Application of earthworm protein hydrolysate in preparation of intestinal mucosa barrier protective agent

Abstract

The invention provides application of earthworm protein hydrolysate in preparation of an intestinal mucosa barrier protective agent, and belongs to the technical field of earthworm deep processing. The invention provides an application of earthworm protein hydrolysate (EWPH) in preparation of an intestinal mucosa barrier protective agent. EWPH treatment is given to a dextran sulfate sodium salt (DSS)-induced mouse intestinal mucosa injury model, and the effect and the treatment mechanism of the EWPH treatment are evaluated. Results show that the EWPH has a protective effect on intestinal mucosal injury, and the mechanism of the EWPH relates to inhibition of activation of a TLR4-MAPK / NF-kappa B pathway, inhibition of inflammatory cell infiltration, adjustment of inflammatory cytokines and the like. Therefore, the invention proves that the EWPH can be used as an intestinal mucosa barrier protective agent, which also points out a specific promising direction for the production and high-valued processing of EWPH-related bioactive peptides.

Description

Technical Field

[0001] The invention belongs to the technical field of earthworm deep processing, and in particular relates to the application of earthworm protein hydrolysate in the preparation of an intestinal mucosal barrier protective agent. Background Art

[0002] The intestinal mucosal barrier is one of the important defense barriers of the human body, which is mainly composed of physical barriers, chemical barriers, immune barriers and microbial barriers. The destruction of the integrity of the intestinal mucosal barrier is not only related to gastrointestinal diseases such as inflammatory bowel disease (IBD) and colorectal cancer, but also closely related to systemic diseases (such as hypertension, diabetes, Alzheimer's disease, etc.). The development of natural products with intestinal mucosal barrier protection is very important for maintaining human health. The protective effect of bioactive peptides in protein hydrolysates on intestinal mucosa has gradually attracted attention.

[0003] In recent years, the potential bioactive peptides in earthworm protein (EWP) and its hydrolysate (EWPH) have gradually come into people's attention. However, there is no report on the protective effect of EWPH on the intestinal mucosal barrier. Summary of the invention

[0004] The purpose of the present invention is to provide application of earthworm protein hydrolysate in preparing an intestinal mucosal barrier protective agent.

[0005] The invention provides application of earthworm protein hydrolysate in preparing an intestinal mucosal barrier protective agent.

[0006] Preferably, the intestinal mucosal barrier protective effect includes protecting intestinal mucosal barrier damage and / or alleviating intestinal inflammation.

[0007] Preferably, the intestinal epithelial barrier damage is induced by dextran sulfate sodium salt.

[0008] Preferably, the intestinal mucosal barrier protective agent includes drugs for treating and / or preventing intestinal mucosal damage.

[0009] The present invention also provides the use of earthworm protein hydrolysate in preparing an intestinal epithelial TLR4-NF-κB / MAPK signaling pathway inhibitor.

[0010] The invention also provides the use of earthworm protein hydrolysate in preparing intestinal mucosal barrier damage-related molecule inhibitors.

[0011] Preferably, the intestinal mucosal barrier damage-related molecules include one or more of p-SRC, p-STAT3, Caspase-3 and MMP9.

[0012] Preferably, the earthworm protein hydrolysate is obtained by hydrolyzing earthworm protein with alkaline protease.

[0013] Preferably, the preparation method of the earthworm protein hydrolysate comprises the following steps:

[0014] The earthworm protein powder solution and alkaline protease are mixed, hydrolyzed, and the enzyme is inactivated to obtain a hydrolyzate; the hydrolyzate is centrifuged, the supernatant is collected, and the supernatant is freeze-dried to obtain the earthworm protein hydrolyzate.

[0015] Preferably, the pH of the hydrolysis is 9; the ratio of the mass of the earthworm protein powder to the volume of the solvent is 1g:25mL; the ratio of the volume of the earthworm protein powder solution to the mass of the alkaline protease is 100mL:0.16g; the temperature of the hydrolysis is 45°C; and the time of the hydrolysis is 4h.

[0016] The present invention provides the use of earthworm protein hydrolysate (EWPH) in the preparation of an intestinal mucosal barrier protective agent. The present invention treats the mouse intestinal mucosal injury model induced by dextran sulfate sodium salt (DSS) with EWPH and evaluates its effect and treatment mechanism. The results show that EWPH has a protective effect on intestinal mucosal injury, and its mechanism involves inhibiting the activation of the TLR4-MAPK / NF-κB pathway, inhibiting inflammatory cell infiltration, regulating inflammatory cytokines, etc. Therefore, the present invention proves that EWPH can be used as an intestinal mucosal barrier protective agent, which also points out a specific and promising direction for the production and high-value processing of bioactive peptides related to EWPH. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0018] Figure 1 It is a pie chart of molecular weight distribution of peptides in EWPH;

[0019] Figure 2 is the secondary mass spectrum of FPW;

[0020] Figure 3 is the secondary mass spectrum of EFPWQ;

[0021] Figure 4 is the secondary mass spectrum of VGPICAPDPA;

[0022] Figure 5 is the secondary mass spectrum of NNISIW;

[0023] Figure 6 is the secondary mass spectrum of DINVGPAI;

[0024] Figure 7 is the secondary mass spectrum of EFPWQVS;

[0025] Figure 8 This is the secondary mass spectrum of EYNNPGPNY;

[0026] Fig. 9 is the secondary mass spectrum of DRWVVC;

[0027] Fig.10 is the secondary mass spectrum of SIINDRW;

[0028] Fig.11 This is the result of network pharmacology analysis of peptides and intestinal mucosal barrier damage in EWPH;

[0029] Fig.12 This is the GO analysis result diagram of key targets;

[0030] Fig.13 KEGG analysis results for key targets;

[0031] Fig.14 Indicates that EWPH treatment can alleviate DSS-induced colitis, and EWPH can alleviate DSS-induced intestinal epithelial barrier damage; A is an animal experiment; B is the daily weight change of mice in each experimental group; C is the DAI index (n=6); D is the FITC level in the serum of mice in each experimental group (n=3); E is a representative image of the colon of mice in each experimental group (n=6); F is the colon length of mice in each experimental group (n=6); G is the colon histopathological score of mice in each experimental group (n=6); H is the villus length of mice in each experimental group (n=6); I is a representative image of stained colon; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001;

[0032] Fig.15 Indicates that EWPH treatment can alleviate DSS-induced inflammation; A to D are the results of RT-qPCR detection of mRNA expression of IL-1β, IL-6, TNF-α and IL-10 in colon tissue; E represents the MPO level in mouse serum; H is a representative immunohistochemical image of macrophages; F is a representative immunohistochemical image of the positive area of ​​macrophages; G represents the statistical analysis results of the positive area of ​​macrophages, and I represents the statistical analysis results of the positive area of ​​neutrophils; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001;

[0033] Fig.16Indicates that EWPH can improve DSS-induced intestinal mucosal barrier dysfunction; A-D are RT-qPCR detection of Occludin, Claudin-4, ZO-1 and Muc-2 mRNA expressions, using GAPDH as an internal reference; E-G are Western blot detection of Occludin and Claudin-4 protein relative expression, using β-tubulin as an internal reference; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001;

[0034] Fig.17 It means that EWPH enhances the intestinal mucosal barrier function by inhibiting the TLR4-NF-κB / MAPK pathway; A-E are representative Western blot images and relative expression levels of TLR4, p-JNK / JNK, p-ERK / ERK and p-p38 MAPK / p38 MAPK; F is a representative immunofluorescence image of p-p65 NF-κB expression; G is the green fluorescence intensity analysis of p-p65 NF-κB expression; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001;

[0035] Fig.18 Representative immunohistochemical images; A to D are p-SRC, p-STAT3, Caspase-3 and MMP9, n=10; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. DETAILED DESCRIPTION

[0036] The invention provides application of earthworm protein hydrolysate in preparing an intestinal mucosal barrier protective agent.

[0037] In the specific implementation of the present invention, the intestinal mucosal barrier protective effect includes protecting intestinal mucosal barrier damage and / or alleviating intestinal inflammation.

[0038] In a specific implementation of the present invention, the intestinal epithelial barrier damage is induced by dextran sulfate sodium salt.

[0039] In the specific implementation of the present invention, the intestinal mucosal barrier protective agent includes drugs for treating and / or preventing intestinal mucosal damage.

[0040] In the present invention, the dosage form of the drug includes an oral dosage form.

[0041] In the present invention, the medicine is a unit preparation; based on mice, the dosage of earthworm protein in the unit preparation is 200 mg / kg.

[0042] The present invention also provides the use of earthworm protein hydrolysate in preparing an intestinal epithelial TLR4-NF-κB / MAPK signaling pathway inhibitor.

[0043] The invention also provides the use of earthworm protein hydrolysate in preparing intestinal mucosal barrier damage-related molecule inhibitors.

[0044] In the specific implementation of the present invention, the intestinal mucosal barrier damage-related molecules include one or more of p-SRC, p-STAT3, Caspase-3 and MMP9.

[0045] In the specific implementation process of the present invention, the earthworm protein hydrolysate is obtained by hydrolyzing earthworm protein with alkaline protease.

[0046] In the specific implementation process of the present invention, the preparation method of the earth dragon protein hydrolysate comprises the following steps:

[0047] The earthworm protein powder solution is mixed with alkaline protease to hydrolyze and inactivate the enzyme to obtain a hydrolyzate;

[0048] The hydrolyzate is centrifuged, the supernatant is collected, and the supernatant is freeze-dried to obtain the earthworm protein hydrolyzate.

[0049] The invention firstly mixes earthworm protein powder dissolving liquid and alkaline protease, performs hydrolysis, kills the enzyme and obtains a hydrolyzate.

[0050] In the specific implementation process of the present invention, the earthworm protein powder is obtained by crushing the earthworm protein and filtering it through a 100-mesh filter; the earthworm protein is provided by Tianjin Dilongli Company; the solvent of the earthworm protein powder solution is Tris-HCl buffer; the ratio of the mass of the earthworm protein powder to the volume of the solvent is 1g:25mL; the pH of the hydrolysis is 9; the ratio of the volume of the earthworm protein powder solution to the mass of the alkaline protease is 100mL:0.16g; the hydrolysis temperature is 45°C; the hydrolysis time is 4h; the enzyme inactivation includes heating the solution at 95°C for 10min.

[0051] After obtaining the hydrolyzate, the present invention centrifuges the hydrolyzate, collects the supernatant, and freeze-dries the supernatant to obtain the earthworm protein hydrolyzate. In the specific implementation process of the present invention, the freeze-drying conditions include: the pre-freezing temperature is -40°C, the pre-freezing time is 4h, the cold trap temperature is set to -45°C during freeze-drying, after the vacuum degree is reduced to 25Pa, the partition is heated to 40°C for 30h; the centrifugal temperature is 4°C; the centrifugal force is 10000g; the centrifugal time is 30min.

[0052] In order to further illustrate the present invention, the application of the earthworm protein hydrolyzate provided by the present invention in preparing an intestinal mucosal barrier protective agent is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0053] The reagents used in the following examples are:

[0054] Earthworm protein was provided by Tianjin Earthworm Power Co., Ltd. Alkaline protease (Beijing Solaibao), dextran sulfate sodium salt (DSS, MW: 36000-50000, Aladdin, China), FITC-dextran (MW: 4000, Sigma-Aldrich, USA), and related antibodies are shown in Table 1.

[0055] Table 1 Primary antibody related information

[0056]

[0057]

[0058] Example 1

[0059] 1. Preparation of earthworm protein hydrolysate (EWPH)

[0060] The earthworm protein powder was dissolved in Tris-HCl buffer solution with the earthworm protein (W): buffer solution (V) being 1:25, and alkaline protease was added to hydrolyze it. The hydrolysis conditions were: pH = 9, enzyme: substrate = 4% (W / W), and the reaction was carried out at 45° for 4 hours. After the hydrolysis was completed, the solution was heated at 95°C for 10 minutes, and finally centrifuged at 4°C, 10000g, and 30 minutes. The supernatant was collected and freeze-dried to obtain the earthworm protein hydrolysate, wherein the freeze-drying conditions were: pre-freezing temperature was -40°C, pre-freezing time was 4 hours, the cold trap temperature was set to -45°C during freeze-drying, and after the vacuum degree dropped to 25Pa, the partition was heated to 40°C for 30 hours.

[0061] 2. Detection of the proportion of soluble peptides in EWPH

[0062] An appropriate amount of EWPH prepared in step 1 was dissolved in water, mixed with an equal volume of 10% trichloroacetic acid, allowed to stand at 25°C for 30 min, and centrifuged (4°C, 5000 g, 10 min) to collect the supernatant. The protein concentration of the supernatant and the original sample was detected using a BCA kit (Biosharp,).

[0063] The results showed that the proportion of soluble polypeptides in EWPH was as high as 88.94%.

[0064] 3. LC-MS / MS analysis

[0065] The Ultimate 3000 system was used for UPLC, and the EWPH prepared in step 1 was injected into the analytical column (150 μm × 150 mm inner diameter, Acclaim PepMap RPLC C18, 1.9 μm, ), mobile phase A is 0.1% formic acid in water, mobile phase B is 0.1% formic acid and 80% acetonitrile solution, flow rate is 600nl / min, gradient conditions are: 0-3min, B phase increases from 4% to 8%; 3-41min, B phase increases from 8% to 25%; 41-49min, B phase increases from 25% to 35%; 49-56min, B phase increases from 35% to 90%; 56-60min, B phase increases from 90% to 90%. Spray voltage: 2.2kV, capillary temperature: 270℃, MS resolution: 70000at 400m / z, MS precursor m / z range: 300to 1500m / z.

[0066] The results showed that EWPH contained 138 peptides, of which small peptides with a molecular weight of less than 1000 accounted for 74.73%, and peptides with a molecular weight of 1000-3000 accounted for 25.27% (see Figure 1 ).

[0067] 4. Network pharmacology and bioinformatics analysis

[0068] The SMILES numbers corresponding to the peptides were obtained from the swissADME database, and then the SMILES numbers were input into the swissTarget Prediction database to obtain the predicted targets corresponding to the peptides. Targets related to intestinal mucosal barrier damage were obtained from the OMIM and GeneCards databases.

[0069] The STRING database was used to construct the gene-gene interaction network (PPI) diagram, and the network diagram was modified using Cytoscape 3.7.2 software. GO and KEGG enrichment analysis was completed using the David database, and data visualization was performed using the Microbiological Information Database.

[0070] In this example, the 9 polypeptides with the highest content were screened (Table 2, Figure 2 to Figure 10), and obtained their corresponding targets through SwissTargetPrediction. After deleting duplicates, a total of 233 targets were obtained. The Davids database was used to perform GO and KEGG analysis on the genes involved in these peptides, and the microbial information network platform was used to visualize the data. The GO analysis results showed that EWPH mainly involved biological processes (BP) such as proteolysis and apoptosis, exogenous stimulation, etc., and the main cell components (CC) involved were on the plasma membrane and cell surface, mainly involving molecular functions such as peptidase binding and protease binding ( Fig.11 ). KEGG results showed that these peptides may be involved in multiple pathways of DSS-induced colitis, including TNF, IL-17, and Neutrophil extracellular trap formation ( Fig.12 ).

[0071] Table 2 The top 9 peptides in EWPH

[0072]

[0073] In order to further explore the mechanism of EWPH protecting intestinal mucosal barrier function, the present example obtained disease targets related to DSS-induced intestinal mucosal barrier damage through OMIM and GeneCards databases, of which 7 and 215 targets were related to UC, and 68 and 2431 targets were related to IBD, respectively. After deleting duplicates, a total of 2720 targets were obtained. The peptides and disease targets were associated with the STRING database, and a PPI network diagram with a total of 107 related targets (Table 3) was obtained, and the modified results showed that there were 6 core targets with a 'degree' greater than 50, namely IL-1β, SRC, APK3, MMP9, STAT3, Caspase-3 ( Fig.13 ).

[0074] Table 3 Some target information

[0075]

[0076]

[0077] Example 2

[0078] 1. Animal model test

[0079] C57BL6 mice aged 6 to 8 weeks were purchased from Beijing Huafukang. The mice were housed in an independently ventilated environment with a 12-h dark and light cycle, a temperature of 23±3°C, and a relative humidity of 50%±10%. The experiment began after the mice had adapted to the environment for one week.

[0080] like Fig.14 In A, mice were randomly divided into three groups: control group, model group (DSS) and earthworm protein hydrolysate EWPH (EWPH+DSS) group, with 6 mice in each group. Except for the control group, 3% DSS was added to the daily drinking water of the remaining mice for 7 days. During this period, the EWPH group was gavaged with 200 μl of EWPH (200 mg / kg) every day, and the control group and model group were replaced with drinking purified water. After 7 days, the drinking water of all mice was replaced with drinking purified water, and gavage of mice in all groups was stopped. The mice were observed for two days, and the body weight and disease activity index (DAI) of the mice were recorded every day. The mice were killed on the 9th day.

[0081] The mouse experiments were approved by the Experimental Animal Ethics Committee of Tianjin Nankai Hospital, license: SYXK(Tianjin)2020-0008.

[0082] 2. Mouse intestinal permeability test

[0083] Mice were gavaged with FITC-dextran (600 mg / kg). Blood was collected from the ophthalmic venous plexus of the mice 3 hours later and the serum was obtained by centrifugation. The serum was appropriately diluted and its fluorescence value was measured under the conditions of 485 nm excitation light and 528 nm emission light.

[0084] 3. Colon tissue section staining

[0085] Fresh colon tissue was fixed with 4% paraformaldehyde, removed and dehydrated after 48 hours, then embedded in paraffin, sliced ​​(4 μm), and stained with hematoxylin-eosin (H&E). The colon sections were observed under a microscope and their histopathological scores were calculated.

[0086] 4. Determination of MPO levels in serum

[0087] The test was performed according to the instructions of the biochemical kit manufacturer (Nanjing Jiancheng).

[0088] 5. Immunohistochemistry

[0089] After colon tissue sectioning, gradient rehydration was performed, and then antigen retrieval was performed using citrate buffer. Then, endogenous peroxidase blocker was added, and after PBS washing, the primary antibody was used for overnight incubation at 4°C, and the secondary antibody was incubated at 37°C for 20 minutes. Then, DAB staining, hematoxylin counterstaining, gradient ethanol and xylene dehydration were performed to make it transparent, and the slides were sealed with neutral gum and observed under a microscope.

[0090] For immunofluorescence, paraffin-embedded colon sections were rehydrated and antigen retrieval was performed using citrate buffer, followed by incubation with triton (0.2%) at room temperature for 15 min, BSA (2%) at room temperature for 1 h, followed by incubation with primary antibody overnight at 4°C and secondary antibody at 37°C for 1 h, followed by addition of DAPI, washing, and sealing with anti-fluorescence attenuation sealing medium for observation under a microscope.

[0091] 6. Expression of target gene mRNA

[0092] The total RNA of colon was extracted by RT-qPCR using the corresponding kit (Acori Biotech). The mRNA was reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche) to obtain cDNA. The concentrations of mRNA and cDNA were measured using a Nanophotometer. After appropriate dilution of cDNA, the qPCR Mastermix kit (abm, ) was used to measure the concentration of cDNA. Gene expression was measured on a 96-well system (Roche). The abundance of the target gene in colon tissue was measured using 2 -△△Ct The expression of GAPDH was used as the internal reference. Some primer sequences were based on the study of Hong et al. (Table 4), see [All: walnut protein peptides ameliorate dss-induced ulcerative colitis damage in mice: an in silico analysis and in vivo investigation] AND [in Journal: Journal of Agricultural and Food Chemistry]. The primers were synthesized by Sangon Biotechnology.

[0093] Table 4 Primer sequences

[0094] Gene sequence GAPDH-F atgggtgtgaaccacgagaa(SEQ ID NO.1) GAPDH-R cccttccacaatgccaaagt(SEQ ID NO.2) Claudin-4-F aacatcgtcacggcacaga(SEQ ID NO.3) Claudin-4-R acacgggcaccataatcag(SEQ ID NO.4) ZO-1-F gccttgaactttgacctctgc(SEQ ID NO.5) ZO-1-R gaaatcgtgctgatgtgcca(SEQ ID NO.6) Occludin-F tactggtctctacgtggatcaat(SEQ ID NO.7) Occludin-R ttcttcgggttttcacagcaa(SEQ ID NO.8) TNF-α-F caaaccaccaagtggaggagcag(SEQ ID NO.9) TNF-α-R tgagatagcaaatcggctgacgg(SEQ ID NO.10) IL-1β-F tccatgagctttgtacaagga(SEQ ID NO.11) IL-1β-R agcccatactttaggaagaca(SEQ ID NO.12) IL-6-F caccaggcaagtctcctcattg(SEQ ID NO.13) IL-6-R tacatcctcgacggcatctca(SEQ ID NO.14) IL-10-F aaggaccagctggacaacat(SEQ ID NO.15) IL-10-R tctcacccagggaattcaaa(SEQ ID NO.16) Muc2-F acgtgtcatatttgcacctct(SEQ ID NO.17) Muc2-R tcaacattgagagtgccaact(SEQ ID NO.18)

[0095] "F represents the front primer, and R represents the rear primer."

[0096] 7. Expression of target protein

[0097] An appropriate amount of tissue was soaked in RIPA lysis buffer, and protease inhibitors and phosphorylation inhibitors were added, lysed, centrifuged, and the supernatant was collected to obtain the total protein of colon tissue. The protein was separated by SDS-PAGE, and then transferred to a PVDF membrane (0.45 μm), and the membrane was incubated with antibodies that could specifically bind. The protein bands were developed using an ultrasensitive luminescent substrate (Biosharp, china) and exposed using the LAS 500images system. Image J was used to analyze the grayscale value of the protein bands, and the data were normalized with β-tubulin and GAPDH and expressed as relative protein expression.

[0098] Test results:

[0099] In order to study whether EWPH can alleviate colitis caused by DSS, the mice were divided into a control group, a model group, and an EWPH group after they were adapted to the environment for seven days. The drinking water of the model group contained 3% DSS. In addition to adding 3% DSS to the drinking water of the EWPH group, mice were gavaged with 200 mg / kg of EWPH every day. This concentration was obtained through preliminary experimental exploration. After 7 days, DSS was removed from the drinking water of all mice, and gavage was stopped. The mice were observed for two days ( Fig.14 The experimental results showed that the mice in the model group lost weight ( Fig.14 B), the length of the colon and the length of the colon villi were significantly shortened Fig.14 E, F, H), DAI and histopathological scores were significantly higher than those of the normal group mice ( Fig.14 C, I). After EWPH treatment, the weight loss and colon shortening of mice were alleviated, and the DAI and histopathological scores were significantly reduced. In addition, in order to examine the intestinal permeability of mice, FITC-dextran was gavaged into the mice 3 h before being killed, and the fluorescence value in the serum was measured after the serum was obtained. The results showed that ( Fig.14 D), the FITC concentration in the serum of the model group mice was significantly higher than that of the blank group, and the FITC concentration in the serum of the mice treated with EWPH decreased. In summary, the above results indicate that EWPH improves the health of mice and alleviates DSS-induced colitis.

[0100] In order to explore whether EWPH can improve DSS-induced inflammatory symptoms, this example extracted total RNA from mouse colon and detected the expression of inflammatory cytokines in colon tissue by RT-qPCR. The results showed that ( Fig.14A to D in the figure, after DSS treatment, the levels of pro-inflammatory cytokines IL-1β, IL-6, and TNF-α in the colon tissue of mice increased significantly, while the level of anti-inflammatory cytokine IL-10 decreased significantly. After EWPH treatment, the abnormal levels of all inflammatory cytokines were reversed, indicating that the inflammation of mice was alleviated after EWPH treatment.

[0101] In order to further study how EWPH affects the infiltration of inflammatory cells and verify the above results, mouse macrophages (F4 / 80) and neutrophils (LY6G) were specifically stained by immunohistochemistry. The results showed that the number of macrophages and neutrophil positive cells in the colon of mice treated with DSS increased significantly ( Fig.15 F~I in the figure), while the positive area of ​​the EWPH group mice was significantly decreased compared with the model group. In addition, myeloperoxidase (MPO) is a marker of neutrophils, and its activity in tissues represents the degree of neutrophil infiltration. This example detected the level of MPO in the serum of mice in each treatment group, and the results were similar to those of immunohistochemistry ( Fig.15 E) in the figure further verified the above viewpoint. These results indicate that EWPH can alleviate DSS-induced colitis in mice by inhibiting the development of inflammation.

[0102] EWPH can improve DSS-induced intestinal mucosal barrier dysfunction. In order to further explore the protective effect of EWPH on the intestinal mucosal barrier, this example measured the mRNA expression levels of tight junction proteins and mucins in the colon by RT-qPCR. The results showed that after DSS treatment, the mRNA expression levels of tight junction proteins Occludin, Clduain-4, ZO-1 and mucin Muc-2 in the mouse colon were significantly reduced, while EWPH treatment significantly increased their expression ( Fig.16 A~D in it).

[0103] In order to further verify the accuracy of the above results, the protein expression of Occludin and Clduain-4 in colon tissue was determined by WB experiment in this example, and the results were similar to the above results ( Fig.16 These experimental results demonstrate that EWPH can protect the intestinal mucosal barrier of mice and alleviate DSS-induced colitis by repairing TJ and mucin of the intestinal epithelium of mice.

[0104] EWPH improves intestinal mucosal barrier function by inhibiting the TLR4-NF-κB / MAPK pathway. In colitis, the NF-κB signaling pathway is a key signaling pathway for regulating inflammatory cytokines. After proving that EWPH can improve DSS-induced colitis and protect the intestinal mucosal barrier of mice by inhibiting the inflammatory process, this example measured the expression of p-p65 protein in colon tissue by immunofluorescence. The results showed that DSS treatment significantly activated the phosphorylation of p65, while in the EWPH treatment group, the expression level of p-p65 was significantly inhibited ( Fig.17 F, G), which is consistent with the above results of this example, indicating that EWPH can regulate the abnormal level of inflammatory cytokines by inhibiting the activation of the NF-κB pathway. In addition, this example detected the phosphorylation levels of JNK, ERK and p38 in colon tissue by WB. The results showed that DSS induction significantly increased the phosphorylation levels of JNK, ERK and p38 proteins in colon tissue, while after EWPH treatment, their phosphorylation levels were significantly reduced ( Fig.17 Then, the protein expression of TLR4 was determined by WB in this example. The results were similar to those above. TLR4 was significantly activated in the colon tissue of the model group, while the treatment with EWPH inhibited this activation ( Fig.17 These results showed that EWPH could alleviate DSS-induced inflammation by inhibiting the activation of TLR4-NF-κB / MAPK signaling pathway.

[0105] Determination of potential targets for EWPH to improve intestinal mucosal barrier. In order to verify the accuracy of the targets predicted by network pharmacology, this example measured the protein expression of p-SRC, p-STAT3, Caspase-3, and MMP9 in colon tissue by immunohistochemistry. The results showed Fig.18 A to D in the figure, DSS treatment significantly increased the protein expression levels of p-SRC, p-STAT3, Caspase-3, and MMP9 in colon tissue, while the expression of these proteins in the colon tissue of mice treated with EWPH was not significantly different from that of the blank group, which is consistent with the prediction results before this example, indicating that EWPH alleviates the damage of the intestinal epithelial barrier of mice induced by DSS by inhibiting the expression of p-SRC, p-STAT3, Caspase-3, and MMP9. In addition, the expression of p-SRC and MMP9 in the colon of mice treated with EWPH was even lower than that of the control group, and the inhibitory effect on p-STAT3 and Caspase-3 was lower, indicating that p-SRC and MMP9 may be the main targets of EWPH.

[0106] In this study, this example used alkaline protease to treat EWP and obtained EWPH. Mice were treated with 3% DSS, and the results showed that the intestinal epithelial barrier of mice was destroyed, the intestinal epithelial tight junction proteins Occludin, Claudin4, ZO-1 and mucin Muc-2 were significantly reduced, the expression levels of IL-1β, IL-6, TNF-α, and IL-10 in colon tissue were significantly abnormal, and the infiltration of macrophages and neutrophils was significantly increased. In the colon tissue of mice pre-protected by EWPH, these conditions were improved, indicating that EWPH has the effect of protecting the intestinal epithelial barrier and alleviating inflammation, but its mechanism of action is still unclear. This example demonstrates that EWPH can inhibit the development of DSS-induced intestinal inflammation by inhibiting the activation of the TLR-4-NF-κB / MAPK signaling pathway, thereby alleviating the damage to the intestinal epithelial barrier. In addition, EWPH can alleviate the destruction of the intestinal mucosal barrier induced by DSS by inhibiting the expression of p-SRC, p-STAT3, Caspase-3, and MMP9.

[0107] In addition, the results of network pharmacology analysis showed that earthworm protein hydrolysate may exert a therapeutic effect on the intestinal mucosal barrier through six key targets, namely IL-1β, SRC, STAT3, Caspase-3, MMP9, and MAPK3 / 1.

[0108] The results of this example show that EWPH inhibited the level of IL-6 cytokines, and the phosphorylation level of STAT3 in the colon was also inhibited, indicating that EWPH can protect the intestinal mucosal barrier by inhibiting the activation of IL-6-STAT3. The results of this example show that EWPH can inhibit the expression of Caspase-3, alleviate the intestinal mucosal damage caused by DSS, and EWPH inhibits the infiltration of neutrophils and the expression of MMP9 in colon tissue.

[0109] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of earthworm protein hydrolysate in the preparation of intestinal mucosal barrier protective agent.

2. The use according to claim 1, characterized in that: The intestinal mucosal barrier protection effect includes protecting intestinal mucosal barrier damage and / or alleviating intestinal inflammation.

3. The use according to claim 2, characterized in that: The intestinal epithelial barrier damage was induced by dextran sulfate sodium salt.

4. The use according to claim 1, characterized in that: Intestinal mucosal barrier protective agents include drugs for treating and / or preventing intestinal mucosal damage.

5. Application of earthworm protein hydrolysate in the preparation of intestinal epithelial TLR4-NF-κB / MAPK signaling pathway inhibitors.

6. Application of earthworm protein hydrolysate in the preparation of inhibitors of intestinal mucosal barrier damage-related molecules.

7. The use according to claim 6, characterized in that: The intestinal mucosal barrier damage-related molecules include one or more of p-SRC, p-STAT3, Caspase-3 and MMP9.

8. The use according to any one of claims 1 to 7, characterized in that: The earthworm protein hydrolysate is obtained by hydrolyzing earthworm protein with alkaline protease.

9. The use according to any one of claims 1 to 7, characterized in that: The preparation method of the earthworm protein hydrolysate comprises the following steps: The earthworm protein powder solution is mixed with alkaline protease to hydrolyze and inactivate the enzyme to obtain a hydrolyzate; The hydrolyzate is centrifuged, the supernatant is collected, and the supernatant is freeze-dried to obtain the earthworm protein hydrolyzate.

10. The use according to claim 9, characterized in that: The pH of the hydrolysis is 9; the ratio of the mass of the earthworm protein powder to the volume of the solvent is 1g:25mL; the ratio of the volume of the earthworm protein powder solution to the mass of the alkaline protease is 100mL:0.16g; the temperature of the hydrolysis is 45°C; and the time of the hydrolysis is 4h.

Images