Efficient preparation method of ABC transporter rollover vesicles

Abstract

The invention discloses an efficient preparation method of ABC transporter turnover vesicles. The efficient preparation method comprises the following steps: S1, plasmid extraction; s2, preparing cells before transfection: recovering the HEK293 cells, and carrying out passage until the growth state of the cells is good; s3, transfection is carried out; s3.1, the total use amount of the KPM buffer solution is 1 / 10 of that of the cell suspension, and the use amount of plasmids is 1 microgram per milliliter of the cell suspension; s3.2, preparing two sterile centrifugal tubes, adding a transfection buffer solution KPM and sterile plasmid DNA into one of the two sterile centrifugal tubes, and gently blowing, beating and uniformly mixing; adding a transfection buffer solution KPM and a transfection reagent TA-293 into the other branch, and gently blowing, beating and uniformly mixing; s3.3, transferring all liquid in the centrifugal tube containing the transfection reagent into a centrifugal tube containing plasmids, and gently blowing, beating and uniformly mixing; s3.4, standing and incubating for a period of time at room temperature; and S4, preparing the rollover vesicles. According to the invention, transfection plasmids and cells HEK293 to be transfected are prepared, and the cells are transfected by adopting a TA-293 transfection reagent, so that the ABC transporter turnover vesicles can be efficiently prepared.

Description

Technical Field

[0001] The invention relates to the technical field of gene transfection, in particular to a method for efficiently preparing ABC transporter mold-reversing vesicles. Background Art

[0002] ABC transporters (ATP-binding cassette transporters) are a class of transport proteins that use the energy generated by ATP hydrolysis to expel substances out of cells against concentration. Their ATP-binding subunits were identified in 1986, and they were officially named ABC transporters in 1990.

[0003] ABC transporters have attracted wide attention in the field of tumor treatment because of their ability to confer multidrug resistance to cells. With the development of biotechnology, ABC transporters have been widely used in biomedicine, biofuels, microbial industrial production and other fields.

[0004] Application of ABC transporters in improving the performance of industrial strains: ABC transporters can pump substances into or out of cells like a pump, and regulate membrane permeability by regulating the function of membrane proteins. In microbial industrial production, engineered ABC transporters are used to improve the performance of industrial strains, enhance strain tolerance and increase the yield of target products.

[0005] In vitro research models of ABC transporters: In vitro research models of ABC transporters mainly include membrane vesicle models, polarized monolayer cell models, and "sandwich" cultured hepatocyte models. Among them, the membrane vesicle model is prepared by infecting insect cells or transfecting mammalian cells, and the vesicles are turned inside out through a special process to form "inside-out" or "inverted" membrane vesicles, so that the substrate binding site is exposed outside the vesicle, which is convenient for drug-drug interaction (DDI) studies.

[0006] Preparation and application of ABC transporter vesicles: ABC transporter vesicles are prepared from HEK293 cells overexpressing specific ABC transporters. These "inside-out" vesicles provide high levels of transporter activity and can be used to evaluate the interaction potential of early candidate drugs and substrates. Summary of the invention

[0007] The purpose of the present invention is to provide an efficient preparation method of ABC transporter molded vesicles to solve the problems in the prior art.

[0008] To achieve the above object, the present invention provides the following technical solution: an efficient preparation method of ABC transporter remodeling vesicles, comprising the following steps:

[0009] S1, plasmid extraction;

[0010] S2. Cell preparation before transfection: thaw HEK293 cells and passage them until the cells grow well;

[0011] S3, transfection;

[0012] S3.1, the total amount of KPM buffer used is 1 / 10 of the cell suspension, the amount of plasmid used is 1 μg per ml of cell suspension; the ratio of plasmid: transfection reagent = 1:5;

[0013] S3.2. Prepare two sterile centrifuge tubes, add transfection buffer KPM and sterile plasmid DNA to one of them, and gently pipette to mix; take the other tube and add transfection buffer KPM and transfection reagent TA-293, and gently pipette to mix;

[0014] S3.3. Transfer all the liquid in the centrifuge tube containing the transfection reagent to the centrifuge tube containing the plasmid and mix by gently pipetting;

[0015] S3.4, incubate at room temperature for a period of time;

[0016] S3.5. Take out the cells from the shaker, mark the shake flask, slowly add the incubated plasmid complex while shaking, and put the shake flask back into the shaker for incubation;

[0017] S3.6, 24 h after transfection, add supplementary materials, transient transfection nutrient additive 50×KT-Feed, expression enhancer KE-293, and return the shake flask to the shaker for culture;

[0018] S3.7. After the protein reaches the highest value after a period of time after transfection, take out the shaking bottle for subsequent purification;

[0019] S4. Preparation of molded vesicles.

[0020] Preferably, the plasmid extraction in S1 is performed by using an endotoxin-free plasmid extraction kit; and the cell viability during transfection in S2 needs to be above 95%.

[0021] Preferably, the TA-293 transfection reagent in S3.1 needs to be activated at 60°C for 10 minutes before use and stored at 4°C.

[0022] Preferably, if the S3 transfects 100 ml of cells;

[0023] You need to prepare two 15ml sterile centrifuge tubes, add 5ml transfection buffer KPM and 100ug sterile plasmid DNA to one of them, and add 5ml transfection buffer KPM and 500ul transfection reagent TA-293 to the other one;

[0024] Transient transfection nutrient additive 50×KT-Feed 2.2 ml, expression enhancer KE-293 0.6 ml, the working concentration of expression enhancer KE-293 is 0.6%, and the stock solution of expression enhancer KE-293 is 100%.

[0025] Preferably, the S4 specifically comprises the following steps:

[0026] S4.1. Collection and washing: The transfected cells were collected, centrifuged for a period of time, and then suspended in 1 mL of PDP solution;

[0027] S4.2, cell disruption: disrupt the cell pellet by ultrasonic disruption;

[0028] S4.3, Centrifugal washing: After the first centrifugation, aspirate the supernatant and add it to the surface of 46% (w / w) sucrose solution. Centrifuge again and aspirate the white capsule at the junction of the two liquid surfaces and place it in a clean tube. Wash with PMD twice;

[0029] Aliquot and store: add an appropriate amount of PMD solution to the precipitate, blow it gently with a pipette tip repeatedly to disperse it evenly, and filter it through a 0.8μm syringe filter several times, a 0.45μm syringe filter several times, and a 0.22μm syringe filter several times in sequence to obtain cell membrane vesicles;

[0030] S4.4. Take a small amount of membrane vesicles for protein quantification and package the rest.

[0031] Preferably, the centrifugation in S4.1 is carried out at a temperature of 4°C and a centrifugal force of 1000 g for 10 min;

[0032] In S4.3, the first centrifugation is performed at a temperature of 4°C and a centrifugal force of 1400 g for 15 min; the second centrifugation is performed at a temperature of 4°C and a centrifugal force of 7000 g for 20 min;

[0033] Washing the PMD solution twice in S4.3 requires centrifugation for 15 min at 4°C and 95,000 g;

[0034] The pipette tip in S4.3 is 300 μl; 0.8 μm syringe filter, 0.45 μm syringe filter, and 0.22 μm syringe filter are all filtered 5 times;

[0035] The S4.4 needs to be stored at -80°C after packaging.

[0036] Preferably, the PDP solution is prepared by adding 20 μl of 1 M DTT and 80 μl of 10 mM PMSF to 20 mL of PBS, mixing well, and storing at 4°C.

[0037] Preferably, the PMD solution is prepared by adding 45 μl 1M DTT and 46.4 μl 2M MgCl2 to 45 mL PBS, mixing well, and storing at 4°C.

[0038] Preferably, the 46% (w / w) sucrose solution is prepared by adding 10 μl of 1 M DTT, 10 μl of 2 M MgCl2 and 9.2 g sucrose to 10 mL PBS, and after complete dissolution, the volume is fixed to 20 mL and stored at 4°C.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] 1. Prepare the transfection plasmid and HEK293 cells to be transfected. Use TA-293 transfection reagent to transfect the cells, which can efficiently prepare ABC transporter flip-molded vesicles.

[0041] 2. Easy operation: The operator can complete the transfer activity operation through only a few simple steps, which improves the user experience.

[0042] 3. Improve efficiency: The present invention significantly improves the efficiency of vesicle eversion by using multiple models of syringe filters for multiple blowing (the traditional method takes 3 hours to complete, while the present invention only takes 1 hour, greatly shortening the production cycle).

[0043] 4. Improved precision: The transport activity of the externally everted vesicles produced by the present invention is much higher than 2 times that stipulated in the drug guidelines, which greatly improves the transport activity of the externally everted vesicles. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0045] Figure 1 is a flow chart of the present invention;

[0046] Figure 2 This is a graph showing the LC-MS / MS detection results of the transmolecular vesicle transport activity of ABCB1 of the present invention. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0048] See also Figure 1 and Figure 2 In an embodiment of the present invention, a method for efficiently preparing ABC transporter molded vesicles comprises the following steps:

[0049] S1. Plasmid extraction: Plasmid extraction is performed by using an endotoxin-free plasmid extraction kit to extract the plasmid;

[0050] S2. Cell preparation before transfection: Resuscitate HEK293 cells and subculture until the cells grow well; the cell viability should be above 95% during transfection;

[0051] S3, transfection;

[0052] S3.1. The total amount of KPM buffer used is 1 / 10 of the cell suspension, and the amount of plasmid used is 1 μg per ml of cell suspension; the ratio of plasmid: transfection reagent is 1:5; TA-293 transfection reagent needs to be activated at 60°C for 10 minutes before use and stored at 4°C;

[0053] S3.2. Prepare two sterile centrifuge tubes, add transfection buffer KPM and sterile plasmid DNA to one of them, and gently pipette to mix; take the other tube and add transfection buffer KPM and transfection reagent TA-293, and gently pipette to mix;

[0054] S3.3. Transfer all the liquid in the centrifuge tube containing the transfection reagent to the centrifuge tube containing the plasmid and mix by gently pipetting;

[0055] S3.4. Incubate at room temperature for a period of time (10-15 minutes). Do not move the plasmid-transfection reagent complex during this period.

[0056] S3.5. Take out the cells from the shaker, mark the shake flask, slowly add the incubated plasmid complex while shaking, and put the shake flask back into the shaker for incubation;

[0057] S3.6, 24 h after transfection, add supplementary materials, transient transfection nutrient additive 50×KT-Feed, expression enhancer KE-293, and return the shake flask to the shaker for culture;

[0058] S3.7. After the protein reaches the highest value after a period of time after transfection, take out the shaking bottle for subsequent purification;

[0059] S4. Preparation of molded vesicles.

[0060] If the S3 is used to transfect 100 ml of cells;

[0061] You need to prepare two 15ml sterile centrifuge tubes, add 5ml transfection buffer KPM and 100ug sterile plasmid DNA to one of them, and add 5ml transfection buffer KPM and 500ul transfection reagent TA-293 to the other one;

[0062] Transient transfection nutrient additive 50×KT-Feed 2.2 ml, expression enhancer KE-293 0.6 ml, the working concentration of expression enhancer KE-293 is 0.6%, and the stock solution of expression enhancer KE-293 is 100%.

[0063] The S4 specifically comprises the following steps:

[0064] S4.1. Collection and washing: The transfected cells were collected and suspended in 1 mL of PDP solution after centrifugation for a period of time; the centrifugation was performed at 4°C and a centrifugal force of 1000 g for 10 min;

[0065] S4.2, cell disruption: disrupt the cell pellet by ultrasonic disruption;

[0066] S4.3, centrifugal washing: After the first centrifugation, the supernatant was aspirated and added to the surface of the 46% (w / w) sucrose solution, and then centrifuged again. The white capsule at the junction of the two liquid surfaces was aspirated and placed in a clean tube, and then washed twice with PMD; the first centrifugation was performed at 4°C and a centrifugal force of 1400g for 15 min; the second centrifugation was performed at 4°C and a centrifugal force of 7000g for 20 min; the PMD solution was washed twice at 4°C and a centrifugal force of 95000g for 15 min;

[0067] Aliquot and store: add an appropriate amount of PMD solution to the precipitate, blow it gently with a pipette tip repeatedly to disperse it evenly, and filter it through a 0.8μm syringe filter multiple times, a 0.45μm syringe filter multiple times, and a 0.22μm syringe filter multiple times in sequence to obtain cell membrane vesicles; use a 300μl pipette tip; filter it through a 0.8μm syringe filter, a 0.45μm syringe filter, and a 0.22μm syringe filter 5 times each;

[0068] S4.4. Take a small amount of membrane vesicles for protein quantification and package the rest; after packaging, they need to be stored at -80℃.

[0069] The PDP solution was prepared by adding 20 μl of 1 M DTT and 80 μl of 10 mM PMSF to 20 mL of PBS, mixing well, and storing at 4°C.

[0070] The PMD solution was prepared by adding 45 μl of 1 M DTT and 46.4 μl of 2 M MgCl2 to 45 mL of PBS, mixing well, and storing at 4°C.

[0071] The 46% (w / w) sucrose solution was prepared by adding 10 μl of 1M DTT, 10 μl of 2M MgCl2 and 9.2 g of sucrose to 10 mL of PBS. After the solution was completely dissolved, the volume was adjusted to 20 mL and stored at 4°C.

[0072] Note: The operation process must be performed aseptically and the consumables used must be sterilized in advance.

[0073] Let's take an example: ABCB1

[0074] P-glycoprotein (P-gp) belongs to the ATP Binding Cassette (ABC) protein family and is an ATP-dependent transmembrane efflux transporter. In humans, it is mainly encoded by the multidrug resistance gene (MDR1), also known as the ABCB1 gene. P-gp is related to both multidrug resistance and drug-drug interactions (DDI). The drug regulatory authorities in the United States, Europe, and China have successively issued guidelines, listing transporter-mediated DDI research as an important indicator for evaluating the safety and efficacy of new drugs. It also clearly points out that in vitro studies should be used to evaluate whether the drug under investigation is a substrate, inhibitor, or inducer of P-gp, providing a reference for in vivo studies.

[0075] 1. Vector construction:

[0076] 1) ABCB1 Primers:

[0077] F:TTCCATTTCAGGTGTCGTGAG ATGGATCTTGAAGGGGACCGC

[0078] R:TCTAGAGCCGGCGCGGCCGCG TCACTGGCGCTTTGTTCCAGC

[0079] 2) ABCB1 sequence:

[0080] NCBI Reference Sequence:NM_000927

[0081] 2. Cell preparation:

[0082] HEK293 cells were revived and passaged until the cells were in good growth condition and the viability reached more than 95% during transfection.

[0083] 3. Cell transient transfection:

[0084] ABCB1 was transfected using TA-293 transfection reagent.

[0085] 4. Preparation of mold-turned vesicles: Prepare mold-turned vesicles by the method of step S4 above.

[0086] 5. Detection of transport activity of ABC transport vesicles:

[0087] (1) Thawing: Thaw the frozen vesicles and Mg-ATP solution in an ice bath and place on ice until use.

[0088] Note: a. To ensure the reliability and reproducibility of the data, please aliquot and store the frozen ABCB1-refolded vesicles and Mg-ATP solution according to the experimental requirements after the first thawing. Do not freeze and thaw repeatedly.

[0089] b. The recommended final concentration of vesicles is 50 μg / reaction, and 50 reactions can be performed in each tube.

[0090] (2) Preparation: The incubation system can be prepared according to the following method (taking a 50 μL system as an example).

[0091] Note: This test is to examine the drug uptake ratio of the transporter vesicles ATP group and AMP group, so both the ATP and AMP groups need to be tested at the same time.

[0092]

[0093] Note: a. Please mix the ABC transporter vesicle reaction solution and ABC transporter molded vesicles evenly and incubate them in a 37℃ water bath for 5 minutes before adding other components in sequence.

[0094] b. During use, the amount of components added can also be adjusted according to actual experimental needs.

[0095] (3) Incubation: After mixing evenly, incubate at 37°C for 5 min.

[0096] (4) Filtration: Transfer the incubation solution to a pre-treated microporous filter, add 300 μL of ABC transporter vesicle reaction solution, and centrifuge at 8000-10000 rpm for 15 seconds. Repeat this step 5 times.

[0097] Collection: Add 400 μL of acetonitrile to the cleaned microporous filter, let it stand for 10 seconds, centrifuge at 8000-10000 rpm for 1 minute, and collect the liquid for corresponding detection.

[0098] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An efficient preparation method of ABC transporter remodeling vesicles, characterized in that: The following steps are involved: S1, plasmid extraction; S2. Cell preparation before transfection: thaw HEK293 cells and passage them until the cells grow well; S3, transfection; S3.1, the total amount of KPM buffer used is 1 / 10 of the cell suspension, and the amount of plasmid used is 1 μg per ml of cell suspension; Plasmid: transfection reagent ratio = 1:5; S3.

2. Prepare two sterile centrifuge tubes, add transfection buffer KPM and sterile plasmid DNA to one of them, and gently pipette to mix; take the other tube and add transfection buffer KPM and transfection reagent TA-293, and gently pipette to mix; S3.

3. Transfer all the liquid in the centrifuge tube containing the transfection reagent to the centrifuge tube containing the plasmid and mix by gently pipetting; S3.4, incubate at room temperature for a period of time; S3.

5. Take out the cells from the shaker, mark the shake flask, slowly add the incubated plasmid complex while shaking, and put the shake flask back into the shaker for incubation; S3.6, 24 h after transfection, add supplementary materials, transient transfection nutrient additive 50×KT-Feed, expression enhancer KE-293, and return the shake flask to the shaker for culture; S3.

7. After the protein reaches the highest value after a period of time after transfection, take out the shaking bottle for subsequent purification; S4. Preparation of molded vesicles.

2. The method for efficiently preparing an ABC transporter mold-reversing vesicle according to claim 1, characterized in that: The plasmid extraction in S1 is performed by using an endotoxin-free plasmid extraction kit to extract the plasmid; and the cell viability during transfection in S2 needs to be above 95%.

3. The method for efficiently preparing an ABC transporter mold-reversing vesicle according to claim 1, characterized in that: The TA-293 transfection reagent in S3.1 needs to be activated at 60°C for 10 minutes before use and stored at 4°C.

4. The method for efficiently preparing an ABC transporter molded vesicle according to claim 1, characterized in that: If the S3 is used to transfect 100 ml of cells; You need to prepare two 15ml sterile centrifuge tubes, add 5ml transfection buffer KPM and 100ug sterile plasmid DNA to one of them, and add 5ml transfection buffer KPM and 500ul transfection reagent TA-293 to the other one; Transient transfection nutrient additive 50×KT-Feed 2.2 ml, expression enhancer KE-293 0.6 ml, the working concentration of expression enhancer KE-293 is 0.6%, and the stock solution of expression enhancer KE-293 is 100%.

5. The method for efficiently preparing an ABC transporter molded vesicle according to claim 1, characterized in that: The S4 specifically comprises the following steps: S4.

1. Collection and washing: The transfected cells were collected, centrifuged for a period of time, and then suspended in 1 mL of PDP solution; S4.2, cell disruption: disrupt the cell pellet by ultrasonic disruption; S4.3, Centrifugal washing: After the first centrifugation, aspirate the supernatant and add it to the surface of 46% (w / w) sucrose solution. Centrifuge again and aspirate the white capsule at the junction of the two liquid surfaces and place it in a clean tube. Wash with PMD twice; Aliquot and store: add an appropriate amount of PMD solution to the precipitate, blow it gently with a pipette tip repeatedly to disperse it evenly, and filter it through a 0.8μm syringe filter several times, a 0.45μm syringe filter several times, and a 0.22μm syringe filter several times in sequence to obtain cell membrane vesicles; S4.

4. Take a small amount of membrane vesicles for protein quantification and package the rest.

6. The method for efficiently preparing ABC transporter-reversed vesicles according to claim 5, characterized in that: The centrifugation in S4.1 is carried out at a temperature of 4°C and a centrifugal force of 1000 g for 10 minutes; The first centrifugation in S4.3 is performed at 4°C and a centrifugal force of 1400 g for 15 min; The centrifugation was repeated at 4°C and 7000 g for 20 min. Washing the PMD solution twice in S4.3 requires centrifugation for 15 min at 4°C and 95,000 g; The pipette tip in S4.3 is 300 μl; 0.8 μm syringe filter, 0.45 μm syringe filter, and 0.22 μm syringe filter are all filtered 5 times; The S4.4 needs to be stored at -80°C after packaging.

7. The method for efficiently preparing ABC transporter-reversed vesicles according to claim 5, characterized in that: The PDP solution was prepared by adding 20 μl of 1 M DTT and 80 μl of 10 mM PMSF to 20 mL of PBS, mixing well, and storing at 4°C.

8. The method for efficiently preparing ABC transporter-reversed vesicles according to claim 5, characterized in that: The PMD solution was prepared by adding 45 μl of 1 M DTT and 46.4 μl of 2 M MgCl2 to 45 mL of PBS, mixing well, and storing at 4°C.

9. The method for efficiently preparing an ABC transporter molded vesicle according to claim 5, characterized in that: The 46% (w / w) sucrose solution was prepared by adding 10 μl of 1M DTT, 10 μl of 2M MgCl2 and 9.2 g of sucrose to 10 mL of PBS. After the solution was completely dissolved, the volume was adjusted to 20 mL and stored at 4°C.

Images