NtMIXTA-like gene, its coding protein, biological material and application in plant gland hair development regulation

Abstract

The application discloses a kind of NtMIXTA-like Gene, its encoding protein, biological material and application in plant gland hair development regulation, to solve the technical problem of single function of existing gland regulation gene.The gene of the present application is cloned from tobacco NtMIXTA-like Gene, respectively constructs the knockout and overexpression plant of NtMIXTA-like Gene, and the leaf gland of it is analyzed to find, NtMIXTA-like Overexpression gland density increases significantly, which shows that NtMIXTA-like NtMIXTA-like Gene can positively regulate tobacco gland development / development.The present application has important significance to the molecular regulation network of plant gland development.

Description

Technical Field

[0001] This invention application relates to the field of genetic engineering breeding technology, specifically to a... NtMIXTA-like Genes, their encoded proteins, biomaterials, and their applications in the regulation of plant glandular trichomes. Background Technology

[0002] Many plants (such as tobacco) are covered with numerous epidermal hairs, among which those with secretory functions are called glandular hairs. Tobacco glandular hairs are further subdivided into long-stalked and short-stalked glandular hairs based on the number of stalk cells. Long-stalked glandular hairs have multiple stalk cells and can synthesize and release secondary metabolites such as diterpenes and sucrose esters; while short-stalked glandular hairs contain only one stalk cell and are responsible for synthesizing and secreting Phylloplain, a protein with antifungal properties.

[0003] Tobacco glandular trichomes play a crucial role in enhancing the environmental adaptability of tobacco plants and improving the aroma quality of tobacco leaves. Firstly, they act as a natural physical barrier, effectively blocking the movement of pests and reducing their feeding on tobacco leaves, thus strengthening the plant's self-protection capabilities. Secondly, the chemical substances secreted by tobacco glandular trichomes possess strong biological activity, not only having a toxic and repellent effect on pests, but also containing resistance proteins such as Phylloplain, which significantly reduce the likelihood of tobacco suffering from fungal diseases, further enhancing the plant's disease resistance. More importantly, these secretions are rich in diterpenoids, sucrose esters, and other aroma precursors. During tobacco processing, aging, and combustion, these precursors gradually degrade and transform into small-molecule volatile components, which are essential for the unique aroma of tobacco leaves. Therefore, increasing the density of tobacco glandular trichomes is crucial. However, due to the small size of tobacco glandular trichomes, direct field screening for trichome density is difficult, posing a significant challenge to traditional breeding methods in developing tobacco varieties with high glandular trichome density.

[0004] In-depth research into the genes regulating glandular trichome density and the use of modern biotechnology such as genetic engineering to create new tobacco varieties with high glandular trichome density is of profound significance for tobacco production. Although some genes regulating glandular trichome development have already been discovered in tobacco, such as... NtCycB2, NtHD9, NtHD12 However, these genes only regulate the density of long-stalked glandular trichomes and have no effect on the density of short-stalked glandular trichomes. Therefore, finding genes that can simultaneously regulate the density of both long-stalked and short-stalked glandular trichomes in tobacco is of great application value for breeding new tobacco varieties with high glandular trichome density.

[0005] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] In view of at least one of the above technical problems, this disclosure provides a NtMIXTA-like The study explores genes, their encoded proteins, biomaterials, and their applications in the regulation of plant glandular trichome development, aiming to address the technical problem of existing glandular trichome regulatory genes having limited functions (e.g., only involved in the regulation of long-stalked glandular trichomes, without affecting the density of short-stalked glandular trichomes).

[0007] According to the first aspect of this disclosure, a method is provided NtMIXTA-like The gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] According to a second aspect of this disclosure, a method is provided. NtMIXTA-like The gene encodes a protein whose amino acid sequence is shown in SEQ ID NO.2.

[0009] According to a third aspect of this disclosure, a biomaterial is provided containing the aforementioned... NtMIXTA-like Genes or fragments thereof.

[0010] In some embodiments of this disclosure, the biological material is any one of nucleic acid molecules, overexpression vectors, host cells, engineered bacteria, or transformed plant cells.

[0011] According to the fourth aspect of this disclosure, the aforementioned NtMIXTA-like The gene, the encoded protein, or the biological material is used in any of the following (1) to (7):

[0012] (1) Application in positive regulation of plant glandular trichome development or in the preparation of reagents for positive regulation of plant glandular trichome development;

[0013] (2) Application in positive regulation of plant glandular hair density traits or in the preparation of reagents for positive regulation of plant glandular hair density traits;

[0014] (3) Application in regulating plant glandular hair type or in preparing reagents for regulating plant glandular hair development type;

[0015] (4) Application in the selection / identification of varieties / strains with relevant plant glandular hair density traits;

[0016] (5) Application in the construction or breeding of transgenic plants with increased glandular trichome density;

[0017] (6) Application in enhancing plant stress resistance or in the preparation of reagents that enhance plant stress resistance;

[0018] (7) Application in improving the aroma quality of plants or in breeding plant varieties / strains with high aroma quality.

[0019] In some embodiments of this disclosure, the expression or upregulation of the... NtMIXTA-like Gene.

[0020] In some embodiments of this disclosure, the plant includes tobacco.

[0021] In some embodiments of this disclosure, the plant glandular hairs include at least one of long-stalked glandular hairs and short-stalked glandular hairs.

[0022] According to a fifth aspect of this disclosure, a method for improving tobacco glandular trichome density / aroma quality is provided, comprising the following steps:

[0023] (1) Constructing a structure containing the above NtMIXTA-like Gene overexpression vectors;

[0024] (2) Transform the overexpression vector into tobacco tissues or cells;

[0025] (3) Make the above NtMIXTA-like The gene is overexpressed in tobacco tissues or cells.

[0026] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages:

[0027] Cloned from tobacco NtMIXTA-like The gene, whose coding region is 1221 bp in length and encodes 406 amino acids, was constructed from these. NtMIXTA-like Gene knockout and overexpression plants, and analysis of their leaf glandular trichomes, revealed that... NtMIXTA-like Overexpression significantly increased the density of glandular trichomes (especially short-stalked glandular trichomes, whose density increased by 317.6%~355.4% compared to the control), indicating that... NtMIXTA-like Genes can positively regulate the occurrence / development of tobacco glandular trichomes. This application provides a new approach for studying and understanding the molecular regulatory network of plant glandular trichome occurrence. Attached Figure Description

[0028] Figure 1 Tobacco as an embodiment of this application NtMIXTA-like Cloning of gene CDS sequences.

[0029] Figure 2 This is the structure of the overexpression vector pC2300-35S-GFP-rbcs in one embodiment of this application.

[0030] Figure 3 As shown in one embodiment of this application NtMIXTA-like PCR identification of overexpression vector in bacterial culture; where M: marker; 1: negative control; 2: positive control; 3-8: positive monoclonal bacterial culture.

[0031] Figure 4 In one embodiment of this application, the overexpressing plant NtMIXTA-like Gene expression level detection.

[0032] Figure 5 This is a schematic diagram of the knockout carrier structure in one embodiment of this application.

[0033] Figure 6 As shown in one embodiment of this application NtMIXTA-like PCR identification of gene knockout vectors in bacterial culture; where M: marker; 1: negative control; 2: positive control; 3-8: bacterial culture.

[0034] Figure 7 As shown in one embodiment of this application NtMIXTA-lik Sequencing analysis of homozygous knockout single-plant mutations in the e gene.

[0035] Figure 8 As shown in one embodiment of this application NtMIXTA-like Observation of leaf glandular hairs in gene knockout and overexpression plants.

[0036] Figure 9 As shown in one embodiment of this application NtMIXTA-like Statistics on the density of glandular hairs on the leaf surface of gene knockout and overexpression plants. Detailed Implementation

[0037] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the detection methods involved are all conventional methods unless otherwise specified.

[0038] To better understand the technical solution of this application, the above technical solution will be described in detail below with reference to the accompanying drawings and specific embodiments. However, the following embodiments are only used to illustrate this application in detail and do not limit the scope of this application in any way.

[0039] Example 1: Tobacco NtMIXTA-like Cloning of genes

[0040] In this example, specific primers (F1: 5'-ATGGGTCGATCTCCATGTTG-3', R1: 5'-GAACATAGCCGAATCAG-3') were designed to amplify cDNA from tobacco leaves by PCR, and the resulting clones were obtained. NtMIXTA - like Gene( Figure 1 The full length of the coding region of this gene is 1221 bp (as shown in SEQ ID NO.1) and encodes 406 amino acids (as shown in SEQ ID NO.2).

[0041] Example 2 NtMIXTA-like Creation of gene overexpression materials

[0042] In order to investigate NtMIXTA-like The function of genes was explained in this example. NtMIXTA-like Creation of gene overexpression materials.

[0043] 1. Construct the overexpression vector, based on the overexpression vector pC2300-35S-GFP-rbcS ( Figure 2 Multiple cloning sites and NtMIXTA-like Based on the restriction enzyme sites contained in the CDS sequence, primers containing restriction adapters (F2: 5'-CGGGATCCATGGGTCGATCTCCATGTTG-3', R2: 5'-GCGTCGACGAACATAGCCGAATCAG-3') were designed for PCR amplification of cDNA in tobacco leaves. After agarose gel recovery, the PCR amplification products were double-digested with the empty vector pC2300-35S-GFP-rbcS using BamHI and SalI, respectively. The PCR amplification products and the digested products of the pC2300-35S-GFP-rbcS empty vector were then recovered from the agarose gel and ligated using T4 DNA ligase. The ligation products were transformed into competent E. coli cells and selected by PCR. Figure 3 Through sequencing, positive monoclonal antibodies were successfully screened.

[0044] 2. Obtaining overexpressing plants: Extract from the above-mentioned positive monoclonal bacterial culture NtMIXTA-like The overexpression vector plasmid was used to infect leaves of tobacco variety K326 using Agrobacterium-mediated transformation, successfully obtaining 29 positive transgenic plants. RNA was extracted from the positive transgenic plants, and specific primers (F3: 5'-TTAGGGAATAGGTGGTCGGC-3', R3: 5'-CCGTCATTGGACAAGAGGGT-3') were designed for detection using real-time quantitative PCR. NtMIXTA-like Gene expression levels were screened, and nine transgenic plants with expression levels higher than the control were obtained. Figure 4 From this, three individual plants were selected: plants numbered 6 and 29, which had the highest relative expression levels, and plant number 24, which had a moderate expression level. These were named... NtMIXTA-like -OE6、 NtMIXTA-like -OE29 and NtMIXTA-like -OE24, used for subsequent tests.

[0045] Example 3 NtMIXTA-like Gene knockout material creation

[0046] 1. Construction of the knockout vector: Using the online design tool (https: / / zlab.bio / guide-design-resources) NtMIXTA-likeDesign gRNA target site sequences in the coding region of genes (ACTGACCGTCATTGGACAAG) AGG The underlined region is the PAM region. A BsaI restriction site is added, and the target site sequence and its reverse complementary sequence are chemically synthesized. After annealing, an Oligo dimer is formed. The vector Cas-PF (…) is cleaved using the restriction endonuclease BsaI at 37°C. Figure 5 After single-enzyme digestion and gel recovery, the DNA was ligated with the target sequence Oligo dimer using T4 DNA ligase. The ligation product was transformed into competent E. coli cells and subjected to colony PCR. Figure 6 Through sequencing and screening, positive monoclonal antibodies were successfully obtained.

[0047] 2. Obtaining the knockout vector: Extract from the above-mentioned positive monoclonal bacterial culture NtMIXTA-like The vector plasmid was knocked out, and K326 leaves were infected using Agrobacterium-mediated transformation, successfully obtaining 13 positive transgenic plants. Genomic DNA was extracted from each plant, and primers (F4: TGACATTAAGATACGTCCAAAC, R4: GACTAGAAGGTGAAGTGGTAG) were designed upstream and downstream of the target site for PCR amplification. The PCR products were sequenced to screen for single plants with base mutations at the target site. The results showed that ( Figure 7 ), resulting in 13 individual plants NtMIXTA-like Mutations were generated in the sgRNA region of all genes, among which three single plants had homozygous mutations: single plant 29 had an insertion of a T base; single plant 31 had a deletion of a CA base; and single plant 34 had a deletion of a GGAC base. These were named NtMIXTA-like-KO29, NtMIXTA-like-KO31, and NtMIXTA-like-KO34, respectively, for subsequent experiments.

[0048] Example 4 NtMIXTA-like Morphological observation and density analysis of glandular hairs in transgenic plants

[0049] This example observes the phenotypic morphology and density of glandular trichomes in the transgenic plants (overexpression lines and gene knockout lines) obtained in the above examples. Plants with normal growth and uniform size were selected. NtMIXTA-like Knockout and overexpression plants were selected, and leaves of the same size and position were cut. The glandular trichomes on the leaf surface were observed under a microscope. The results are as follows: Figure 8 , Figure 9 As shown, compared with the control, the leaf glandular trichome density of the three knockout lines was slightly lower than that of the control, with the density of long-stalked glandular trichomes decreasing by 12.3%-25.4% and that of short-stalked glandular trichomes decreasing by 23.5%-33.1%. Conversely, the leaf glandular trichome density of the three overexpression lines increased significantly, with the density of long-stalked glandular trichomes increasing by 34.6%-40.2% and that of short-stalked glandular trichomes increasing by 317.6%-355.4%. This indicates… NtMIXTA-like The gene is a positive regulator of tobacco glandular trichomes.

[0050] Although some preferred embodiments of this application have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this application.

[0051] Obviously, those skilled in the art can make various modifications and variations to this application without departing from the spirit and scope of its inventive concept. Therefore, if such modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include such modifications and variations.

Claims

1. The nucleotide sequence is as shown in SEQ ID NO.

1. NtMIXTA-like The use of a gene, its encoded protein, or biological material containing the gene in any of the following (1) to (4): (1) Application in positive regulation of plant glandular trichome development or in the preparation of reagents for positive regulation of plant glandular trichome development; (2) Application in positive regulation of plant glandular hair density traits or in the preparation of reagents for positive regulation of plant glandular hair density traits; (3) Application in the selection / identification of varieties / strains related to the density trait of plant glandular hairs; (4) Application in the construction or breeding of transgenic plants with increased glandular trichome density; Its features are, Overexpression or upregulation of the expression NtMIXTA-like The gene can increase the density of glandular hairs; the plant glandular hairs are at least one of long-stalked glandular hairs and short-stalked glandular hairs; the plant is tobacco; the biological material is any one of nucleic acid molecules, overexpression vectors, host cells, and engineered bacteria.

2. A method for increasing the density of tobacco glandular trichomes, characterized in that, Includes the following steps: (1) Construct a nucleotide sequence as shown in SEQ ID NO.1 NtMIXTA-like Gene overexpression vectors; (2) Transform the overexpression vector into tobacco tissues or cells; (3) Make the above NtMIXTA-like The gene is overexpressed in tobacco tissues or cells.

Images