repressor element to cause functional promoter repression. "Repression" refers to the reduction or inhibition of promoter transcription initiation to downstream coding or non-coding gene sequences. "Repressor element" refers to a protein or polypeptide that can bind to a promoter (or near a promoter) to reduce or inhibit promoter activity. The repressor element can interact with a substrate or binding partner of the repressor element so that the repressor element undergoes a conformational change. This conformational change of the repressor element takes away the ability of the repressor element to reduce or inhibit the promoter, thereby causing "de-repression" of the promoter, thereby allowing the promoter to continue to initiate transcription. "Functional promoter" refers to a promoter that will be able to initiate transcription in the absence of a repressor element. Various functional promoters that can be used in the practice of the present invention are known in the art and include, for example, promoters of PCMV, PH1, P19, P5, P40, and adenovirus helper genes (e.g., E1A, E1B, E2A, E4Orf6, and VA).

[0065] Described herein are examples of various controllable promoters, including inducible promoters and derepressible promoters, and methods of inducing expression of Cas9 nuclease by introducing molecules that induce expression or derepress derepressible promoters.

[0066] Exemplary repressor elements and their corresponding binding partners that can be used as derepressible promoters are known in the art and include, for example, the cumate gene switch system (CuO operator, CymR repressor, and cumate binding partner) (see, e.g., Mullick et al., "The cumate gene-switch: a system for regulated expression in mammalian cells," BMC Biotechnology 6:43(1-18) (2006), the disclosure of which is incorporated herein by reference in its entirety, including the disclosure of the derepressible promoter system described therein) and the TetO / TetR system described herein (see, e.g., Yao et al., "Tetracycline Repressor, tetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells." Cells", Human Gene Therapy 9: 1939-1950 (1998), the disclosure of which is incorporated herein by reference in its entirety) and other systems. In exemplary embodiments, the derepressible promoter comprises a functional promoter and any two tetracycline operator sequences (TetO or TetO2). In such embodiments, the nucleic acid introduced into the T cell further comprises a tetracycline repressor protein to control the TetO derepressible system (TET-on system).

[0067] As described herein, the method may further include inducing the expression of CRISPR-related nucleases by activating an inducible promoter. In the case of an inducible promoter (such as 4HT inducible promoter, rapamycin inducible promoter, hormone response element or glutamate inducible promoter), by adding such as 4-hydroxytamoxifen (hydroxytamoxifen), rapamycin, hormone or glutamate inducible promoter respectively. In the case of a derepressible promoter (TetO sequence coupled with CMV promoter as described herein), doxycycline is added to remove repression, and gene (engineered nuclease) is allowed to be expressed by CMV promoter. Suitably, the nucleic acid molecule encoding Cas9 also encodes TetR repressor element, suitably in another promoter system, such as under the control of a constitutive promoter (such as hPGK promoter).

[0068] In another embodiment, the present invention provides a method for preparing a cell that produces an antibody, the method comprising: providing a cell as described herein, introducing a sequence encoding an antibody heavy chain variable region and a fifth guide RNA target sequence into a genomic nucleic acid sequence, and introducing a sequence encoding an antibody light chain variable region and a sixth guide RNA target sequence into a genomic nucleic acid sequence. In some embodiments, the sequence encoding the antibody heavy chain variable region and the fifth guide RNA target sequence are operably linked to a first sequence encoding antibody heavy chain constant regions 1, 2, and 3. In some embodiments, the sequence encoding the antibody light chain variable region and the sixth guide RNA target sequence are operably linked to a second sequence encoding an antibody light chain constant region 1.

[0069] In some embodiments, a method for preparing a cell producing an antibody is provided herein, the method further comprising introducing a sequence encoding an antibody heavy chain variable region and a fifth guide RNA target sequence upstream of a first sequence encoding an antibody heavy chain constant region 1, 2, and 3. In some embodiments, a method for preparing a cell producing an antibody is provided herein, the method further comprising introducing a sequence encoding an antibody light chain variable region and a sixth guide RNA target sequence upstream of a second sequence encoding an antibody light chain constant region 1. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody heavy chain variable region. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody light chain variable region. In some embodiments, the promoter sequence is operably connected to a sequence encoding an antibody heavy chain variable region. In some embodiments, the sequence encoding an antibody heavy chain variable region is operably connected to a first sequence encoding an antibody heavy chain constant region 1, 2, and 3. In some embodiments, the promoter sequence is operably connected to a sequence encoding an antibody light chain variable region. In some embodiments, the sequence encoding an antibody light chain variable region is operably connected to a second sequence encoding an antibody light chain constant region 1.

[0070] In some embodiments, the method further comprises introducing a sequence encoding a selectable marker.

[0071] As used herein, the term "selectable marker" or "selectable marker gene" refers to a gene introduced into a cell that confers a trait suitable for artificial selection. Universal selectable markers are well known to those of ordinary skill in the art. Drug selectable markers can be used, such as ampicillin / / carbenicillin, kanamycin, chloramphenicol, nourseothricin N-acetyl transferase, erythromycin, tetracycline, gentamicin, bleomycin, streptomycin, puromycin, hygromycin, blasticidin (blast) and G418. In other embodiments, selectable markers include, but are not limited to, human nerve growth factor receptor (detected with MAbs, as described in U.S. Pat. No. 6,365,373); truncated human growth factor receptor (detected with MAbs); mutant human dihydrofolate reductase (DHFR; a fluorescent MTX substrate is available); secretory alkaline phosphatase (SEAP; a fluorescent substrate is available); human thymidylate synthase (TS; confers resistance to the anticancer agent fluorodeoxyuridine); human glutathione S-transferase alpha (GSTA1; glutathione is conjugated to the stem cell selective alkylating agent busulfan; chemoprotective selectable marker); CD24 cell surface antigen in hematopoietic stem cells; human CAD gene that confers resistance to N-phosphono-L-aspartate (PALA); human multidrug resistance-1 (MDR-1; p-glycoprotein surface protein that can be selected by increased drug resistance or enriched by FACS); human CD25 (IL-2α; detectable by Mab-FITC); methylguanine-DNA methyltransferase (MGMT; selectable by carmustine); rhamnose; and cytidine deaminase (CD; selectable by Ara-C).

[0072] In some embodiments, a method for producing editable cells is provided herein, wherein the gene editing protein is a CRISPR-related gene editing protein. In a suitable embodiment, the CRISPR-related (Cas) nuclease is a Cas9 nuclease, or may be other Cas nucleases (such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a), etc.), in some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity. In some embodiments, the gene editing protein is a zinc finger nuclease. In some embodiments, the gene editing protein is a TALENS. In some embodiments, the gene editing protein is a FokI nuclease.

[0073] In some embodiments, a method for producing editable cells is provided herein, wherein a sequence encoding a gene editing protein is operably linked to an inducible promoter. By placing the gene editing protein under the control of an inducible promoter, the nuclease can remain dormant or silent before its desired use as a gene editing tool. In some embodiments, as described herein, the inducible promoter is a TET-on system.

[0074] In some embodiments, provided herein is a method for producing editable cells, the method further comprising introducing a first promoter operably linked to a sequence encoding a constant heavy chain region 1, and introducing a second promoter operably linked to a sequence encoding a constant light chain region 1.

[0075] As described herein, in an embodiment, the editable cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algae cell, or a plant cell. In a suitable embodiment, the cell is a Chinese hamster ovary (CHO) cell. Examples of CHO cells include, but are not limited to, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN, HD7876 BOB cells, which are GFP-positive CHO cells or CHO-derived cells. In some embodiments, the cell is a Chinese hamster ovary (CHO) cell.

[0076] In suitable embodiments, the cell is a human embryonic kidney (HEK) cell. In certain embodiments, the cell is selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, e.g., COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0077] In another embodiment, a cell is provided herein, comprising a genomic nucleic acid sequence comprising a first sequence encoding antibody heavy chain constant regions 1, 2, and 3, wherein the first sequence is not flanked by sequences encoding antibody heavy chain variable regions, and a second sequence encoding antibody light chain constant region 1, wherein the second sequence is not flanked by sequences encoding antibody light chain variable regions. See, e.g. Figure 2A and Figure 2B , which shows an embodiment in which the heavy chain region and the light chain region are located on the same genomic sequence. In an embodiment, the first sequence and the second sequence can be located in the same segment of the genomic DNA, including the same DNA strand. However, in other embodiments, the first sequence and the second sequence can be located on different DNA strands, including being located on a separate chromosome. In addition, the first sequence and the second sequence can be in any order.

[0078] In some embodiments, the cell further comprises a first promoter operably linked to the first sequence and a second promoter operably linked to the second sequence. In some embodiments, the cell further comprises a single promoter operably linked to the first sequence or the second sequence, and wherein the first sequence and the second sequence are operably linked to each other. In some embodiments, the first sequence and the second sequence do not have a promoter linked to the sequence.

[0079] In some embodiments, the cell further comprises a sequence encoding a gene editing protein. In some embodiments, the gene editing protein is a CRISPR-related gene editing protein. In a suitable embodiment, the CRISPR-related (Cas) nuclease is a Cas9 nuclease, or may be other Cas nucleases (such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a), etc.). In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity. In some embodiments, the gene editing protein is a zinc finger nuclease. In some embodiments, the gene editing protein is a TALENS. In some embodiments, the gene editing protein is a FokI nuclease. As described herein, the gene editing protein can be part of a genomic sequence, or may be a sequence provided separately (e.g., by a vector) or included as an RNP.

[0080] In some embodiments, the sequence encoding the gene editing protein is operably linked to an inducible promoter. By placing the gene editing protein under the control of an inducible promoter, the nuclease can remain dormant or silent before its desired use as a gene editing tool. In some embodiments, as described herein, the inducible promoter is a TET-on system.

[0081] Figure 3 An exemplary schematic diagram of a genomic sequence of an editable cell is shown, the genomic sequence comprising a first sequence and a second sequence and a sequence encoding a gene editing protein (e.g., Cas9 shown). The gene editing protein is appropriately operably linked to an inducible promoter, so that the gene editing protein can remain dormant prior to its desired use as a gene editing tool.

[0082] As described herein, the cell is suitably a eukaryotic cell. In certain embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algae cell or a plant cell. In a suitable embodiment, the cell is a Chinese hamster ovary (CHO) cell. The example of a CHO cell includes but is not limited to CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN or CHO derived cells. In certain embodiments, the cell is a Chinese hamster ovary (CHO) cell. In a suitable embodiment, the cell is a human embryonic kidney (HEK) cell. In some embodiments, the cell is selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, e.g., COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0083] Fig.13 Schematic diagram showing the generation of headless cell lines by site-specific integration of a vector encoding a headless antibody into the genomic sequence of a host cell. Fig.14A The recovery of cells after transfection with a vector to generate a headless antibody cell line is shown. As shown in the figure, the headless antibody sequence was successfully integrated into the genomic sequence, as the cell line treated with the vector showed increased cell viability compared to the control. Fig. 14B FACS analysis verifying cassette integration is shown.

[0084] Figures 15A-15C Additional validation of the successful generation of a headless antibody cell line from the vector is shown. Fig.15A Verification by PCR is shown, as indicated by a band at 515 bp for delta VL compared to 864 bp for the complete ab product and a band at 800 bp for delta VH compared to 1,222 bp for the complete antibody product. Fig. 15B Validation by Western blot is shown, as indicated by the band of intact antibody in the left column compared to the band of headless antibody in the right column. Fig. 15C Validation by FACS analysis is shown, where the headless antibody is expressed but does not bind to the CD20 antigen compared to the intact antibody.

[0085] In some embodiments, the cells further comprise a sequence encoding a selectable marker.

[0086] In some embodiments, a method for preparing a cell producing an antibody is provided herein, the method further comprising introducing a promoter operably connected to a sequence encoding an antibody heavy chain region and a promoter operably connected to a sequence encoding an antibody light chain region. In some embodiments, the method further comprises introducing a promoter operably connected to a sequence encoding an antibody.

[0087] In some embodiments, a method for preparing a cell producing an antibody is provided herein, the method further comprising introducing a first sequence encoding a first selectable marker and a second sequence encoding a second selectable marker. In some embodiments, the method further comprises selecting cells expressing the antibody using the first selectable marker. In some embodiments, the method further comprises selecting cells expressing the antibody using the second selectable marker. In some embodiments, the method further comprises selecting cells expressing the antibody using the first selectable marker and the second selectable marker. In some embodiments, the method further comprises expressing the antibody in the cell.

[0088] Methods for amplifying cells produced using the methods described herein are known in the art, as are methods for recovering antibodies produced thereby. Such methods include, for example, various column filtration methods, washing steps, and bead-based magnetic separation methods, etc.

[0089] It will be apparent to those skilled in the relevant art that other suitable modifications and adaptations may be made to the methods and applications described herein without departing from the scope of any embodiment.

[0090] It should be understood that although certain embodiments have been shown and described herein, the claims are not limited to the specific forms or arrangements of the parts described and shown. Illustrative embodiments have been disclosed in this specification, and although specific terms are employed, they are used in a general and descriptive sense only and not for the purpose of limitation. In view of the above teachings, modifications and variations to the described embodiments are possible. Therefore, it should be understood that the described embodiments may be practiced in a manner different from that specifically described.

[0091] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0092] Examples

[0093] Example 1: Selection of sgRNA for excision of light chain variable region from intact IgG

[0094] method

[0095] SSI cell subculture and sgRNA preparation

[0096] Site-specific integration (SSI) cells expressing intact IgG antibodies (see, e.g., WO 2020 / 072480) were cultured at 0.3 x 10 6 The cells were subcultured into Erlenmeyer shake-flasks of appropriate size (with CD-CHO medium supplemented with 6 mM L-glutamine) at a viable concentration of 10 cells / mL. These cells were cultured for no less than 4 days and no more than 4 weeks and had a viability of greater than 90% before transfection.

[0097] The sgRNA (TrueGuide synthetic sgRNA 3 nmol (Invitrogen, catalog number A35514)) was briefly centrifuged to collect the contents and resuspended to 100 μM in nuclease-free Tris-EDTA (TE) buffer to produce a stock solution. A 10 μM working solution was generated from this stock solution. All sgRNA solutions were stored at -20°C. The following 7 sgRNA sequences were prepared.

[0098]

[0099]

[0100] Nucleofection

[0101] General nucleofection conditions for each individual transfection were as follows:

[0102]

[0103] The Cas9 RNP complex mixture for each sgRNA sequence was prepared in 7 Eppendorf tubes by mixing 3.2 μl of Cas9 protein with 3.2 μl of 10 μM sgRNA. Three control mixtures were also prepared with 1 Eppendorf tube containing 3.2 μl of Cas9 protein and 3.2 μl of TE buffer and 2 Eppendorf tubes each containing 6.4 μl of TE buffer. The mixture was incubated at room temperature for 30-60 minutes.

[0104] By adding 10 7The cells were transferred to a new tube and centrifuged at 300 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing complete IgG antibodies for nuclear transfection. The cells were then resuspended in 736 μl of nuclear transfection solution (656 μl of SF solution and 144 μl of supplement 1). 73.6 μl of cells were added to each of the 10 Cas9 RNP complex mixtures.

[0105] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, wherein the Lonza 4D nucleofection unit is used to pulse the cells using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and then 80 μ l of 10 ml pre-warmed to 36.5 ° C are added and mixed with the CD-CHO culture medium supplemented with 6 mM L-glutamine. The final mixture of 20 μ l is transferred to a 96-well plate with 100 μ l of CD-CHO culture medium supplemented with 6 mM L-glutamine, maintained in an incubator at 36.5 ° C. The cells are then incubated for 48 hours at 36.5 ° C, 5% CO2 in a static incubator.

[0106] result

[0107] Transfection efficiency was evaluated using PCR and TIDE analysis. The results are shown in Figure 4 Based on the transfection efficiency evaluation, sgRNA#1 and sgRNA#7 were selected.

[0108] Example 2: Complete excision of the light chain variable region from intact IgG using the Cas9 RNP complex

[0109] method

[0110] SSI cells expressing intact IgG antibodies were subcultured in the same manner as described in Example 1. sgRNA #1 and sgRNA #7 were selected and prepared for nuclear transfection in the same manner as described in Example 1.

[0111] Prepare Cas9 RNP complex according to Table 1.

[0112] Table 1: RNP complexes

[0113]

[0114] The complexes were incubated at room temperature for 30-60 minutes.

[0115] By adding 7x 10 6The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing complete IgG antibodies for nuclear transfection. The cells were then resuspended in 492.8 μl of nuclear transfection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0116] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofection unit using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and then 80 μ l of 10 ml CD-CHO culture medium pre-warmed to 36.5 ° C are added and mixed. The final mixture of all 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5 ° C. The cells are then incubated for 48 hours at 36.5 ° C, 5% CO2 in a static incubator.

[0117] result

[0118] Evaluation of excision efficiency was determined using next generation sequencing (NGS) PCR and FACS. The results are shown in 5A-5C. PCR ( Figure 5A )、FACS( Figure 5B ) and NGS( Figure 5C ) evaluation showed clear and successful excision of the light chain variable region.

[0119] Example 3: Selection of sgRNA to seamlessly integrate the light chain variable region into IgG lacking the light chain variable region (δVL IgG)

[0120] method

[0121] SSI cells expressing δVL IgG antibody were subcultured in the same manner as described in Example 1. sgRNA (TrueGuide synthetic sgRNA 3 nmol (Invitrogen, catalog number A35514)) was prepared for nuclear transfection in the same manner as described in Example 1. The following 3 sgRNA sequences were prepared.

[0122]

[0123] Prepare Cas9 RNP complex according to Table 2.

[0124] Table 2: RNP complexes

[0125]

[0126]

[0127] The complexes were incubated at room temperature for 30-60 minutes.

[0128] By adding 2 x 10 of each cell type (δVL T1 and T2) 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing δVL antibodies (δVL T1 and T2) for nuclear transfection. The cells were then resuspended in 588.8 μl of nuclear transfection solution (1200 μl of SF solution prepared by mixing 984 μl of SF solution with 216 μl of supplement 1). 73.6 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0129] 20 μl of cell-nucleofection solution-RNP complex mixture is transferred to a cuvette in a nucleofection 16-well strip, where cells are pulsed using a Lonza 4D nucleofection unit using program DU-158. After nucleofection, cells are placed in a nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml CD-CHO culture medium pre-warmed to 36.5°C is added and mixed. The final mixture of 20 μl is transferred to a 96-well plate with 100 μl of CD-CHO culture medium, maintained in an incubator at 36.5°C. The cells are then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0130] result

[0131] Transfection efficiency was evaluated using PCR and NGS. Figure 6 Medium. Based on the transfection efficiency assessment, sgRNA #9 was selected.

[0132] Example 4: Seamless integration of the light chain variable region into an IgG lacking the light chain variable region (delta VL IgG)

[0133] method

[0134] SSI cells expressing δVL IgG antibodies were subcultured in the same manner as described in Example 1. sgRNA #9 was selected and prepared for nuclear transfection in the same manner as described in Example 1. 100 μg of the light chain variable region DNA template was briefly centrifuged to collect the contents and resuspended with 25 μl of TE buffer to obtain a concentration of 4 μg / μl.

[0135] Prepare Cas9 RNP complex according to Table 3.

[0136] Table 3: RNP complexes

[0137]

[0138] The complexes were incubated at room temperature for 30-60 minutes.

[0139] By combining 17x 10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing δVL antibodies for nuclear transfection. The DNA template according to Table 3 was added to the appropriate Cas9 RNP complex prepared. The cells were then resuspended in 1196.8 μl of nuclear transfection solution (1250 μl of SF solution prepared by mixing 1025 μl of SF solution with 225 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0140] 20 μl of cell-nucleofection solution-RNP complex mixture is transferred to a cuvette in a nucleofection 16-well strip, where cells are pulsed using a Lonza 4D nucleofection unit using program DU-158. After nucleofection, cells are placed in a nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml CD-CHO culture medium pre-warmed to 36.5°C is added and mixed. The final mixture of 100 μl is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5°C. The cells are then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0141] result

[0142] Integration efficiency was assessed using PCR and TIDE assays. The results are shown in Figures 7A-7C PCR( Fig. 7A )、FACS( Figure 7B ) and NGS( Figure 7C ) evaluation showed that the light chain variable region was clearly and successfully integrated into cells expressing the delta VL antibody.

[0143] Example 5: Generation of inducible Cas9 single-site integrated CHO cells

[0144] method

[0145] Prepare transduction medium by diluting polybrene from a stock solution (10 mg / mL) to a final concentration of 10 μg / mL (1:1000 dilution factor) and divide it into 6 mL and 3 mL of Tube 1 and Tube 2, respectively. Then add Edi-R inducible lentiviral hEF1a-Blast-Cas9 lentiviral nuclease particles to Tube 2. The volume of lentiviral particles to be added is determined by the following equation:

[0146] V=MOI×CN÷VT×1000

[0147] in:

[0148] V = volume of lentiviral stock in μL

[0149] MOI = desired multiplicity of infection

[0150] CN = number of cells in the well at the time of transduction

[0151] VT = lentiviral titer in TU / mL and multiplied by 1000 to convert volume from mL to μL.

[0152] Based on the desired MOI of 1 and a cell density of 0.1 x 10 6 cells / well and 1×10 7 TU / mL of lentiviral titer, and calculate 25 μL of lentiviral stock solution per well.

[0153] Prepare 0.6 x 10 in tube A and 0.6 x 10 in tube B. 6 cells and 0.3x10 6 CHO cells of 10 cells were centrifuged at 200 g for 5 minutes. The cells were then resuspended with the transduction medium prepared as described above so that the contents of tube 1 were added to tube A to contain cells without lentiviral particles, and tube 2 was added to tube B to contain cells with lentiviral particles. These cells were seeded into 12-well plates according to the plate layout of Table 4, with 1 ml in each well, and incubated at 37°C in a humidified CO2 incubator for 24 hours.

[0154] Table 4: Plate layout for cell seeding

[0155]

[0156] After 24 hours, the contents of each well were centrifuged at 200 g for 5 minutes to remove the medium and resuspended with 1 ml of pre-warmed CD-CHO / 6 mM L-glutamine medium prepared by adding 10 μL of polybrene to 10 mL of CD-CHO / 6 mM L-glutamine and seeded in a new plate with 1 ml in each well according to the plate layout of Table 4. The cells were incubated at 37°C in a humidified CO2 incubator for 72 hours.

[0157] After 72 hours, transduced cells were selected using selection medium containing blasticidin at a concentration of 5 μg / mL. Cells were subcultured as needed, and blasticidin was added to appropriate wells each time.

[0158] result

[0159] The cell viability was assessed using the Vi-Cell device. The results are shown in Figure 8 The cell viability results clearly show the successful transduction of inducible Cas9 HD7876 Bob cells by Edi-R inducible lentiviral hEF1a-Blast-Cas9 lentiviral nuclease particles.

[0160] Example 6: Generation of an inducible Cas-SSI cell line expressing an IgG antibody lacking its VL domain

[0161] method

[0162] iCas CHO host cells were cultured at 0.3 x 10 6 The cells were subcultured into appropriately sized Erlenmeyer shake flasks (with CD-CHO medium supplemented with 6 mM L-glutamine) at a viable concentration of 10 cells / mL. These cells had been cultured for no less than 4 days and no more than 4 weeks and had a viability of greater than 90% prior to transfection.

[0163] According to Table 5, the purified δVL (eCHO-1) plasmid containing the gene of interest and the pMF35 plasmid containing the FlpE recombinase expression cassette were mixed in a DNase-free sterile tube and the volume was adjusted to 100 μL using TE buffer.

[0164] Table 5: Plasmid mixture preparation

[0165]

[0166] 100 μL of the plasmid mixture from Table 5 was transferred to a 0.4 cm electroporation cuvette (per transfection), to which 0.8 ml of iCas CHO host cells were added, prepared and resuspended in 6.4 ml CD CHO / 6 mM L-glutamine medium. Cells were electroporated by delivering a single exponential decay pulse of 300 V, 900 μF.

[0167] The contents of the cuvette were transferred to each of the 20 mL of CD CHO / 6 mM L-glutamine medium added to six T75 flasks and pre-warmed to 36.5° C. in a humidified static CO 2 incubator. The flasks were incubated in a humidified static CO 2 incubator for 24 hours.

[0168] After 24 hours, replace the medium in each flask with 20 ml pre-warmed CD CHO medium. Cultivate and subculture the cells.

[0169] result

[0170] Transfection efficiency was evaluated using PCR. The results are shown in Fig. 9 PCR evaluation showed that δVL was clearly and successfully integrated into iCas HD7876 Bob host cells to generate an inducible Cas-SSI cell line.

[0171] Example 7: Seamless integration of the light chain variable region into an inducible Cas-SSI cell line expressing an IgG antibody lacking its VL domain

[0172] method

[0173] SSI cells expressing δVL IgG antibody were cultured at 0.3 x 10 6 The cells were subcultured into Erlenmeyer shake flasks of appropriate size (CD-CHO medium and blasticidin at a final concentration of 5 μg / mL) at a feasible concentration of 1 cell / mL. One day before transfection, doxycycline at a final concentration of 2.5 μg / mL was added to the cell culture. sgRNA # 9 was selected and prepared for nuclear transfection in the same manner as described in Example 1. 100 μg of light chain variable region DNA template was briefly centrifuged to collect the contents and resuspended with 25 μl of TE buffer to obtain a concentration of 4 μg / μl.

[0174] Prepare Cas9 RNP complex according to Table 6.

[0175] Table 6: RNP complexes

[0176]

[0177] The complexes were incubated at room temperature for 30-60 minutes.

[0178] By placing 8x 10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing δVL antibodies for nuclear transfection. The DNA template according to Table 6 was added to the appropriate Cas9 RNP complex prepared. The cells were then resuspended in 563.2 μl of nuclear transfection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0179] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to a cuvette in a 16-well nucleofection strip, where cells are pulsed using a Lonza 4D nucleofection unit using program DU-158. After nucleofection, cells are placed in a nucleofection cuvette for 10 minutes, and then 80 μ l of 10 ml of CD-CHO culture medium containing doxycycline at a final concentration of 2.5 μ g / mL pre-warmed to 36.5 ° C are added and mixed. The final mixture of 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium containing blasticidin at a final concentration of 5 μ g / mL, maintained at 36.5 ° C incubator. The cells are then incubated in a static incubator at 36.5 ° C, 5% CO2 for 48 hours.

[0180] result

[0181] Integration efficiency was assessed using PCR and TIDE assays. The results are shown in Figures 10A-10C PCR( Fig. 10A )、FACS( Fig. 10B ) and NGS( Fig. 10C ) evaluation showed that the light chain variable region was clearly and successfully integrated into cells expressing the delta VL antibody.

[0182] Example 8: Seamless integration of heavy chain variable regions and light chain variable regions into a headless IgG antibody

[0183] method

[0184] SSI cells expressing headless IgG antibody were cultured at 0.3 x 10 6The viable concentration of cells / mL was subcultured into Erlenmeyer shake flasks of appropriate size (CD-CHO medium and blasticidin at a final concentration of 5 μg / mL). The day before transfection, doxycycline at a final concentration of 2.5 μg / mL was added to the cell culture. sgRNA #9 was selected and prepared for nuclear transfection. 100 μg of the DNA template consisting of both the VL domain and the VH domain was briefly centrifuged to collect the contents and resuspended with 25 μl of TE buffer to obtain a concentration of 4 μg / μl.

[0185] Prepare Cas9 RNP complex according to Table 7.

[0186] Table 7: RNP complexes

[0187]

[0188]

[0189] The complexes were incubated at room temperature for 30-60 minutes.

[0190] By placing 8x 10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing headless IgG antibodies for nuclear transfection. The DNA template according to Table 7 was added to the appropriate Cas9 RNP complex prepared. The cells were then resuspended in 563.2 μl of nuclear transfection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0191] 20 μl of cell-nucleofection solution-RNP complex mixture is transferred to a cuvette in a 16-well nucleofection strip, where cells are pulsed using a Lonza 4D nucleofection unit using program DU-158. After nucleofection, cells are placed in a nucleofection cuvette for 10 minutes, and 80 μl of 10 ml of doxycycline pre-warmed to 36.5°C are added and mixed. The final mixture of 100 μl is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium containing blasticidin at a final concentration of 5 μg / mL, maintained at 36.5°C in an incubator. The cells are then incubated for 48 hours at 36.5°C, 5% CO2 in a static incubator.

[0192] result

[0193] Integration efficiency was assessed using PCR, NGS, FACS analysis, and Western blot analysis.

[0194] General Materials and Methods

[0195] SDS-PAGE and western blotting

[0196] Cell culture supernatant (CCS) was collected and centrifuged at 3,500xg for 10 minutes. Protein concentration was determined using a BCA protein assay kit (Sigma Aldrich No. 71285-3). Protein extract (30 μg) was mixed with 4x Laemmli protein sample buffer (Biorad No. 1610747), incubated at 75°C for 15 minutes, and resolved according to its molecular weight using a MP TGX 4-20% 12-well SDS page gel in Tris / glycine / SDS buffer x1 (Biorad No. 4561095). Gel was run at room temperature at 120V until appropriate separation was achieved.

[0197] The protein was then transferred to a nitrocellulose membrane using the Trans-Blot Turbo transfer system (Bio-Rad No. 1704158). The membrane was then blocked at room temperature in PBS-T (0.1% Tween) containing 5% BSA for 1 hour, and then incubated at room temperature for 1 hour with the designated antibody (goat anti-human IgG Fc (HRP) ab97225) diluted in PBS-T containing 5% BSA. Next, the membrane was subjected to 3-5 washes with PBS supplemented with 0.2% Tween. Finally, the membrane was developed using a bright imaging system (rhenium) using Immobilon Forte Western HRP substrate (Sigma Aldrich No. WBLUF0100).

[0198] DNA extraction and PCR amplification

[0199] Genomic DNA was extracted using Quick Extract DNA Extraction Solution (Danyel Biotech No. QE09050) according to the manufacturer's instructions and quantified using a NanoDrop One / OneC micro-volume UV-Vis spectrophotometer (ThermoFisher) at 100 ng / PCR reaction. Primers were designed using SnapGene with a CG content of approximately 50% and a melting temperature below 60°C (Table 8). PCR was performed using the Proflex PCR system (ThermoFisher Scientific) using Hot Start Flex 2X Master Mix (New England Biolabs No. M0536S). PCR products were loaded into 1xTAE (Biological Industries No. 18701A) containing 1% agarose gel (1% agarose (Sigma Aldrich No. A9539)) and subjected to electrophoresis.

[0200] Table 8. PCR primers

[0201]

[0202]

[0203] Flow cytometry

[0204] Electroporation cells / cell culture supernatants (CCS) were examined by flow cytometry to determine cell line generation, VL / VL excision and integration efficiency. All flow cytometry experiments were performed on a CytoFLEX S flow cytometer (Beckman coulter), and CytExpert 2.4 software was used to analyze the acquired immunofluorescence data.

[0205] For cell line generation verification, cells were collected in 96-well U-shaped microplates, washed twice in FACS buffer (DPBS containing 2% w / v bovine serum albumin (Sigma-Aldrich No. 810533) and 0.09% v / v sodium azide (Sigma-Aldrich No. 08591), centrifuged at 400 rpm for 3 minutes, and analyzed using FACS. GFP-positive cells were detected using the GFP channel (488 / 525-40) on a CytoFLEX S flow cytometer.

[0206] CCS was collected from cells at a concentration of 5 million cells / mL, centrifuged at 3500x g for 10 minutes, and frozen at (-80°C). For excision and integration, 0.5 μl / well of Dynabead protein A for immunoprecipitation (Invitrogen, catalog number: 10001D) was added to each 96-well plate and washed twice with assay buffer (PBS containing 0.1% BSA, 0.2 μM filtration). 200ul of CCS was added to each well, incubated for 30 minutes at room temperature with gentle rotation, and washed three times with assay buffer. Afterwards, 0.525ug / well of biotinylated human CD20 protein, His, Avitag (Acro Biosystems, catalog number: CD0-H82E5) was added to the assay buffer, incubated for 30 minutes at room temperature with gentle rotation, and washed three times with assay buffer. Then, Alexa Flour 488 conjugated streptavidin catalog number 016-540-084 was diluted 1:50 in each well using assay buffer and incubated in the dark for 30 minutes at room temperature with gentle rotation. Then, Alexa Fluor 647 conjugated affinity pure F (ab) 2 fragment goat anti-human IgG (H + L) (Jackson Immune Research Laboratory, catalog number: 109-606-088) was diluted to 1:250 in each well using assay buffer and incubated in the dark for 30 minutes at room temperature with gentle rotation. Finally, the beads were resuspended in 100ul of assay buffer and analyzed using FACS. AF488 was detected using a 488 / 525-40 filter and AF647 was detected using a 630 / 660-20 filter on a CytoFLEX S flow cytometer.

[0207] Example 9: Selection of sgRNA for excision of light chain variable region

[0208] method

[0209] SSI cell subculture and sgRNA preparation

[0210] Site-specific integration (SSI) cells expressing intact IgG antibodies (see, e.g., WO 2020 / 072480) were cultured at 0.3 x 10 6 The cells were subcultured into appropriately sized Erlenmeyer shake flasks (with CD-CHO medium) at a viable concentration of 10 cells / mL. These cells were cultured for no less than 4 days and no more than 4 weeks and had a viability of greater than 90% prior to transfection.

[0211] The sgRNA (TrueGuide synthetic sgRNA 3 nmol (Invitrogen, catalog number A35514)) was briefly centrifuged to collect the contents and resuspended to 100 μM in nuclease-free Tris-EDTA (TE) buffer to produce a stock solution. A 10 μM working solution was generated from this stock solution. All sgRNA solutions were stored at -20°C. The following 7 sgRNA sequences were prepared.

[0212] Wizard Name Sequence (5' to 3') sgRNA#1(eCHO1) GCCCCGAGACATGATCACGG(SEQ ID NO:1) sgRNA#2(eCHO2) CCGCCTCCGTGATCATGTCT(SEQ ID NO:2) sgRNA#3(eCHO3) GCCTCCGTGATCATGTCTCG(SEQ ID NO:3) sgRNA#4(eCHO4) CTTCGGCGGAGGCACCAAGC(SEQ ID NO:4) sgRNA#5(eCHO5) GCACCAAGCTGGAAATCAAG(SEQ ID NO:5) sgRNA#6(eCHO6) GAACACGGAGGGAGCGGCCA(SEQ ID NO:6) sgRNA#7(eCHO7) GCTGGAAATCAAGCGGACCG(SEQ ID NO:7)

[0213] Nucleofection

[0214] General nucleofection conditions for each individual transfection were as follows:

[0215]

[0216] Prepare the Cas9 RNP complex mixture for each sgRNA sequence described above in 7 Eppendorf tubes by mixing 3.2 μl of Cas9 protein with 3.2 μl of 10 μM sgRNA. Also prepare 3 control mixtures with 1 Eppendorf tube containing 3.2 μl of Cas9 protein and 3.2 μl of TE buffer and 2 Eppendorf tubes each containing 6.4 μl of TE buffer. Incubate the mixture at room temperature for 30-60 minutes.

[0217] By adding 10 7 The cells were transferred to a new tube and centrifuged at 300 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing complete IgG antibodies for nuclear transfection. The cells were then resuspended in 736 μl of nuclear transfection solution (656 μl of SF solution and 144 μl of supplement 1). 73.6 μl of cells were added to each of the 10 Cas9 RNP complex mixtures.

[0218] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, wherein the Lonza 4D nucleofection unit is used to pulse the cells using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and then 80 μ l of 10 ml pre-warmed to 36.5 ° C are added and mixed with the CD-CHO culture medium supplemented with 6 mM L-glutamine. The final mixture of 20 μ l is transferred to a 96-well plate with 100 μ l of CD-CHO culture medium supplemented with 6 mM L-glutamine, maintained in an incubator at 36.5 ° C. The cells are then incubated for 48 hours at 36.5 ° C, 5% CO2 in a static incubator.

[0219] result

[0220] Transfection efficiency was evaluated using TIDE analysis. The results are shown in Fig.11A Based on the transfection efficiency evaluation, sgRNA#1 and sgRNA#7 were selected.

[0221] Example 10: Complete excision of the light chain variable region from intact IgG using the Cas9 RNP complex

[0222] method

[0223] SSI cells expressing intact IgG antibodies were subcultured in the same manner as described in Example 9. sgRNA#1 and sgRNA#7 were selected and prepared for nuclear transfection in the same manner as described in Example 9.

[0224] Prepare Cas9 RNP complex according to Table 9.

[0225] Table 9: RNP complexes

[0226]

[0227] The complexes were incubated at room temperature for 30-60 minutes.

[0228] By adding 7x 10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing complete IgG antibodies for nuclear transfection. The cells were then resuspended in 492.8 μl of nuclear transfection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0229] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofection unit using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and then added and mixed with 80 μ l of 10 ml CD-CHO culture medium pre-warmed to 36.5 ° C. The final mixture of all 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5 ° C. The cells are then incubated for 48 hours at 36.5 ° C, 5% CO2 in a static incubator.

[0230] result

[0231] Evaluation of excision efficiency was determined using PCR analysis. The results are shown in Fig. 11B PCR evaluation showed clear and successful excision of the light chain variable region.

[0232] Example 11: Selection of sgRNA for excision of heavy chain variable region

[0233] method

[0234] SSI cell subculture and sgRNA preparation

[0235] Site-specific integration (SSI) cells expressing intact IgG antibodies (see, e.g., WO 2020 / 072480) were cultured at 0.3 x 10 6 The cells were subcultured into appropriately sized Erlenmeyer shake flasks (with CD-CHO medium) at a viable concentration of 10 cells / mL. These cells were cultured for no less than 4 days and no more than 4 weeks and had a viability of greater than 90% prior to transfection.

[0236] The sgRNA (TrueGuide synthetic sgRNA 3 nmol (Invitrogen, catalog number A35514)) was briefly centrifuged to collect the contents and resuspended to 100 μM in nuclease-free Tris-EDTA (TE) buffer to produce a stock solution. A 10 μM working solution was generated from this stock solution. All sgRNA solutions were stored at -20°C. The following 6 sgRNA sequences were prepared.

[0237] Wizard Name Sequence (5' to 3') sgRNA#11(eCHO1) cgtgtctgccgcttccacca(SEQ ID NO:33) sgRNA#12(eCHO2) gggggccagagggaacacgg(SEQ ID NO:34) sgRNA#13(eCHO3) gaacacggaggggcccttgg(SEQ ID NO:35) sgRNA#14(eCHO4) gaccaggaacagcaggatca(SEQ ID NO:36) sgRNA#15(eCHO5) cctggtcgccgtggccaccc(SEQ ID NO:37) sgRNA#16(eCHO6) cccgggtggccacggcgacc(SEQ ID NO:38)

[0238] Nucleofection

[0239] General nucleofection conditions for each individual transfection were as follows:

[0240]

[0241] Prepare the above Cas9 RNP complex mixture for each sgRNA sequence in 6 Eppendorf tubes by mixing 3.2 μl of Cas9 protein with 3.2 μl of 10 μM sgRNA. Also prepare 3 control mixtures with 1 Eppendorf tube containing 3.2 μl of Cas9 protein and 3.2 μl of TE buffer and 2 Eppendorf tubes each containing 6.4 μl of TE buffer. Incubate the mixture at room temperature for 30-60 minutes.

[0242] By adding 10 7The cells were transferred to a new tube and centrifuged at 300 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing complete IgG antibodies for nuclear transfection. The cells were then resuspended in 736 μl of nuclear transfection solution (656 μl of SF solution and 144 μl of supplement 1). 73.6 μl of cells were added to each of the 10 Cas9 RNP complex mixtures.

[0243] 20 μl of cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a 16-well nucleofection strip, where cells were pulsed using a Lonza 4D nucleofection unit using program DU-158. After nucleofection, cells were placed in a nucleofection cuvette for 10 minutes, and then added and mixed with 80 μl of 10 ml CD-CHO culture medium pre-warmed to 36.5°C. The final mixture of 20 μl was transferred to a 96-well plate with 100 μl of CD-CHO culture medium, maintained at 36.5°C in an incubator. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0244] result

[0245] Transfection efficiency was evaluated using TIDE analysis. The results are shown in Fig. 12A Based on the transfection efficiency evaluation, sgRNA#12 and sgRNA#14 were selected.

[0246] Example 12: Complete excision of the heavy chain variable region from intact IgG or light chain variable region excision cells (δVL cells) using Cas9 RNP complexes

[0247] method

[0248] SSI cells expressing intact IgG antibody VL excised cells (δVL) were subcultured in the same manner as described in Example 11. sgRNA #12 and sgRNA #14 were selected and prepared for nuclear transfection in the same manner as described in the VH excised gRNA evaluation.

[0249] Prepare Cas9 RNP complex according to Table 10.

[0250] Table 10: RNP complexes

[0251]

[0252] The complexes were incubated at room temperature for 30-60 minutes.

[0253] By adding 7x 10 6The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells for nuclear transfection. The cells were then resuspended in 492.8 μl of nuclear transfection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0254] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofection unit using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and then 80 μ l of 10 ml CD-CHO culture medium pre-warmed to 36.5 ° C are added and mixed. The final mixture of all 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5 ° C. The cells are then incubated for 48 hours at 36.5 ° C, 5% CO2 in a static incubator.

[0255] result

[0256] Evaluation of excision efficiency was determined using PCR analysis. The results are shown in Figures 12B-12C Middle. δVL cells ( Fig. 12B ) and SSI cells expressing intact IgG antibodies ( Fig. 12C ) showed clear and successful excision of the heavy chain variable region from both cells.

[0257] Clone selection

[0258] Prior to sorting, delta VH and VL cells were filtered through a 40 μm nylon mesh into 5 mL round-bottom tubes (Corning, Corning, NY, USA). Cells were gated based on FCS and SSC in a FACS AriaII using a 100 um nozzle and single cell sorting was performed in a 96-well plate.

[0259] Example 13: Seamless integration of the heavy chain variable region into an IgG lacking heavy and light chain variable regions (delta VH VL IgG)

[0260] method

[0261] SSI cells expressing δVH VL IgG antibodies were subcultured in the same manner as before. sgRNA #18 with the following sequence (5' to 3'): AGACAGCACCCGGGTGGCCA (SEQ ID NO: 39) was selected and prepared for nuclear transfection in the same manner as described previously. 100 μg of heavy chain variable region DNA template was briefly centrifuged to collect the contents and resuspended with 25 μl of TE buffer to obtain a concentration of 4 μg / μl. Fig.16 A schematic representation of the DNA template for heavy chain variable region-puromycin integration is shown.

[0262] Prepare Cas9 RNP complex according to Table 11.

[0263] Table 11: RNP complexes

[0264]

[0265] By placing 8x 10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing δVH VL IgG antibodies for nuclear transfection. The cells were then resuspended in 563.2 μl of nuclear transfection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0266] 220 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofection unit using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and then 80 μ l of 10 ml CD-CHO culture medium pre-warmed to 36.5 ° C are added and mixed. The final mixture of all 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5 ° C. The cells are then incubated in a static incubator at 36.5 ° C, 5% CO2 for 24 hours.

[0267] After 24 hours, the medium was replaced with CD-CHO + 6ug / mL puromycin medium for selection. The cells were grown in a static incubator until the negative control died. Cell viability was assessed using a Vi-Cell device.

[0268] result

[0269] Integration of the heavy chain variable region was confirmed by PCR. Fig.17AAs indicated, cell selection and viability were assessed by puromycin selection. PCR assessment ( Fig. 17B ) shows seamless integration of the heavy chain variable region.

[0270] Example 14: Seamless integration of the light chain variable region into an IgG lacking the light chain variable region (delta VL IgG)

[0271] method

[0272] SSI cells expressing δVL IgG antibodies were subcultured in the same manner as before. sgRNA #9 was selected and prepared for nuclear transfection in the same manner as described previously. 100 μg of light chain variable region DNA template was briefly centrifuged to collect the contents and resuspended with 27.7 μl of TE buffer to obtain a concentration of 3.6 μg / μl. Fig.18 A schematic representation of the DNA template for light chain variable region-blasticidin integration is shown.

[0273] Prepare Cas9 RNP complex according to Table 12.

[0274] Table 12: RNP complexes

[0275]

[0276]

[0277] By placing 8x 10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare SSI cells expressing only VH IgG antibodies for nuclear transfection. The cells were then resuspended in 563.2 μl of nuclear transfection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0278] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofection unit using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and then 80 μ l of 10 ml CD-CHO culture medium pre-warmed to 36.5 ° C are added and mixed. The final mixture of all 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5 ° C. The cells are then incubated for 24 hours at 36.5 ° C, 5% CO2 in a static incubator.

[0279] After 24 hours, the medium was replaced with CD-CHO + 6ug / mL puromycin + 5ug / mL blasticidin medium for selection. The cells were grown in a static incubator until the negative control died. Cell viability was assessed using a Vi-Cell device.

[0280] result

[0281] Integration of the light chain variable region was confirmed by PCR. Fig.19A As shown, cell selection and viability were assessed by blasticidin selection. PCR assessment ( Fig.19B ) shows seamless integration of the light chain variable region, as indicated by the band at 764 bp in the left 3 columns.

[0282] Example 15: Generation of inducible Cas9 single-site integrated BOB (iBOB) cells

[0283] method

[0284] Prepare transduction medium by diluting polybrene from a stock solution (10 mg / mL) to a final concentration of 10 μg / mL (1:1000 dilution factor) and divide it into 6 mL and 3 mL of Tube 1 and Tube 2, respectively. Then add Edit-R inducible lentiviral hEF1a-Cas9 lentiviral nuclease particles to Tube 2. The volume of lentiviral particles to be added is determined by the following equation:

[0285] V=MOI×CN÷VT×1000

[0286] in:

[0287] V = volume of lentiviral stock in μL

[0288] MOI = desired multiplicity of infection

[0289] CN = number of cells in the well at the time of transduction

[0290] VT = lentiviral titer in TU / mL and multiplied by 1000 to convert volume from mL to μL.

[0291] Based on the desired MOI of 1 and a cell density of 0.1 x 10 6 cells / well and a lentiviral titer of 1×107TU / mL, calculate 25μL of lentiviral stock solution / well.

[0292] Prepare 0.6 x 10 in tube A and 0.6 x 10 in tube B. 6 cells and 0.3x 10 6BOB cells of 10 cells were centrifuged at 200 g for 5 minutes. The cells were then resuspended with the transduction medium prepared as described above so that the contents of tube 1 were added to tube A to contain cells without lentiviral particles, and tube 2 was added to tube B to contain cells with lentiviral particles. These cells were seeded into 12-well plates according to the plate layout of Table 13, with 1 ml in each well, and incubated at 37° C. in a humidified CO2 incubator for 24 hours.

[0293] Table 13: Plate layout for cell seeding

[0294]

[0295] After 24 hours, the contents of each well were centrifuged at 200 g for 5 minutes to remove the medium and resuspended with 1 ml of pre-warmed CD-CHO / 6 mM L-glutamine medium prepared by adding 10 μL of polybrene to 10 mL of CD-CHO / 6 mM L-glutamine and seeded in a new plate with 1 ml in each well according to the plate layout of Table 4. The cells were incubated at 37°C in a humidified CO2 incubator for 72 hours.

[0296] After 72 hours, transduced cells were selected using selection medium containing blasticidin at a concentration of 5 μg / mL. Cells were subcultured as needed, and blasticidin was added to appropriate wells each time.

[0297] result

[0298] like Fig. 20A As shown, cell viability assessment showed successful transduction, selection, proliferation and cell banking of the inducible Cas9 BOB (SSI) cell line. RT-PCR, ELISA and WB analysis also verified the generation of the inducible Cas9 BOB (iBOB) cell line and evaluated the expression of Cas9, as shown in Figures 20B-20D shown.

[0299] Example 16: Generation of an inducible Cas-SSI cell line expressing an IgG antibody lacking its VL domain

[0300] method

[0301] iBOB host cells were cultured at 0.3 x 10 6 The cells were subcultured into appropriately sized Erlenmeyer shake flasks (with CD-CHO medium supplemented with 6 mM L-glutamine) at a viable concentration of 10 cells / mL. These cells had been cultured for no less than 4 days and no more than 4 weeks and had a viability of greater than 90% prior to transfection.

[0302] According to Table 14, the purified delta VL plasmid containing the gene of interest and the pMF26 plasmid containing the FlpE recombinase expression cassette were mixed in a DNase-free sterile tube and the volume was adjusted to 100 μL using TE buffer.

[0303] Table 14: Plasmid mixture preparation

[0304]

[0305] 100 μL of the plasmid mixture from Table 6 was transferred to a 0.4 cm electroporation cuvette (per transfection) to which was added 0.8 ml of iBOB host cells prepared and resuspended in 6.4 ml CD CHO / 6 mM L-glutamine medium. Cells were electroporated by delivering a single exponential decay pulse of 300 V, 900 μF.

[0306] The contents of the cuvette were transferred to each of the 20 mL of CD CHO / 6 mM L-glutamine medium added to six T75 flasks and pre-warmed to 36.5° C. in a humidified static CO 2 incubator. The flasks were incubated in a humidified static CO 2 incubator for 24 hours.

[0307] After 24 hours, replace the medium in each flask with 20 ml pre-warmed CD CHO medium. Cultivate and subculture the cells.

[0308] result

[0309] like Fig.21A and 21B PCR and FACS analyses shown confirm the successful generation of δVL iBOB cells.

[0310] Example 17: Generation of an inducible Cas-SSI cell line expressing an IgG antibody lacking its VH domain

[0311] method

[0312] iCas9 CHO host cells were cultured at 0.3 x 10 6 The cells were subcultured into appropriately sized Erlenmeyer shake flasks (with CD-CHO medium supplemented with 6 mM L-glutamine) at a viable concentration of 10 cells / mL. These cells had been cultured for no less than 4 days and no more than 4 weeks and had a viability of greater than 90% prior to transfection.

[0313] According to Table 15, the purified delta VH plasmid containing the gene of interest and the pMF35 plasmid containing the FlpE recombinase expression cassette were mixed in a DNase-free sterile tube and the volume was adjusted to 100 μL using TE buffer.

[0314] Table 15: Plasmid mixture preparation

[0315]

[0316] 100 μL of the plasmid mixture from Table 10 was transferred to a 0.4 cm electroporation cuvette (per transfection), to which 0.8 ml of iCas CHO host cells were added, prepared and resuspended in 6.4 ml CD CHO / 6 mM L-glutamine medium. Cells were electroporated by delivering a single exponential decay pulse of 300 V, 900 μF.

[0317] The contents of the cuvette were transferred to each of the 20 mL of CD CHO / 6 mM L-glutamine medium added to six T75 flasks and pre-warmed to 36.5° C. in a humidified static CO 2 incubator. The flasks were incubated in a humidified static CO 2 incubator for 24 hours.

[0318] After 24 hours, replace the medium in each flask with 20 ml pre-warmed CD CHO medium. Cultivate and subculture the cells.

Claims

1. A cell comprising a genomic nucleic acid sequence, wherein the genomic nucleic acid sequence comprises, a first sequence encoding antibody heavy chain constant regions 1, 2, and 3, wherein the first sequence is not flanked by sequences encoding antibody heavy chain variable regions, and A second sequence encoding an antibody light chain constant region 1, wherein the second sequence is not flanked by a sequence encoding an antibody light chain variable region.

2. The cell of claim 1, further comprising a first promoter operably linked to the first sequence and a second promoter operably linked to the second sequence.

3. The cell according to claim 1 or 2, further comprising a sequence encoding a selectable marker.

4. The cell according to any one of claims 1 to 3, further comprising a sequence encoding a gene editing protein.

5. The cell of claim 4, wherein the gene editing protein is a Cas gene editing protein.

6. The cell according to claim 4, wherein the gene editing protein is selected from Cas9, Cas12, Cas12i2, TALENS, MAD7 nuclease and zinc finger nuclease.

7. The cell of claim 6, wherein the gene editing protein is Cas9.

8. The cell of any one of claims 4 to 7, wherein the gene editing protein is operably linked to an inducible promoter.

9. The cell according to claim 8, wherein the inducible promoter is the TET-on system.

10. The cell according to any one of claims 1 to 9, wherein the cell is a high-expressing stable clone.

11. The cell of claim 10, wherein the cell is a Chinese Hamster Ovary (CHO) cell.

12. A method for producing editable cells, the method comprising: Providing a cell that stably expresses a genomic nucleic acid sequence of an antibody, wherein the genomic nucleic acid sequence includes a variable heavy chain region sequence, constant heavy chain region 1, 2 and 3 sequences, a variable light chain region sequence and a constant light chain region 1 sequence; Using a gene editing protein to excise the sequence encoding the variable heavy chain region; and The variable light chain region sequence is excised using the gene editing protein.

13. The method according to claim 12, further comprising: Prior to the excision of the sequences encoding the variable heavy chain region and the variable light chain region, introducing a sequence encoding the gene editing protein into the genomic nucleic acid sequence; and The gene editing protein is expressed prior to said excision of the variable heavy chain region and the variable light chain region.

14. The method of claim 12 or 13, wherein the gene editing protein is a Cas gene editing protein.

15. The method of claim 12 or 13, wherein the gene editing protein is selected from Cas9, Cas12, Cas12i2 TALENS, MAD7 nuclease and zinc finger nuclease.

16. The method of claim 15, wherein the gene editing protein is Cas 9.

17. The method according to any one of claims 14 to 16, wherein said excision of said sequence encoding said variable heavy chain region with said gene editing protein occurs at a first guide RNA target sequence and a second guide RNA target sequence; and said excision of said variable light chain region sequence with said gene editing protein occurs at a third guide RNA target sequence and a fourth guide RNA target sequence.

18. The method of claim 17, further comprising introducing a first guide RNA and a second guide RNA.

19. The method of claim 17, further comprising introducing a third guide RNA and a fourth guide RNA.

20. The method of any one of claims 13 to 19, wherein the sequence encoding the gene editing protein is operably linked to an inducible promoter.

21. The method of claim 20, wherein the inducible promoter is a TET-on system.

22. The method of any one of claims 12 to 21, wherein the editable cells are high-expressing stable clones.

23. The method of claim 22, wherein the editable cells are Chinese hamster ovary (CHO) cells.

24. A method for preparing a cell that produces an antibody, the method comprising: Providing a cell according to any one of claims 1 to 11; introducing into the cell a sequence encoding an antibody heavy chain variable region; and A sequence encoding the antibody light chain variable region is introduced into the cells.

25. The method of claim 24, further comprising introducing a fifth guide RNA target sequence and a sixth guide RNA target sequence.

26. The method of claim 24 or 25, further comprising introducing a first sequence encoding a first selectable marker and a second sequence encoding a second selectable marker.

27. The method of any one of claims 24 to 26, further comprising selecting cells expressing the antibody using the first selectable marker and the second selectable marker.

28. The method of any one of claims 24 to 27, further comprising expressing the antibody in the cell.

Images