Editable cell line

Abstract

The present disclosure provides editable cell lines, including the use of gene editing proteins to produce the cell lines. The editable cell lines are capable of expressing antibody constant regions, which may act as a platform for antibody variable regions to produce customized antibodies.

Description

Technical Field

[0001] The present disclosure provides editable cell lines, including the use of gene editing proteins to produce the cell lines. By preparing editable cell lines, the editable cell lines have the ability to be further modified to produce the desired antibodies alone, which can reduce the cost and time of the antibody preparation process. Background Art

[0002] As clinical adoption of advanced antibody therapeutics begins to gain traction, more attention is turning to the underlying manufacturing strategies that will make these therapies available to patients worldwide. While antibody therapeutics hold great promise in the clinic, the high manufacturing cost relative to reimbursement is a significant barrier to commercialization.

[0003] One of the challenges facing antibody therapy is the multi-stage and complex preparation process to produce the desired antibodies. The current preparation process relies on the introduction of vectors to construct cell lines to express the gene of interest and obtain the desired antibody. This process requires the construction of vectors for each new antibody to be expressed, followed by gene introduction and pool recovery. This process further requires clonal selection to find high-yield clones, which is time-consuming, where each clone needs to be evaluated for stability and can lead to deviations and failures.

[0004] What is needed to overcome these challenges is a method to shorten and simplify the production process. Editable cell lines are able to express antibody constant regions, and can serve as a platform for antibody variable regions and remove the need for vector construction, and provide a reliable antibody production platform. The present invention meets these needs. Summary of the invention

[0005] In some embodiments, the present disclosure provides a cell comprising a genomic nucleic acid sequence, the genomic nucleic acid sequence comprising a first sequence, the first sequence encoding antibody heavy chain constant regions 1, 2 and 3 on one chain of the genomic nucleic acid sequence, wherein the first sequence is not flanked by a sequence encoding an antibody heavy chain variable region, and a second sequence, the second sequence encoding an antibody light chain constant region 1 on the opposite chain of the genomic nucleic acid sequence, wherein the second sequence is not flanked by a sequence encoding an antibody light chain variable region.

[0006] In another embodiment, the present invention provides a method for producing an editable cell, the method comprising: introducing a first sequence encoding antibody heavy chain constant regions 1, 2, and 3 on one chain of the cell's genomic nucleic acid sequence; and introducing a second sequence encoding antibody light chain constant region 1 on the opposite chain of the cell's genomic nucleic acid sequence.

[0007] Also provided herein is a method for preparing an editable cell that produces an antibody, the method comprising: providing a cell comprising a genomic nucleic acid sequence, the genomic nucleic acid sequence comprising a first sequence, the first sequence encoding antibody heavy chain constant regions 1, 2 and 3 on one chain of the genomic nucleic acid sequence, wherein the first sequence is not flanked by a sequence encoding an antibody heavy chain variable region, and a second sequence, the second sequence encoding an antibody light chain constant region 1 on the opposite chain of the genomic nucleic acid sequence, wherein the second sequence is not flanked by a sequence encoding an antibody light chain variable region, introducing the sequence encoding the antibody heavy chain variable region into the first sequence upstream of the antibody heavy chain constant region; and introducing the sequence encoding the antibody light chain variable region into the second sequence upstream of the antibody light chain constant region 1. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 Schematic diagram showing how an intermediate headless antibody can be modified by introducing antibody variable regions to generate a desired custom antibody.

[0009] Figure 2 An exemplary representation of a genomic nucleic acid sequence of an editable cell is shown, wherein the antibody heavy chain constant region and light chain constant region are located on opposite chains within the same locus of the genomic sequence.

[0010] Figure 3 An exemplary representation of a genomic nucleic acid sequence is shown, in which an editable cell line is modified to include a sequence encoding an antibody heavy constant region and a sequence encoding an antibody light constant region on opposite chains within the same locus of the genomic sequence, as well as a sequence encoding a gene editing protein, a selection marker, and an inducible promoter.

[0011] Figures 4A-4C Schematic diagrams showing the de novo nootropic cell line (4A), recovery of cells after transfection (4B), and FACS analysis showing integration of the cassette into BOB cells (CHO cells expressing GFP) using the SSI system (4C).

[0012] Figures 5A-5C PCR validation of the production of headless antibodies (5A) and intact antibodies (5B and 5C) is shown.

[0013] Figure 6A-6B Antibody expression validation by WB (6A) and functional and expression validation by FACS analysis (6B) are shown.

[0014] Figure 7 Schematic diagram showing seamless integration of heavy and light chain variable regions using one DNA template and selectable marker.

[0015] Figure 8Shown is the recovery of cells after puromycin antibiotic selection for cells transfected with heavy and light chain variable regions.

[0016] Figures 9A-9B Antibody function and expression verification by FACS analysis (9A) and antibody expression verification by WB (9B) are shown. DETAILED DESCRIPTION

[0017] In the claims and / or the specification, use of the words "a / an" when used in conjunction with the term "comprising" may mean "one", but is also consistent with "one or more", "at least one", and "one or more than one".

[0018] Throughout this application, the term "about" is used to indicate that a value includes the inherent error variation of the method / device used to determine the value. Typically, the term is meant to encompass about or less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% variability, as the case may be.

[0019] Use of the term "or" in the claims is intended to mean "and / or" unless explicitly stated to refer to only alternatives or the alternatives are mutually exclusive, although the present disclosure supports definitions referring to only alternatives and to "and / or."

[0020] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, system, host cell, expression vector, and / or composition of the invention. In addition, the compositions, systems, cells, and / or nucleic acids of the invention can be used to implement any of the methods as described herein.

[0021] As described throughout, the subject of the present disclosure is an editable cell line that is stable in an embodiment and highly productive in another embodiment, capable of being further modified to produce a desired custom antibody individually. The editable cell line includes the use of a gene editing protein to further modify the genomic sequence encoding the headless antibody structure. The editable cell line may or may not express the headless antibody structure because the headless antibody structure is an intermediate. However, once the editable cell line is completely modified by the antibody variable region, the cell line can be expressed to produce a completely customized antibody protein.

[0022] As used herein, "headless antibody" refers to an antibody protein without antibody variable regions, but including constant heavy chain regions and light chain regions. The antibody variable region includes the heavy chain and light chain variable regions that define the antigen binding site of the antibody protein. See, e.g. Figure 1 , which shows a schematic representation of an antibody including heavy and light chain constant regions. The headless antibody structure can be modified and is only an intermediate into which antibody variable regions can be introduced to produce a custom antibody protein.

[0023] As used herein, "genomic nucleic acid" or "genomic sequence" means a nucleic acid that is integrated into the genome of a cell. The term "genome" refers to a complete set of genetic information in the chromosomes of a cell.

[0024] As used herein, "nucleic acid", "nucleic acid molecule" or "oligonucleotide" means a polymeric compound comprising covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, gRNA, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA or MIRNA.

[0025] As used herein, "gene" refers to an assembly of nucleotides encoding a polypeptide and includes cDNA and genomic DNA nucleic acid molecules. "Gene" also refers to a nucleic acid fragment that can serve as a regulatory sequence before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. In some embodiments, the gene is integrated with multiple copies. In some embodiments, the gene is integrated with a predefined copy number.

[0026] As used herein, "stable" means that cell lines can use conventional storage methods to maintain cell integrity, and cells can maintain the function of producing antibodies during multiple cell divisions. In an embodiment, cell lines described herein are stable cell lines. As used herein, "high yield" or "high expression" means producing the molecule of interest with an amount of at least about 1g / L. It is considered that the amount of high yield will depend on the molecule of interest produced, and can be about 2g / L, about 3g / L, about 4g / L, about 5g / L, about 6g / L, about 7g / L, about 8g / L, about 9g / L, about 10g / L, about 15g / L, about 20g / L or higher. In an embodiment, the cell provided herein is a stable high expression cell.

[0027] Figure 1 Schematic diagram showing how an intermediate headless antibody can be modified by introducing antibody variable regions to generate a desired custom antibody. Figure 1 In the present invention, the overlapping antibody structure represents what is encoded and produced by expressing the DNA sequence. Therefore, initially the sequence represents a headless antibody. Then the antibody variable region is introduced into the genome. Finally, the complete structure of the customized antibody is expressed. Various methods for generating such headless antibody structures are described herein.

[0028] The editable cell lines disclosed herein do not appropriately require the use of DNA vectors to introduce genetic sequences encoding antibodies produced by each antibody. A commonly used method for producing antibodies requires the use of recombinant DNA vectors, which are created, cloned, and introduced into host cells in each antibody production cycle. However, this general method depends on the random / semi-random integration of DNA vectors into host cells.

[0029] Editable cell lines can reduce the time and cost of commonly used antibody production methods by eliminating the need to generate DNA vectors, introducing the vectors into host cells, and selecting host cells with DNA vectors to produce antibodies. In the disclosed editable cell lines, the sequence encoding the headless antibody is integrated into the genomic sequence of the host cell. Therefore, once the editable cells are modified to produce complete antibodies, the cells can be selected and cloned to produce antibodies.

[0030] Editable cell lines can be generated by integrating sequences encoding antibody constant regions into the genomic sequence of cells, and selecting appropriately stable and, in embodiments, highly expressing cell lines. The resulting cells contain sequences encoding headless antibodies.

[0031] In some embodiments, a method for producing an editable cell is provided herein, the method comprising: introducing a first sequence encoding antibody heavy chain constant regions 1, 2, and 3 on one chain of the cell's genomic nucleic acid sequence; and introducing a second sequence encoding antibody light chain constant region 1 on the opposite chain of the cell's genomic nucleic acid sequence. In some embodiments, the first sequence and the second sequence are located on opposite chains within the same locus of the genomic nucleic acid. In some embodiments, the first sequence and the second sequence are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide base pairs on opposite chains within the same locus. In some embodiments, the first sequence and the second sequence are located on different chromosomes.

[0032] In some embodiments, a method for producing editable cells is provided herein, the method further comprising: introducing a sequence encoding a gene editing protein into a genomic nucleic acid sequence and expressing the gene editing protein. In some embodiments, a method for producing editable cells is provided herein, the method further comprising: introducing a ribonucleoprotein (RNP) of a suitable gene editing protein. In some embodiments, a method for producing editable cells is provided herein, the method further comprising: introducing a plasmid containing a sequence encoding a gene editing protein into a cell and expressing the gene editing protein sequence in the plasmid.

[0033] As used herein, the terms "engineered nuclease," "engineered gene editing protein," or "gene editing protein" refer to a nuclease that has been isolated, modified, mutated, and / or altered from its native state as a nuclease. "Nuclease" refers to an enzyme that is capable of cleaving DNA and / or RNA molecules. By engineering the nuclease, the specific location of the cleavage can be designed and customized based on the desired cell type and / or gene of interest.

[0034] Exemplary engineered nucleases (produced by integrated genomic nucleic acid, virus or other non-genomic nucleic acid, or produced as RNP) that can be inserted into cells include, for example, large nucleases, methyltransferases, zinc finger nucleases, nucleases based on transcription activator-like effectors (TALENS), FokI nucleases and CRISPR-related (Cas) nucleases. In general, engineered nucleases use DNA binding proteins with the desired catalytic activity and the ability to bind to the desired target sequence in a manner similar to a restriction enzyme through protein-nucleic acid interactions. Examples include large-range nucleases, zinc finger nucleases (ZFNs) or transcription activator-like nucleases (TALENs) of naturally occurring or engineered rare sequence cutting enzymes, which contain FokI catalytic nuclease subunits connected to a modified DNA binding domain, and can each cut a predetermined sequence. In ZFN, the binding domain comprises an amino acid chain folded into a custom zinc finger domain. Similarly, in TALEN, 34 amino acid repeats derived from transcription factors are folded into a huge DNA binding domain. In the case of gene targeting, these enzymes can cut genomic DNA to form double-strand breaks (DSBs) or generate nicks, which can be repaired by one of two repair pathways, non-homologous end joining (NHEJ) or homologous recombination (HR). The NHEJ pathway may cause specific mutations, deletions, insertions, or substitution events. The HR pathway causes the targeted sequence to be replaced by the supplied donor sequence. An exemplary FokI and methyltransferase-based system is described in U.S. Pat. No. 10,220,052, the disclosure of which is incorporated herein by reference in its entirety.

[0035] The clustered regularly interspaced short palindromic repeats (CRISPR) and associated proteins (CRISPR-associated nucleases or Cas proteins) comprising the CRISPR-Cas system were first identified in selected bacterial species and form part of the prokaryotic adaptive immune system. See Sorek et al., "CRISPR-a widespread system that provides acquired resistance against phages in bacteria and archaea," Nat. Rev. Microbiol. 6(3)181-6 (2008), which is incorporated herein by reference in its entirety. CRISPR-Cas systems are mainly classified into three types: type I, type II, and type III. The main defining features of the individual types are the various Cas genes employed and the corresponding proteins they encode. The cas1 and cas2 genes appear to be universal across the three main types, while cas3, cas9, and cas10 are considered to be specific to type I, type II, and type III systems, respectively. See, e.g., Barrangou, R. and Marraffini, LA, "CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity," Mol. Cell. 54(2):234-44 (2014), which is incorporated herein by reference in its entirety.

[0036] Typically, CRISPR-Cas systems function by capturing short regions of invading viral or plasmid DNA and integrating the captured DNA into the host genome to form a so-called CRISPR array, which is spaced apart by repetitive sequences within the CRISPR locus. DNA is collected into the CRISPR array and subsequently transcribed and processed into RNA.

[0037] Depending on the bacterial species, the CRISPR RNA processing performed is also different. For example, in the type II system originally described in the bacterium Streptococcus pyogenes, the transcribed RNA is paired with a trans-activating RNA (tracrRNA) and then cut by RNase III to form a single CRISPR-RNA (crRNA). The crRNA is further processed after binding to the Cas9 nuclease to produce mature crRNA. The crRNA / Cas9 complex is then combined with a DNA containing a sequence complementary to the captured region (referred to as a protospacer). The Cas9 protein then cuts the two chains of the DNA in a site-specific manner, thereby forming a double-strand break (DSB). This provides a DNA-based memory, so that the virus or plasmid DNA is rapidly degraded when repeatedly exposed and / or infected.

[0038] Since its initial discovery, multiple groups have conducted extensive research on the potential applications of the CRISPR system in genetic engineering, including gene editing (Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity," Science, 337(6096):816-21 (2012); Cong et al., "Multiplex genome engineering using CRISPR / Cas systems," Science, 339(6121):819-23 (2013); and Mali et al., "RNA-guided human genome engineering via Cas9," Science, 339(6121):823-26; each of which is incorporated herein by reference in its entirety). A major development is to use chimeric RNA to target Cas9 protein, which is designed around a single unit from a CRISPR array fused to tracrRNA. This will produce a single RNA species, known as a small guide RNA (gRNA), in which the sequence in the original spacer region is modified to target the Cas9 protein site-specifically. Considerable work has been done to understand the nature of the base pairing interaction between chimeric RNA and the target site and its tolerance to mismatches, which is highly relevant to predicting and evaluating off-target effects (see, for example, Fu et al., "Improving CRISPR-Cas nucleases using truncated guide RNAs", Nature Biotechnology 32 (3): 279-84 (2014), and supporting materials, which are incorporated herein by reference in their entirety).

[0039] The CRISPR-Cas9 gene editing system has been successfully used in a variety of organisms and cell lines, and can use wild-type Cas9 protein to induce double-strand break formation, or can use a mutant protein called Cas9n / Cas9 D10A to cut a single DNA strand (see, for example, Mali et al., (2013) and Sander and Joung, "CRISPR-Cas systems for editing, regulating and targeting genomes", Nature Biotechnology 32(4): 347-55 (2014), each of which is incorporated herein by reference in its entirety). Although double-strand break (DSB) formation can lead to small insertions and deletions (indels) that may disrupt gene function, Cas9 wild-type and Cas9n / Cas9 D10A nickases can avoid indels (the result of repair by non-homologous end joining) while stimulating endogenous homologous recombination machinery. Therefore, these systems can be used to insert DNA regions into the genome with high fidelity.

[0040] In some embodiments, a method for producing editable cells is provided herein, wherein the gene editing protein used in the method is a CRISPR-related gene editing protein. In a suitable embodiment, CRISPR-related (Cas) nuclease is a Cas9 nuclease, or may be other Cas nucleases (such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a), etc.). In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity, as disclosed in the U.S. Patent Application No. 2018-0319850, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the gene editing protein is a zinc finger nuclease. In some embodiments, the gene editing protein is a TALENS. In some embodiments, the gene editing protein is a FokI nuclease.

[0041] In addition to the Cas9 nuclease, Cas12, Cas13, Cas14 and MAD7 (Cas12a) nucleases can also be used in the methods described herein. Cas12 produces staggered cuts in dsDNA (5 nucleotides of 5' protruding dsDNA breaks). Cas12 processes its own guide RNA, thereby improving multiplexing capabilities. Cas13t targets RNA, not DNA. Once it is activated by an ssRNA sequence complementary to its crRNA spacer, it releases nonspecific RNAse activity and destroys all nearby RNAs, regardless of their sequence. See, for example, Yan et al., "CRISPR-Cas12 and Cas13: the lesser known siblings of CRISPRCas9", Cell Biology and Toxicology, pp. 1-4 (August 29, 2019), the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the Cas12i2 nuclease can also be used in the methods described herein, such as the methods disclosed in U.S. Pat. No. 10,808,245, the disclosure of which is incorporated herein by reference in its entirety.

[0042] In some embodiments, there is provided herein a method for producing editable cells, wherein a sequence encoding a gene editing protein (genome integrated) is operably connected to an inducible promoter. By placing the gene editing protein under the control of an inducible promoter, the nuclease can remain dormant or silent before its desired use as a gene editing tool. In some embodiments, the inducible promoter is a TET-on system.

[0043] As used herein, "promoter", "promoter sequence" or "promoter region" refers to a DNA regulatory region / sequence that can bind RNA polymerase and initiate transcription of downstream coding or non-coding gene sequences. In other words, the promoter is operably combined or operably connected to the gene. As mentioned herein, the terms "in an operable combination", "in an operable order", "operably connected" and "operably linked" refer to nucleic acid sequences that are connected in a manner that produces a promoter that can guide the transcription of a given gene and / or the synthesis of a desired protein molecule. The term also refers to connecting amino acid sequences in a manner that produces a protein.

[0044] In some examples of the present disclosure, the promoter sequence includes a transcription start site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at a detectable level above background. In some embodiments, the promoter sequence includes a transcription start site and a protein binding domain responsible for binding RNA polymerase. Eukaryotic promoters will often, but not always, contain a "TATA" box and a "CAT" box.

[0045] Various promoters can be used to drive gene expression. In some embodiments, the promoter is an "inducible promoter", i.e., the promoter does not constitutively express any gene product as described herein and is activated in response to a specific stimulus that can be turned on or off, depending on the desired control of the gene under the control of the promoter. In other embodiments as described herein, the promoter is a constitutive promoter that initiates mRNA synthesis without being affected by external regulation.

[0046] Suitably, the promoter for controlling engineered nuclease is a derepressible promoter. As used herein, "derepressible promoter" refers to a structure comprising a functional promoter and other elements or sequences that can bind to a repressor element to cause functional promoter repression. "Repression" refers to the reduction or inhibition of promoter transcription initiation to downstream coding or non-coding gene sequences. "Repressor element" refers to a protein or polypeptide that can bind to a promoter (or near a promoter) to reduce or inhibit promoter activity. The repressor element can interact with a substrate or binding partner of the repressor element so that the repressor element undergoes a conformational change. This conformational change of the repressor element takes away the ability of the repressor element to reduce or inhibit the promoter, thereby causing "de-repression" of the promoter, thereby allowing the promoter to continue to initiate transcription. "Functional promoter" refers to a promoter that will be able to initiate transcription in the absence of a repressor element. Various functional promoters that can be used in the practice of the present invention are known in the art and include, for example, promoters of PCMV, PH1, P19, P5, P40, and adenovirus helper genes (e.g., E1A, E1B, E2A, E4Orf6, and VA).

[0047] Described herein are examples of various controllable promoters, including inducible promoters and derepressible promoters, and methods of inducing expression of Cas9 nuclease by introducing molecules that induce expression or derepress derepressible promoters.

[0048] Exemplary repressor elements and their corresponding binding partners that can be used as derepressible promoters are known in the art and include, for example, the cumate gene switch system (CuO operator, CymR repressor, and cumate binding partner) (see, e.g., Mullick et al., "The cumate gene-switch: a system for regulated expression in mammalian cells," BMC Biotechnology 6:43(1-18) (2006), the disclosure of which is incorporated herein by reference in its entirety, including the disclosure of the derepressible promoter system described therein) and the TetO / TetR system described herein (see, e.g., Yao et al., "Tetracycline Repressor, tetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells." Cells), "Human Gene Therapy" 9: 1939-1950 (1998), the disclosure of which is incorporated herein by reference in its entirety) and other systems. In exemplary embodiments, the derepressible promoter comprises a functional promoter and any two tetracycline operator sequences (TetO or TetO2). In such embodiments, the nucleic acid introduced into the T cell further includes a tetracycline repressor protein to control the TetO derepressible system (TET-on system).

[0049] As described herein, the method may further include inducing the expression of CRISPR-related nucleases by activating an inducible promoter. In the case of an inducible promoter (such as 4HT inducible promoter, rapamycin inducible promoter, hormone response element or glutamate inducible promoter), by adding such as 4-hydroxytamoxifen (hydroxytamoxifen), rapamycin, hormone or glutamate inducible promoter respectively. In the case of a derepressible promoter (TetO sequence coupled with CMV promoter as described herein), doxycycline is added to remove repression, and gene (engineered nuclease) is allowed to be expressed by CMV promoter. Suitably, the nucleic acid molecule encoding Cas9 also encodes TetR repressor element, suitably in another promoter system, such as under the control of a constitutive promoter (such as hPGK promoter).

[0050] Figure 2 The invention shows that a first sequence encoding antibody heavy chain constant regions 1, 2 and 3 (respectively represented by CH1, CH2 and CH3) is introduced and a second sequence encoding antibody light chain constant region 1 is introduced into the C L Schematic representation of the method for generating editable cells using genomic nucleic acid sequences. Figure 2 In one embodiment, the first sequence and the second sequence are located on opposite strands of the genomic nucleic acid, but are within the same locus and are separated by 10 or fewer nucleotide base pairs. As described herein, other orientations include situations in which the antibody heavy chain constant region is located on a first nucleic acid sequence on a chromosome that is completely different from the second sequence encoding the antibody light chain constant region.

[0051] In some embodiments, the method further comprises introducing a sequence encoding a selectable marker.

[0052] As used herein, the term "selectable marker" or "selectable marker gene" refers to a gene introduced into a cell that confers a trait suitable for artificial selection. Universal selectable markers are well known to those of ordinary skill in the art. Drug selectable markers can be used, such as ampicillin / carbenicillin, kanamycin, chloramphenicol, nourseothricin N-acetyl transferase, erythromycin, tetracycline, gentamicin, bleomycin, streptomycin, puromycin, hygromycin, blasticidin (blast) and G418. In other embodiments, selectable markers include, but are not limited to, human nerve growth factor receptor (detected with MAbs, as described in U.S. Pat. No. 6,365,373); truncated human growth factor receptor (detected with MAbs); mutant human dihydrofolate reductase (DHFR; fluorescent MTX substrate available); secretory alkaline phosphatase (SEAP; fluorescent substrate available); human thymidylate synthase (TS; confers resistance to the anticancer agent fluorodeoxyuridine); human glutathione S-transferase alpha (GSTA1; glutathione is conjugated to the stem cell selective alkylating agent busulfan; chemoprotective selectable marker); CD24 cell surface antigen in hematopoietic stem cells; human CAD gene that confers resistance to N-phosphono-L-aspartate (PALA); human multidrug resistance-1 (MDR-1; p-glycoprotein surface protein that can be selected by increased drug resistance or enriched by FACS); human CD25 (IL-2.α; detectable by Mab-FITC); methylguanine-DNA methyltransferase (MGMT; selectable by carmustine); rhamnose; and cytidine deaminase (CD; selectable by Ara-C).

[0053] In another embodiment, the present invention provides a method for preparing an antibody-producing cell, the method comprising: providing a cell as described herein, introducing a sequence encoding an antibody heavy chain variable region upstream of a first sequence encoding antibody heavy chain constant regions 1, 2, and 3 on one chain of the cell's genomic nucleic acid sequence, and introducing a sequence encoding an antibody light chain variable region upstream of a second sequence encoding antibody light chain constant region 1 on the opposite chain of the cell's genomic nucleic acid sequence.

[0054] In some embodiments, a method for preparing a cell producing an antibody is provided herein, the method further comprising using a single guide RNA to introduce a sequence encoding an antibody heavy chain variable region on one chain of the cell's genomic nucleic acid sequence and a sequence encoding an antibody light chain variable region on the relative chain of the cell's genomic nucleic acid sequence. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody heavy chain variable region. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody light chain variable region. In some embodiments, the promoter sequence is operably connected to the sequence encoding the antibody heavy chain variable region. In some embodiments, the promoter sequence is operably connected to the sequence encoding the antibody light chain variable region.

[0055] In some embodiments, the sequence encoding the antibody heavy chain variable region is operably linked to a first sequence encoding antibody heavy chain constant regions 1, 2, and 3. In some embodiments, the sequence encoding the antibody light chain variable region is operably linked to a second sequence encoding antibody light chain constant region 1.

[0056] In some embodiments, the method further comprises introducing the guide RNA via a plasmid that transiently expresses the guide RNA.

[0057] As described herein, in an embodiment, the editable cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algae cell, or a plant cell. In a suitable embodiment, the cell is a Chinese hamster ovary (CHO) cell. Examples of CHO cells include, but are not limited to, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN, or CHO-derived cells. In some embodiments, the cell is a Chinese hamster ovary (CHO) cell.

[0058] In suitable embodiments, the cell is a human embryonic kidney (HEK) cell. In certain embodiments, the cell is selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, e.g., COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0059] In another embodiment, a cell is provided herein, comprising a genomic nucleic acid sequence, the genomic nucleic acid sequence comprising a first sequence, the first sequence encoding antibody heavy chain constant region 1, 2 and 3 on one chain of the genomic nucleic acid sequence, wherein the first sequence is not flanked by a sequence encoding an antibody heavy chain variable region, and a second sequence, the second sequence encoding an antibody light chain constant region 1 on the opposite chain of the genomic nucleic acid sequence, wherein the second sequence is not flanked by a sequence encoding an antibody light chain variable region. As described herein, suitably, the first sequence and the second sequence are located on opposite chains within the same locus of the genomic nucleic acid. See, e.g. Figure 3 , it shows an embodiment in which the heavy chain region and the light chain region are located on the relative strand of genomic nucleic acid. In certain embodiments, the first sequence and the second sequence on the relative strand in the same locus are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide base pairs. In still other embodiments, nucleic acid can be separated by a greater number of base pairs, and can even be on different chromosomes.

[0060] In some embodiments, the cell further comprises a first promoter operably linked to the first sequence and a second promoter operably linked to the second sequence. In some embodiments, the cell further comprises a bidirectional promoter operably linked to the first sequence and the second sequence on opposite strands in the same locus of the genomic nucleic acid. In some embodiments, the first sequence and the second sequence do not have a promoter linked to the sequence.

[0061] In some embodiments, the cell further comprises a sequence encoding a gene editing protein. In some embodiments, the gene editing protein is a CRISPR-related gene editing protein. In a suitable embodiment, the CRISPR-related (Cas) nuclease is a Cas9 nuclease, or may be other Cas nucleases (such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a), etc.). In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity. In some embodiments, the gene editing protein is a zinc finger nuclease. In some embodiments, the gene editing protein is a TALENS. In some embodiments, the gene editing protein is a FokI nuclease. As described herein, the gene editing protein can be part of a genomic sequence, or may be a sequence provided separately (e.g., by a vector) or included as an RNP.

[0062] In some embodiments, the sequence encoding the gene editing protein is operably linked to an inducible promoter. By placing the gene editing protein under the control of an inducible promoter, the nuclease can remain dormant or silent before its desired use as a gene editing tool. In some embodiments, as described herein, the inducible promoter is a TET-on system.

[0063] As described herein, the cell is suitably a eukaryotic cell. In certain embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algae cell or a plant cell. In a suitable embodiment, the cell is a Chinese hamster ovary (CHO) cell. The example of a CHO cell includes but is not limited to CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN or CHO derived cells. In certain embodiments, the cell is a Chinese hamster ovary (CHO) cell. In a suitable embodiment, the cell is a human embryonic kidney (HEK) cell. In some embodiments, the cell is selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, e.g., COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0064] In some embodiments, the cells further comprise a sequence encoding a selectable marker.

[0065] Figure 3 An exemplary illustration of a genomic sequence of an editable cell is shown, comprising a first sequence and a second sequence located on opposite strands within the same locus of a genomic nucleic acid. The genomic sequence also contains a sequence encoding a gene editing protein (Cas9), a sequence encoding a selection marker, and a sequence encoding a TET-on inducible promoter, which is provided as an exemplary embodiment.

[0066] Figure 4AA diagram of the genomic sequence of a headless antibody is shown, the genomic sequence including the heavy and light chain constant regions on opposite chains within the same locus of the genomic nucleic acid without a promoter, so the headless antibody is not expressed. However, the genomic sequence also encodes a selectable marker (e.g., RFP) inserted using a proximal cassette with a CMV promoter that can be used to direct the expression of the antibody. Figure 4B Recovery of cells after transfection of the genomic sequence of the headless antibody as described herein is shown, indicating that cells with the genomic sequence of the headless antibody were successfully generated and cloned. Figure 4C Shown is a FACS analysis verifying successful integration of the cassette, as indicated by comparison of RFP expression to GFP expression in control cells.

[0067] Figure 5A PCR results for successfully generated and expressed headless antibodies are shown, indicated by a band at 400 bp. Figure 5B As shown, successful transfection of non-expressed headless antibody did not show any bands with PCR, while PCR expression of the light chain region of the complete antibody showed a band at 493 bp. Similarly, Figure 5C PCR of the heavy chain region of the intact antibody showed a band at 370 bp, whereas no band was shown for the non-expressed headless antibody.

[0068] exist Fig. 6A , Western blot results show successful generation of non-expressed headless antibody. The expected size of the intact antibody is 144.64 kDa and is clearly indicated by the bands in the left two columns, while for the promoter-less headless antibody, no bands are shown in the right two columns. Figure 6B Also shown is the successful production of intact and headless antibodies by FACS analysis of their functionality and expression. The results show that similar to the control, the headless antibody was not bound or expressed.

[0069] In some embodiments, a method for preparing a cell producing an antibody is provided herein, the method further comprising introducing a promoter operably connected to a sequence encoding an antibody heavy chain region and a promoter operably connected to a sequence encoding an antibody light chain region. In some embodiments, the method further comprises introducing a promoter operably connected to a sequence encoding an antibody.

[0070] In some embodiments, a method for preparing a cell producing an antibody is provided herein, the method further comprising introducing a first sequence encoding a first selectable marker and a second sequence encoding a second selectable marker. In some embodiments, the method further comprises selecting cells expressing the antibody using the first selectable marker. In some embodiments, the method further comprises selecting cells expressing the antibody using the second selectable marker. In some embodiments, the method further comprises selecting cells expressing the antibody using the first selectable marker and the second selectable marker. In some embodiments, the method further comprises expressing the antibody in the cell.

[0071] Methods for amplifying cells produced using the methods described herein are known in the art, as are methods for recovering antibodies produced thereby. Such methods include, for example, various column filtration methods, washing steps, and bead-based magnetic separation methods, etc.

[0072] It will be apparent to those skilled in the relevant art that other suitable modifications and adaptations may be made to the methods and applications described herein without departing from the scope of any embodiment.

[0073] It should be understood that although certain embodiments have been shown and described herein, the claims are not limited to the specific forms or arrangements of the parts described and shown. Illustrative embodiments have been disclosed in this specification, and although specific terms are employed, they are used in a general and descriptive sense only and not for the purpose of limitation. In view of the above teachings, modifications and variations to the described embodiments are possible. Therefore, it should be understood that the described embodiments may be practiced in a manner different from that specifically described.

[0074] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0075] Examples

[0076] Example 1: Seamless integration of heavy and light chain variable regions into a non-expressed headless IgG antibody

[0077] method

[0078] Cells with non-expressing headless IgG antibodies (where one chain encodes the heavy chain constant region and the opposite chain encodes the light chain constant region) were cultured at 0.3 x 10 6The cells were subcultured into Erlenmeyer shake-flasks (CD-CHO medium) of appropriate size at a feasible concentration of 10 cells / mL. Guide RNAs were selected and prepared for nuclear transfection. 100 μg of DNA template consisting of the VL domain encoded on one chain and the VH domain on the other chain was briefly centrifuged to collect the contents and resuspended with 25 μl of TE buffer to obtain a concentration of 4 μg / μl.

[0079] Prepare Cas9 RNP complex according to Table 1.

[0080] Table 1: RNP complexes

[0081]

[0082]

[0083] The complexes were incubated at room temperature for 30-60 minutes.

[0084] By placing 17x10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare cells with non-expressed headless IgG antibodies for nuclear transfection. The DNA template according to Table 1 was added to the appropriate Cas9 RNP complex prepared. The cells were then resuspended in 1196.8 μl of nuclear transfection solution (1250 μl of SF solution was prepared by mixing 1025 μl of SF solution with 225 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0085] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofection unit using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and 80 μ l of 10 ml CD-CHO culture medium pre-warmed to 36.5 ° C are added and mixed. The final mixture of 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5 ° C. The cells are then incubated for 48 hours at 36.5 ° C, 5% CO2 in a static incubator.

[0086] result

[0087] Integration efficiency was assessed using PCR, NGS, FACS analysis, and Western blot analysis.

[0088] Example 2: Seamless integration of heavy and light chain variable regions into a non-expressed headless IgG antibody

[0089] method

[0090] Cells with non-expressing headless IgG antibodies (where one chain encodes the heavy chain constant region and the opposite chain encodes the light chain constant region) were cultured at 0.3 x 10 6 The cells were subcultured into Erlenmeyer shake flasks (CD-CHO medium) of appropriate size at a viable concentration of 10 cells / mL. A guide RNA (sgRNA #30) with the following sequence (5' to 3'): ccacggtccgcttCCATGCA (SEQ ID NO: 1) was selected and prepared for nuclear transfection. 100 μg of DNA template consisting of the VL domain encoded on one chain and the VH domain on the other chain was briefly centrifuged to collect the contents and resuspended with 19.3 μl of TE buffer to obtain a concentration of 5.2 μg / μl.

[0091] Figure 7 Schematic diagrams of various DNA templates for integrating both the heavy chain variable region and the light chain variable region into the genomic sequence of a headless antibody are shown, wherein the heavy chain constant region and the light chain constant region are located on opposite strands of the genomic nucleic acid. The DNA template contains a puromycin sequence for antibiotic selection and a promoter sequence connected to the heavy and light chain variable region sequences. dsDNA #6 was selected as the DNA template for preparing the Cas9 RNP complex for transfection.

[0092] Prepare Cas9 RNP complex according to Table 2.

[0093] Table 2: RNP complexes

[0094]

[0095] The complexes were incubated at room temperature for 30-60 minutes.

[0096] By placing 8x10 6 The cells were transferred to a new tube and centrifuged at 200 g for 5 minutes to remove as much culture medium as possible to prepare cells with non-expressed headless IgG antibodies for nuclear transfection. The DNA template according to Table 2 was added to the appropriate Cas9 RNP complex prepared. The cells were then resuspended in 563.2 μl of nuclear transfection solution (492 μl of SF solution and 108 μl of supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0097] 20 μ l of cell-nucleofection solution-RNP complex mixture is transferred to the cuvette in the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofection unit using program DU-158. After nucleofection, the cells are placed in the nucleofection cuvette for 10 minutes, and 80 μ l of 10 ml CD-CHO culture medium pre-warmed to 36.5 ° C are added and mixed. The final mixture of 100 μ l is transferred to a 12-well plate with 1.5 ml of CD-CHO culture medium, maintained in an incubator at 36.5 ° C. The cells are then incubated in a static incubator at 36.5 ° C, 5% CO2 for 24 hours.

[0098] After 24 hours, the medium was replaced with CD-CHO + 6ug / mL puromycin. The cells were grown in a static incubator until the negative control died. Cell viability was assessed using the Vi-Cell device.

[0099] Figure 8 The recovery of cells after puromycin antibiotic selection for cells transfected with heavy and light chain variable regions is shown. Negative control recovery of cells with DNA template and gRNA as indicated by *, where the two rightmost lines indicate the recovery of cells transfected with heavy and light chain variable regions using the DNA templates described herein.

[0100] result

[0101] like Fig. 9A The FACS analysis shown demonstrates successful production of intact antibodies by seamless integration of heavy and light chain variable regions into the headless cell line. Fig. 9B The antibody expression as verified by WB was shown, and the complete antibody was successfully produced by seamless integration of the heavy and light chain variable regions into the headless cell line. As expected, the non-expressing headless antibody did not show any binding or expression, while the successful integration of the heavy and light chain variable regions with the promoter produced the complete antibody.

[0102] dsDNA #6 sequence (5' to 3'):

[0103] tgtgcttctcgtagtcggccttggacagggtcagggtggaggacaggctgtaggtgctgtccttggagtcctgctcggtgacggatt

[0104] cctgggagttgccggactgcagggcgttgtccaccttccactgcaccttggcctcgcgggggtagaagttgttcagcaggcagac

[0105] cacgctggcggtgccggacttcagctgctcgtcggagggtgggaagatgaacacggagggagcggccacggtccgcttgatttc

[0106] cagcttggtgcctccgccgaaggtgggggggttggaggtccactgctggcagtagtaggtggcggcgtcctcggcttccacccg

[0107] ggagatggtcagggagtaggaggtgccagagccagagccggagaaccgcacgggcacgccagaggccaggttggaggtgg

[0108] cgtagatccagggcttggggctggagccgggcttctgctggaaccagtggatgtaggacacggaggaggaggcccggcaggtc

[0109] attgtcactttctcgccagggctggcggacaggatggcaggggactgggacagcacgatctggccccgagacatgatcacggag

[0110] gcggagatcagcagaaaggagatgatctgcacctggaagtccatggtggcggcgacttcagaaaagacccatggaaaggaaca

[0111] gtctgttagtctgtcagctattatgtctggtggcgcgcgcggcagcaacgagtactgctcagactacactgccctccaccgttaacag

[0112] caccgcaacgggagttacctctgactcttatcagaacacaacaactcagctgcctgcatcttcttctgccgctgccttaagtcttccaa

[0113] atgcgtcagcggtgcaagcccgctccccgagctcattttcagacacataccctaccgccacggccttgtgcggcacactggtggtg

[0114] gtgggcatcgtgctgtgcctaagtctggcctccactgttaggagcaaggagctgccgagcgaccatgagtcgctggaggcatggg

[0115] agcagggctcggatgtagaagctccgccgctaccggagaagagcccatgtccggaacacgtacccgagattcgcgtggagatc

[0116] ccacgttatgtttaataaaaactgcgggcactggggacggtggtgttgtatatgtgaatttgtaaataataaatgagaccccatcctgta

[0117] aaaatacagagtccgtgtcagtctctgaaggacagtgtattggcatatagccaataaagagagttgtggcaaagagccatgttatgg

[0118] attagtaatggaaagtatcgtcaccaataggggagtggtcaataatggtcaataacccacacctataggctaagctataccatcacct

[0119] ataacatgaggaagcgggggtgtatagaccccaagccaaaaacagtatagcatgcataagaagccaagggggtgggcctatag

[0120] actctataggcggtacttacgtcactcttggcacggggaatccgcgttccaatgcaccgttcccggccgcggaggctggatcggtc

[0121] ccggtgtcttctatggaggtcaaaacagcgtggatggcgtctccaggcgatctgacggtaccgacgctggtcgcgcctcttatacc

[0122] cacgtagaacgcagctcagccaatagaatgcgtgccaatatggaatttccaggggaaaaccggggcggtgttacgttttggctgcc

[0123] ctttcacttcccattgacgtgtattggctcgagaacggtactttcccattaatcagctatgggaaagtaccgtttaaaggtcacgttgcat

[0124] tagtttcaatagcccattgacgtcaatggtgggaaagtacatggcgttttaattaaattggctggaaaaacccaatgactcacccctatt

[0125] gaccttatgtacgtgccaataatgggaaaaacccattgactcaccccctattgaccttttgtactgggcaaaacccaatggaaagtcc

[0126] ctattgactcagtgtacttggctccaatgggactttcctgttgattcacccctattgaccttatgtactgggcaaaacccattggaaagtc

[0127] cctaatgactcagtaccagAACGatgattagacttagtactgccttttcctagtactcccccccgccagactgaggcggaaagaa

[0128] ccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaatt

[0129] agtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccat

[0130] agtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttat

[0131] gcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaCGat

[0132] gaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtcccccgggccgtacgcaccctcgccgccgcgttcgcc

[0133] gactaccccgccacgcgccacaccgtcgacccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcg

[0134] cgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcga

[0135] agcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaa

[0136] ggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagg

[0137] gtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgcc

[0138] ccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcat

[0139] gacccgcaagcccggttaagcgggatccaccggatctagtaagatacattgatgagtttggacaaaccacaactagaatgcagtg

[0140] aaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttatgattagacttagtact

[0141] gccttttcctagtactcccccccgccagactgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtcccc

[0142] aggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagc

[0143] aggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgc

[0144] ccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccaga

[0145] agtagtgaggaggcttttttggaggcctaggcttttgcaaaatcagatcgcctggagacgccatccacgctgttttgacctccataga

[0146] agacaccgggaccgatccagcctccgcggccgggaacggtgcattggaacgcggattccccgtgccaagagtgacgtaagtac

[0147] cgcctatagagtctataggcccacccccttggcttcttatgcatgctatactgtttttggcttggggtctatacacccccgcttcctcatgt

[0148] tataggtgatggtatagcttagcctataggtgtgggttattgaccattattgaccactcccctattggtgacgatactttccattactaatc

[0149] cataacatggctctttgccacaactctctttattggctatatgccaatacactgtccttcagagactgacacggactctgtatttttacagg

[0150] atggggtctcatttattatttacaaattcacatatacaacaccaccgtccccagtgcccgcagtttttattaaacataacgtgggatctcc

[0151] acgcgaatctcgggtacgtgttccggacatgggctcttctccggtagcggcggagcttctacatccgagccctgctcccatgcctcc

[0152] agcgactcatggtcgctcggcagctccttgctcctaacagtggaggccagacttaggcacagcacgatgcccaccaccaccagtg

[0153] tgccgcacaaggccgtggcggtagggtatgtgtctgaaaatgagctcggggagcgggcttgcaccgctgacgcatttggaagact

[0154] taaggcagcggcagaagaagatgcaggcagctgagttgttgtgttctgataagagtcagaggtaactcccgttgcggtgctgttaa

[0155] cggtggagggcagtgtagtctgagcagtactcgttgctgccgcgcgcgccaccagacataatagctgacagactaacagactgtt

[0156] cctttccatgggtcttttctgaagatcggcggtggatgggctggtccctgatcctgctgttcctggtcgccgtggccacccgggtgct

[0157] gtctcaggtgcagctgcagcagcctggcgccgagctggtcaaacctggcgcctccgtgaagatgtcctgcaaggcctccggcta

[0158] caccttcaccagctacaacatgcactgggtcaaacagacccccggcagaggcctggaatggatcggcgccatctaccccggcaa

[0159] cggcgacacctcctacaaccagaagttcaagggcaaggccaccctgaccgccgacaagtcctcctccaccgcctacatgcagct

[0160] gtcctccctgacctccgaggactccgccgtgtactactgcgcccggtccacctactacggcggcgactggtacttcaacgtgtggg

[0161] gcgctggcaccaccgtgaccgtgtcttctgcttccaccaagggcccctccgtgttccctctggccccctccagcaagtccacctctg

[0162] gcggcaccgctgccctgggctgcctggtcaaagactacttccccgagcccgtgacagtgtcctggaactctggcgccctgaccag

[0163] cggcgtgcacaccttccctgccgtgctgcagtcctccggcctgtactccctgtccagcgtggtcacagtgccctcctccagcctgg

[0164] gcacccagacctaca(SEQ ID NO:2)

Claims

1. A cell comprising a genomic nucleic acid sequence, wherein the genomic nucleic acid sequence comprises, a first sequence encoding antibody heavy chain constant regions 1, 2 and 3 on one strand of the genomic nucleic acid sequence, wherein the first sequence is not flanked by sequences encoding antibody heavy chain variable regions, and A second sequence, wherein the second sequence encodes an antibody light chain constant region 1 on the opposite strand of the genomic nucleic acid sequence, wherein the second sequence is not flanked by a sequence encoding an antibody light chain variable region.

2. The cell of claim 1, further comprising a sequence encoding a selectable marker.

3. The cell according to claim 1 or 2, further comprising a sequence encoding a gene editing protein.

4. The cell of claim 3, wherein the gene editing protein is a Cas gene editing protein.

5. The cell according to claim 3, wherein the gene editing protein is selected from Cas9, Cas12, Cas12i2TALENS, MAD7 nuclease and zinc finger nuclease.

6. The cell of claim 5, wherein the gene editing protein is Cas9.

7. The cell of any one of claims 1 to 6, wherein the gene editing protein sequence is operably linked to an inducible promoter.

8. The cell according to claim 7, wherein the inducible promoter is the TET-on system.

9. The cell of any one of claims 1 to 8, further comprising a first promoter operably linked to the first sequence and a second promoter operably linked to the second sequence.

10. The cell according to any one of claims 1 to 9, wherein the cell is a high-expressing stable clone.

11. The cell of claim 10, wherein the cell is a Chinese Hamster Ovary (CHO) cell.

12. A method for producing editable cells, the method comprising: Introducing a first sequence encoding antibody heavy chain constant regions 1, 2, and 3 on one chain of the cell's genomic nucleic acid sequence; and A second sequence encoding an antibody light chain constant region 1 is introduced on the opposite strand of the genomic nucleic acid sequence of the cell.

13. The method of claim 12, further comprising introducing a sequence encoding a selectable marker.

14. The method according to claim 12 or 13, further comprising introducing a sequence encoding a gene editing protein into the genomic nucleic acid sequence.

15. The method of claim 14, wherein the gene editing protein is a Cas gene editing protein.

16. The method of claim 14, wherein the gene editing protein is selected from Cas9, Cas12, Cas12i2, TALENS, MAD7 nuclease and zinc finger nuclease.

17. The method of claim 16, wherein the gene editing protein is Cas9.

18. The method of any one of claims 12 to 17, wherein the gene editing protein sequence is operably linked to an inducible promoter.

19. The method of claim 18, wherein the inducible promoter is a TET-on system.

20. The method of any one of claims 12 to 19, further comprising introducing a first promoter operably linked to the first sequence and a second promoter operably linked to the second sequence.

21. The method according to any one of claims 12 to 20, wherein the cell is a high expressing stable clone.

22. The method of claim 21, wherein the cells are Chinese Hamster Ovary (CHO) cells.

23. A method for preparing a cell that produces an antibody, the method comprising: Providing a cell according to any one of claims 1 to 11; Introducing a sequence encoding an antibody heavy chain variable region into the first sequence upstream of the antibody heavy chain constant region; and A sequence encoding an antibody light chain variable region is introduced into the second sequence upstream of the antibody light chain constant region 1.

24. The method of claim 23, further comprising introducing a first promoter operably linked to the sequence encoding the antibody heavy chain variable region and a second promoter operably linked to the sequence encoding the antibody light chain variable region.

25. The method of claim 23 or 24, further comprising expressing the antibody in the cell.

26. The method according to any one of claims 23 to 25, further comprising introducing a sequence encoding a selectable marker.

27. The method of claim 26, further comprising selecting cells expressing the antibody using the selectable marker.

28. A method for preparing a cell that produces an antibody, the method comprising: A single guide RNA is used to introduce a sequence encoding the antibody heavy chain variable region into a first sequence upstream of the antibody heavy chain constant region on one chain of the genomic nucleic acid sequence of the cell, and a sequence encoding the antibody light chain variable region is introduced into a second sequence upstream of the antibody light chain constant region 1 on the opposite chain of the genomic nucleic acid sequence of the cell.

29. The method of claim 28, further comprising introducing a first promoter having the sequence encoding the antibody heavy chain variable region.

30. The method of claim 29, wherein the first promoter is operably linked to the sequence encoding the antibody heavy chain variable region.

31. The method according to any one of claims 28 to 30, further comprising introducing a second promoter having the sequence encoding the antibody light chain variable region.

32. The method of claim 31, wherein the second promoter is operably linked to the sequence encoding the antibody light chain variable region.

Images