An anti-human trps1 monoclonal antibody and a preparation method and application thereof

Abstract

The application discloses an anti-human TRPS1 monoclonal antibody and a preparation method and application thereof, and belongs to the technical field of immunology. The anti-human TRPS1 monoclonal antibody provided by the application comprises VHCDR1, VHCDR2 and VHCDR3 with the amino acid sequences as shown in SEQ ID NO. 1-3, and VLCDR1, VLCDR2 and VLCDR3 with the amino acid sequences as shown in SEQ ID NO. 4-6. The nucleotide sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody, an expression cassette containing the nucleotide sequences, an expression vector, a recombinant cell and a recombinant bacterium are also provided. Therefore, the monoclonal antibody can be prepared by using genetic engineering technology, and the risk factors in the production and storage process of the traditional monoclonal antibody can be avoided. The monoclonal antibody prepared by the application has stable properties, high experimental repeatability and high titer, and has good specificity and affinity to the TRPS1 protein.

Description

TECHNICAL FIELD

[0001] The present application relates to an anti-human TRPS1 monoclonal antibody and a preparation method and application thereof, and belongs to the technical field of immunology. BACKGROUND

[0002] TRPS1 is also known as transcription repressor GATA binding 1 gene, which is one of the members of the atypical GATA transcription factor family (only contains one GATA zinc finger domain). The protein encoded by this gene plays a key role in various biological processes, including skeletal development, morphological characteristics of skin and hair, and is of great concern in many physiological and pathological processes. The main cause is that TRPS1 gene mutation leads to loss of function of TRPS1 protein, thereby causing clinical features such as sparse hair, prominent nose, abnormal skeletal development, etc.

[0003] Recent studies have shown that TRPS1 is considered a marker for cancer and has specific expression in various tissues. Its expression pattern is significantly different from other related biomarkers. The specific expression of TRPS1 makes it an important marker for distinguishing TRPS1-related diseases from other types of diseases. Studies have shown that the expression level of TRPS1 in prostate cancer cells often changes. The expression of TRPS1 protein in normal prostate tissue is usually low, but the expression level of TRPS1 in prostate cancer tissue can be significantly increased. This change may be closely related to the occurrence and development of prostate cancer. The same is true for the expression of TRPS1 in ovarian cancer tissue. In breast cancer tissue, the expression level of TRPS1 protein can be heterogeneous. Although TRPS1 protein may be highly expressed in some breast cancer cases, in other cases, its expression level may be low or undetectable. These results suggest that the expression level of TRPS1 protein may be related to the progression and prognosis of cancer.

[0004] Lennartz M et al (Lennartz M, N, D, Dwertmann Rico S, von Bargen C, Kind S, Reiswich V, Viehweger F, Lutz F, Bertram V, Fraune C, Gorbokon N, Weidemann S, Blessin NC, Hube-Magg C, Menz A, Schlichter R, Krech T, Hinsch A, Burandt E, Sauter G, Simon R, Kluth M, Marx AH, Lebok P, Dum D, Minner S, Jacobsen F, Clauditz TS, Bernreuther C, Steurer S. TRPS1 is a Highly Sensitive Marker for Breast Cancer: A Tissue Microarray Study Evaluating More Than 19,000 Tumors From 152 Different Tumor Entities. Am J Surg Pathol. 2024 Jun 1;48(6):637-651. doi: 10.1097 / PAS.0000000000002213. Epub 2024 Apr 18. PMID: 38647255; PMCID: PMC11093513. To determine the diagnostic and prognostic value of TRPS1 IHC, a tissue microarray comprising 19,201 samples of 152 different tumor types and subtypes was analyzed, data showed that TRPS1 staining was visible in 86 of 152 tumor classes, and at least one strongly positive case in 36 of them. TRPS1 staining was predominant in multiple types of breast cancer (51-100%), soft tissue tumors (up to 100%), salivary gland tumors (up to 46%), squamous cell carcinomas (up to 35%) and gynecological cancers (up to 40%). Low expression of TRPS1 was associated with high-grade tumors, high pT stage, lymph node metastasis, loss of hormone receptors, and features of triple-negative breast cancer. Therefore, by developing anti-TRPS1 monoclonal antibodies, a powerful tool can be provided for early diagnosis of tumors, while also helping to evaluate the biological characteristics of tumors and the prognosis of patients.

[0005] Currently, there are challenges in the study of TRPS1 protein, such as: TRPS1 protein is large, contains zinc finger domains and phosphorylation sites, so the expression and purification process of the protein is complex, making it difficult to obtain high-quality TRPS1 protein. Although some anti-TRPS1 antibodies have been developed and used for research, the existing antibodies often lack sufficient specificity and affinity, which limits their effectiveness in basic research and clinical applications. Moreover, the preparation of most TRPS1 polyclonal antibodies on the current market relies on TRPS1 recombinant protein fragments or synthetic peptides for immunization, and these methods often face difficulties in expression, poor specificity, and other problems. SUMMARY

[0006] The first object of the present application is to provide an anti-human TRPS1 monoclonal antibody, and to provide an anti-human TRPS1 monoclonal antibody with good specificity and reliability.

[0007] The second object of the present application is to provide the use of an anti-human TRPS1 monoclonal antibody in the preparation of a TRPS1 detection reagent or kit, and to provide a method for preparing a detection reagent or kit for detecting TRPS1 protein with good specificity and reliability.

[0008] The third object of the present application is to provide a detection reagent or kit, and to provide a detection reagent or kit for detecting TRPS1 protein with good specificity and reliability.

[0009] The fourth object of the present application is to provide a nucleic acid molecule, and to provide a nucleic acid molecule capable of stably expressing an anti-human TRPS1 monoclonal antibody.

[0010] The fifth object of the present application is to provide an expression cassette, an expression vector, a recombinant cell or a recombinant bacteria containing the above-mentioned nucleic acid molecule, and to provide a molecular biology tool capable of stably expressing an anti-human TRPS1 monoclonal antibody.

[0011] The sixth object of the present application is to provide the use of the above-mentioned nucleic acid molecule, expression cassette, recombinant vector, recombinant cell or recombinant bacteria in the preparation of an anti-human TRPS1 monoclonal antibody, and to provide a simple and stable method for producing an anti-human TRPS1 monoclonal antibody.

[0012] The seventh object of the present application is to provide a method for preparing an anti-human TRPS1 monoclonal antibody, to solve the problems of batch difference, low yield, and poor stability of the antibody in the prior art, or to solve the problem of loss of antibody gene in the method of hybridoma.

[0013] To achieve the above-mentioned objects, the technical scheme adopted by an anti-human TRPS1 monoclonal antibody in the present application is:

[0014] An anti-human TRPS1 monoclonal antibody, the anti-human TRPS1 monoclonal antibody comprising VHCDR1, VHCDR2 and VHCDR3 with the amino acid sequences as shown in SEQ ID NO. 1-3, and VLCDR1, VLCDR2 and VLCDR3 with the amino acid sequences as shown in SEQ ID NO. 4-6.

[0015] The beneficial effects of the above technical solutions are that the anti-human TRPS1 monoclonal antibody is a pioneering invention. The application selects the head 1-200 aa and tail 945-1050 aa of TRPS1, uses the recombinant protein connected by Linker as the antigen of TRPS1 protein, immunizes animals to obtain hybridoma cells, and screens a hybridoma cell strain capable of secreting anti-TRPS1 specific antibodies. The anti-human TRPS1 monoclonal antibody secreted by the hybridoma cell strain comprises VHCDR1, VHCDR2 and VHCDR3 with the amino acid sequences as shown in SEQ ID NO. 1-3, and VLCDR1, VLCDR2 and VLCDR3 with the amino acid sequences as shown in SEQ ID NO. 4-6. The experiment verifies that the anti-human TRPS1 monoclonal antibody has the advantages of stable properties, good specificity and affinity.

[0016] Specifically, the TRPS1 antigen prepared by the application can achieve the expected immunization effect, effectively stimulate the immune response, achieve the expected immunization effect, avoid the problem of difficult expression of the TRPS1 protein which is too large, and avoid the low specificity immune effect easily produced when the full-length recombinant protein of TRPS1 is used as an immunogen, thereby improving the immune hit rate of TRPS1. By linking the head and tail domain of TRPS1 for expression, the non-specific immune response caused by the full-length protein can be reduced, thereby improving the specificity of the immune and the hit rate of the antibody, and further obtaining the anti-human TRPS1 monoclonal antibody comprising VHCDR1, VHCDR2 and VHCDR3 with the amino acid sequences as shown in SEQ ID NO. 1-3, and VLCDR1, VLCDR2 and VLCDR3 with the amino acid sequences as shown in SEQ ID NO. 4-6.

[0017] As a further improvement, the anti-human TRPS1 monoclonal antibody heavy chain variable region has the amino acid sequence as shown in SEQ ID NO. 7, and the light chain variable region has the amino acid sequence as shown in SEQ ID NO. 8.

[0018] In order to achieve the above-mentioned purpose, the technical scheme adopted by the application of the anti-human TRPS1 monoclonal antibody in the preparation of a TRPS1 detection reagent or kit is:

[0019] The application of the anti-human TRPS1 monoclonal antibody in the preparation of a TRPS1 detection reagent or kit. The application of the anti-human TRPS1 monoclonal antibody in the preparation of a TRPS1 detection reagent or kit.

[0020] The anti-human TRPS1 monoclonal antibody has good specificity and affinity, and can be used for preparing a TRPS1 detection reagent or kit, and detecting the expression of TRPS1 in tissues and cells.

[0021] Specifically, the anti-human TRPS1 monoclonal antibody can be used for preparing an immunohistochemical, Western blot or ELISA detection reagent or kit that needs the anti-human TRPS1 monoclonal antibody.

[0022] To achieve the above-mentioned purposes, the technical scheme adopted by the detection reagent or kit in the present application is:

[0023] A detection reagent or kit, wherein the detection reagent or kit comprises the anti-human TRPS1 monoclonal antibody.

[0024] The anti-human TRPS1 monoclonal antibody has good specificity and affinity, and the detection reagent and kit comprising the anti-human TRPS1 monoclonal antibody can effectively and specifically detect TRPS1 in tissues and cells, thereby providing a means and tool for further studying the function of TRPS1.

[0025] Further, the anti-human TRPS1 monoclonal antibody with good specificity and affinity can be used to prepare an immunohistochemical staining, immunocyte staining, Western blot or ELISA detection reagent or kit for detecting TRPS1 in tissues or cells according to the needs of users, thereby helping to meet the diversified market demand.

[0026] To achieve the above-mentioned purposes, the technical scheme adopted by the nucleic acid molecule in the present application is:

[0027] A nucleic acid molecule, wherein the nucleic acid molecule encodes the anti-human TRPS1 monoclonal antibody.

[0028] The anti-human TRPS1 monoclonal antibody has good specificity and affinity, and can be used for preparing a TRPS1 detection reagent or kit, and detecting the expression of TRPS1 in tissues and cells.

[0029] Specifically, the nucleic acid molecule can be obtained by genetic engineering recombination technology or chemical synthesis method. It is obvious to those skilled in the art that the variant sequence of the heavy chain variable region nucleotide sequence and / or the light chain variable region nucleotide sequence obtained by adding, deleting, replacing, modifying or mutating one or more nucleotides to the above-mentioned nucleic acid molecule provided in the present application, the amino acid sequence encoded by the variant sequence, the single-chain antibody or chimeric monoclonal antibody or modified monoclonal antibody or other forms of monoclonal antibody or antibody fragment still retains the ability to specifically bind to the TRPS1 protein.

[0030] As a further improvement, the nucleotide sequence of the anti-human TRPS1 monoclonal antibody heavy chain variable region gene is shown as SEQ ID NO. 9; the nucleotide sequence of the anti-human TRPS1 monoclonal antibody light chain variable region gene is shown as SEQ ID NO. 10.

[0031] In order to achieve the above-mentioned purpose, the technical scheme adopted by the expression cassette, expression vector, recombinant cell or recombinant bacteria containing the nucleic acid molecule in the present application is:

[0032] An expression cassette, expression vector, recombinant cell or recombinant bacteria containing a nucleic acid molecule.

[0033] The beneficial effects of the above technical scheme are that the present application provides a nucleic acid molecule encoding an anti-human TRPS1 monoclonal antibody, an expression cassette, an expression vector, a recombinant cell and a recombinant bacteria containing the above-mentioned nucleic acid molecule, and the anti-human TRPS1 monoclonal antibody is preserved in the form of DNA, which is convenient for the later exogenous expression and large-scale industrial production of the anti-human TRPS1 monoclonal antibody.

[0034] Specifically, the expression vector is selected from prokaryotic or eukaryotic expression vectors; more specifically, the expression vector is selected from bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenovirus, retrovirus or other vectors.

[0035] Specifically, the recombinant bacteria are selected from commonly used carrier bacteria in the field of genetic engineering, such as bacteria, yeast, filamentous fungi, etc.

[0036] Specifically, the recombinant cells are selected from commonly used host cells in the field of genetic engineering, such as mammalian cells, insect cells, plant cells, etc.

[0037] In order to achieve the above-mentioned purpose, the technical scheme adopted by the nucleic acid molecule or the expression cassette, expression vector, recombinant cell or recombinant bacteria in the preparation of the anti-human TRPS1 monoclonal antibody is:

[0038] The application of a nucleic acid molecule or an expression cassette, an expression vector, a recombinant cell or a recombinant bacteria in the preparation of an anti-human TRPS1 monoclonal antibody.

[0039] The technical scheme has the beneficial effects that the nucleic acid molecule, the expression cassette, the expression vector, the recombinant cell and the recombinant bacteria provided by the application contain the variable region amino acid sequences of the heavy chain and the light chain of the anti-human TRPS1 monoclonal antibody, and on this basis, the anti-human TRPS1 monoclonal antibody of the application can be obtained by using the conventional genetic engineering method, so that the problems of large batch difference and poor stability of the anti-human TRPS1 monoclonal antibody caused by the batch fluctuation of animals and hybridoma cells can be effectively avoided.

[0040] In order to achieve the above-mentioned purpose, the technical scheme adopted by the preparation method of the anti-human TRPS1 monoclonal antibody in the application is as follows:

[0041] A preparation method of an anti-human TRPS1 monoclonal antibody, wherein the nucleic acid molecule is introduced into a host cell, the cell supernatant is collected, and ultrafiltration is performed to obtain the purified product.

[0042] The technical scheme has the beneficial effects that the nucleic acid molecule, the expression cassette, the expression vector, the recombinant cell and the recombinant bacteria provided by the application contain the variable region amino acid sequences of the heavy chain and the light chain of the anti-human TRPS1 monoclonal antibody, and on this basis, the anti-human TRPS1 monoclonal antibody of the application can be obtained by using the conventional genetic engineering method, so that the problems of large batch difference and poor stability of the anti-human TRPS1 monoclonal antibody caused by the batch fluctuation of animals and hybridoma cells can be effectively avoided.

[0043] As a further improvement, the host cell includes a HEK293 cell, a CHO cell. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 The Western blot detection result of the anti-human TRPS1 mouse monoclonal antibody prepared in Example 5 of the application;

[0045] Figure 2 The immunohistochemical effect diagram of breast cancer in Example 5 of the application (wherein the magnification of the left diagram is 100x, and the magnification of the right diagram is 200x);

[0046] Figure 3 The immunohistochemical effect diagram of lung cancer in Example 5 of the application (wherein the magnification of the left diagram is 100x, and the magnification of the right diagram is 200x);

[0047] Figure 4 The Western blot detection result of the recombinant anti-human TRPS1 mouse monoclonal antibody prepared in Example 5 of the application;

[0048] Figure 5ICH detection results of the recombinant anti-human TRPS1 mouse monoclonal antibody prepared in Example 5 of the present application in breast cancer tissue (100x magnification);

[0049] Figure 6 Comparison chart of ICH detection effects of the anti-human TRPS1 mouse monoclonal antibody prepared in the present application and the anti-human TRPS1 rabbit monoclonal antibody of Abeam in breast cancer tissue (wherein, the left chart is the anti-human TRPS1 rabbit monoclonal antibody of Abeam [EPR16171], the right chart is the anti-human TRPS1 mouse monoclonal antibody prepared in the present application, and the magnification is 100x). DETAILED DESCRIPTION

[0050] Although the anti-human TRPS1 antibody has been developed for research in the prior art, there is a problem of lacking specificity and affinity of scale inhibition, which limits the effectiveness of the anti-human TRPS1 antibody in basic research and clinical application. Monoclonal antibodies become an important tool in biomedical research due to their high specificity and consistency. In order to facilitate the preparation of anti-human TRPS1 monoclonal antibody, the present application selects two key regions of TRPS1, and connects the key regions, and the connecting element Linker is used at the connection. The addition of Linker can maintain the independence of the two key regions, prevent the occurrence of tandem epitopes at the connection, and prepare an anti-human TRPS1 monoclonal antibody containing VHCDR1, VHCDR2 and VHCDR3 with an amino acid sequence as shown in SEQ ID NO. 1-3, and VLCDR1, VLCDR2 and VLCDR3 with an amino acid sequence as shown in SEQ ID NO. 4-6.

[0051] Further, the anti-human TRPS1 monoclonal antibody provided by the present application is detected by Western blot (WB) and immunohistochemistry (IHC), and compared with the polyclonal antibody prepared from recombinant protein or synthetic polypeptide commonly used in the market, the TRPS1 monoclonal antibody prepared by the present application performs excellently in specificity and stability, and has good specificity and reliability in the research of TRPS1 related diseases.

[0052] The present application will be further described in detail below in conjunction with specific examples. Unless otherwise specified, the equipment and reagents used in each example, experimental example and comparative example can be obtained from commercial channels.

[0053] First, a specific embodiment of an anti-human TRPS1 monoclonal antibody of the present application:

[0054] Example 1 Anti-human TRPS1 Monoclonal Antibody

[0055] The anti-human TRPS1 monoclonal antibody of the embodiment comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO. 7 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO. 8. The heavy chain variable region comprises VHCDR1, VHCDR2 and VHCDR3 as shown in SEQ ID NO. 1-3, and the light chain variable region comprises VLCDR1, VLCDR2 and VLCDR3 as shown in SEQ ID NO. 4-6.

[0056] Secondly, a specific embodiment of the detection reagent of the present application is provided.

[0057] Embodiment 2: A detection reagent

[0058] The detection reagent of the embodiment is an immunohistochemical detection reagent, which is a working solution of the anti-human TRPS1 monoclonal antibody of embodiment 1. The concentration of the monoclonal antibody is 0.1 μg / mL, and the solvent is TBS buffer, which contains BSA (bovine serum albumin) with a concentration of 10 mg / mL and preservatives Proclin-300 and Proclin-950, which are both added at a ratio of 1:1000 (V / V).

[0059] Thirdly, a specific embodiment of the nucleic acid molecule of the present application is provided.

[0060] Embodiment 3: A nucleic acid molecule

[0061] The nucleic acid molecule of the embodiment encodes the anti-human TRPS1 monoclonal antibody of embodiment 1. The nucleotide sequence of the heavy chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO. 9, and the nucleotide sequence of the light chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO. 10.

[0062] Fourthly, a specific embodiment of the recombinant cell comprising the nucleic acid molecule of the present application is provided.

[0063] Embodiment 4: A recombinant cell comprising the nucleic acid molecule

[0064] The recombinant cell of the embodiment is a CHO-K1 cell as a starting cell, and a recombinant expression vector for expressing the nucleic acid molecule of embodiment 3 is transfected.

[0065] Fifthly, a specific embodiment of the preparation method of the anti-human TRPS1 monoclonal antibody of the present application is provided.

[0066] Embodiment 5: A preparation method of an anti-human TRPS1 monoclonal antibody

[0067] The preparation method of the anti-human TRPS1 monoclonal antibody of the embodiment selects the recombinant protein composed of the head 1-200 aa and the tail 945-1050 aa of TRPS1 connected by a linker as an immunogen, immunizes mice, isolates hybridoma cells, and detects the specificity of the anti-human TRPS1 monoclonal antibody secreted by the hybridoma cells. Then the gene of the anti-human TRPS1 monoclonal antibody is retrieved, the heavy chain and light chain gene information of the antibody is determined, the heavy chain and light chain genes are amplified and connected to an expression vector, cells are transfected, and the anti-human TRPS1 monoclonal antibody is obtained after the supernatant of the cells is purified and concentrated. The specific implementation operation is as follows:

[0068] 1. Selection of TRPS1 head and tail

[0069] According to the TRPS1 sequence and structure published by Uniprot, the head and tail sequences are selected, and the head and tail sequences are optimized by bioinformatics analysis for the preparation of TRPS1 immunogen. The accession number of human TRPS1 in Uniprot is Q9UHF7, which contains 1281 amino acids, wherein 1-200 aa is the head and 945-1050 aa is the tail. The TRPS1 head-linker-tail protein amino acid sequence is shown as SEQ ID NO. 11, and the nucleic acid sequence is shown as SEQ ID NO. 12.

[0070] 2. Fusion expression and purification of antigen

[0071] (1) Synthesis of TRPS1 head and tail nucleic acid sequences and vector construction

[0072] According to the selected TRPS1 head 1-200 aa and tail 945-1050 aa nucleic acid sequences, TRPS1(1-200 aa)-linker-TRPS1(945-1050 aa) is artificially synthesized after inserting the linker, and enzyme cutting sites NdeI and XhoI are introduced at both ends of the sequence. The synthesized tandem nucleic acid sequence is cloned into the pET-28a expression vector to construct the recombinant plasmid pET-28a-TRPS1(1-200 aa)-linker-TRPS1(945-1050 aa).

[0073] (2) Transformation and expression analysis of recombinant plasmid

[0074] The pET-28a-TRPSl(l-200aa)-linker-TRPSl(945-1050aa) recombinant plasmid constructed above was transformed into BL21(DE3) E. coli competent cells, and a single colony was inoculated into 4 mL of LB liquid medium containing kanamycin (50 μg / mL) for culture. Subsequently, IPTG was added to a final concentration of 1 mM for expression analysis, and the strain capable of expressing the TRPSl protein of interest was preserved.

[0075] (3) Large-scale expression of recombinant protein

[0076] The strain capable of expressing the TRPSl protein of interest in step (2) was inoculated into 350 mL of LB liquid medium containing kanamycin (50 μg / mL) and cultured at 37°C until the OD 600 When the OD reached 0.8, IPTG was added to a final concentration of 0.4 mM, and expression was induced at 37°C for 4 hours.

[0077] (4) Collection and ultrasonic disruption of bacterial cells

[0078] The bacterial cells after induction of expression in step (3) were collected by centrifugation, and the bacterial cells were resuspended with ice-bath-cooled 10 mM PBS. Subsequently, the bacterial cells were disrupted using ultrasonic waves (350 W, 20 minutes, 3 seconds of work and 3 seconds of rest). After disruption, centrifugation was performed at 12000 g for 10 minutes, and the supernatant was collected for the next step of purification.

[0079] (5) Nickel Sepharose gel purification

[0080] The supernatant collected in step (4) was filtered through a 0.45 μm filter, and the obtained filtrate was subjected to nickel Sepharose gel purification. The filtrate was loaded into an equilibrated nickel Sepharose gel column at a flow rate of 1 mL / min, and washed with 10 mM PBS to remove unbound impurity proteins. Subsequently, linear elution was performed using PBS containing 0.5 M imidazole, and different elution peaks were collected for SDS-PAGE to identify the protein purity. The sample with a purity greater than 90% was subjected to ultrafiltration and exchanged into 10 mM PBS for subsequent experiments.

[0081] 3. Screening of TRPSl hybridoma cell strains and preparation of monoclonal antibodies

[0082] (1) Immunization and antibody screening

[0083] The TRPSl protein purified from step 2 was mixed with an equal volume of Freund's complete adjuvant, and 6-8 week old BalB / c mice were immunized by subcutaneous injection. The immunization dose for each mouse was 100 μg. Two weeks later, the second immunization was performed, and the antigen was emulsified with Freund's incomplete adjuvant, and the immunization dose was the same as the first time, and the intraperitoneal injection method was used. After the second immunization, the serum titer was determined by gradient dilution using indirect ELISA method, and the mouse with the highest antibody titer was selected for tail vein pulse immunization, and the pulse dose was 50 μg per mouse.

[0084] (2) Cell fusion

[0085] The sp2 / 0 myeloma cells derived from BalB / c mice were used, and the cells should be in the logarithmic growth phase. The spleen of the mouse after pulse immunization was aseptically removed, and a single cell suspension of spleen cells was prepared. The mouse spleen cells were mixed with myeloma cells at a ratio of 1:5, 1 mL of 37°C 50% PEG (pH 8.0) was added dropwise, and then HAT selective medium was added after mixing. After centrifugation, the supernatant was discarded, HAT medium was added, mixed, and then diluted to 50 mL, and added dropwise to a 96-well cell culture plate. The culture plate was placed in a 37°C, 5% CO2 constant temperature incubator for culture.

[0086] (3) Screening and cloning

[0087] Within 7-10 days after fusion, cell clones were selected and screened (ELISA method). The positive well cells were subjected to limited dilution, and the ELISA value was measured 5-6 days after each limited dilution. The OD 450 The monoclonal well with a higher positive value was further subjected to limited dilution until the ELISA determination of the 96-well plate was positive, and the monoclonal cell strain with a higher positive value was finally selected and determined.

[0088] (4) Preparation and purification of ascites monoclonal antibody

[0089] 8-10 week old BalB / c mice were injected intraperitoneally with 0.5 mL of liquid paraffin, and one week later, each mouse was injected intraperitoneally with 1 mL of monoclonal cell suspension resuspended with PBS, and each strain of cell was injected with 5 x 10 6 cells per mouse, and a total of 3 mice were injected. After the mouse ascites accumulated, the ascites was collected and centrifuged to obtain the supernatant. The ascites was purified by Protein A column chromatography, the concentration of the purified monoclonal antibody was determined, and the purified monoclonal antibody was aliquoted and stored at -20°C.

[0090] 4. Western Blot detection of TRPSl monoclonal antibody specificity

[0091] (1) Sample preparation

[0092] TRPS1 is expressed in 293T and HeLa cell lines, but not in Jurket cell line in the prior art. Therefore, to verify the specificity of the TRPS1 monoclonal antibody, human HeLa cells, 293T cells and Jurket cells were prepared, and lysis was performed using RAPI lysis buffer containing 1 mM PMSF. After lysis, the samples were mixed with 5x SDS-PAGE Loading buffer at a volume ratio of 1:1 for sample preparation.

[0093] (2) Electrophoresis and membrane transfer

[0094] 30 μg of each sample was loaded for SDS-PAGE electrophoresis, with an initial voltage of 80 V for 20 minutes, and then the voltage was adjusted to 120 V until the bromophenol blue dye ran to the bottom of the gel.

[0095] After electrophoresis, the membrane transfer step was performed: the NC membrane and filter paper were soaked in advance with transfer buffer. The samples and membranes were placed in a wet transfer membrane instrument in the form of a sandwich: electrode (-) - sponge - filter paper - gel - NC membrane - filter paper - sponge - electrode (+), and transferred at a constant voltage of 90 V for 90 minutes.

[0096] (3) Blocking

[0097] The NC membrane was immersed in blocking solution (TBST containing 5% skim milk) and incubated at 37°C for 2 hours for blocking treatment to reduce non-specific binding.

[0098] (4) Primary antibody incubation

[0099] The NC membrane was placed in blocking solution containing anti-human TRPS1 monoclonal antibody (2.5 mg / mL antibody diluted 1:2000), and incubated in a 37°C incubator for 1 hour. After incubation, the membrane was washed with TBST 3 times for 5 minutes each time to remove unbound primary antibody.

[0100] (5) Secondary antibody incubation

[0101] The NC membrane was placed in HRP-labeled goat anti-mouse IgG secondary antibody (diluted 1:5000), and incubated in a 37°C shaker for 30 minutes. After incubation, the membrane was washed with TBST 3 times for 5 minutes each time to remove unbound secondary antibody.

[0102] (6) Color development

[0103] After mixing components A and B of ECL luminescent solution at a ratio of 1:1, they were added to the NC membrane for color development. The NC membrane was exposed using an exposure instrument, and the TRPS1 protein band was observed and recorded.

[0104] The WB results are shown in Figure 1As shown, the TRPS1 target band appeared in the 293T and HeLa cell lysate samples, but not in the Jurket cell lysate, indicating that the anti-human TRPS1 monoclonal antibody has good specificity.

[0105] 5. Specificity of TRPS1 Monoclonal Antibody Tested by Immunohistochemistry (IHC)

[0106] (1) Preparation of Tissue Sections

[0107] Human breast cancer and lung cancer tissue paraffin blocks were taken, and sectioning was performed using a Leica tissue sectioning machine, with a section thickness of 3 μm. After sectioning, the sections were dried at 65°C for 2 hours to remove excess paraffin and perform preliminary fixation.

[0108] (2) Immunohistochemical Staining

[0109] The anti-human TRPS1 monoclonal antibody was tested for immunohistochemical staining using a manual immunohistochemical method, with the following specific steps

[0110] ① High-temperature antigen retrieval was performed using DAKO HIGH pH retrieval solution, with a retrieval time of 20 minutes.

[0111] ② After the sections cooled, 100 μL of endogenous peroxidase blocking solution was added, and incubated at room temperature for 5 minutes to block endogenous peroxidase activity. Then, the sections were soaked in washing solution (PBS or TBS) for 2 times, 5 minutes each time.

[0112] ③ Primary antibody incubation: TRPS1 monoclonal antibody was used, diluted at a ratio of 1:1000, and 100 μL of the diluted antibody was added to the sections and incubated at 37°C for 30 minutes. After incubation, the sections were soaked in washing solution for 2 times, 5 minutes each time, to remove unbound primary antibody.

[0113] ④ 100 μL of enzyme-labeled polymer was added, and incubated at room temperature for 20 minutes. After incubation, the sections were again soaked in washing solution for 2 times, 5 minutes each time.

[0114] ⑤ Color development was performed using DAB color developing solution: 100 μL of DAB color developing solution was added, and incubated at room temperature for 5 minutes. After color development, the sections were soaked in purified water for 2 times, 5 minutes each time.

[0115] ⑥ Counterstaining: 100 μL of hematoxylin was added, and the sections were counterstained at room temperature for 5 minutes. After counterstaining, the sections were rinsed with tap water for blueing.

[0116] (3) Dehydration, Transparency, and Mounting

[0117] ① The sections were washed with deionized water for 3 minutes.

[0118] 2. Dehydrate the sections sequentially: 85% ethanol for 1 minute; 95% ethanol for 1 minute; 100% ethanol for 1 minute, repeat twice.

[0119] 3. Use xylene to treat the sections for 1 minute, repeat twice, to achieve transparency.

[0120] 4. Finally, use neutral gum to seal the sections, and cover with a cover glass.

[0121] (4) Microscopic observation

[0122] Observe the staining results by microscopy. The specific results are shown in Figure 2 and Figure 3 , the TRPS1 protein is localized in the nucleus, and shows specific expression in breast cancer tissue and lung cancer tissue, and the staining results are expected to show specific nuclear positive signals.

[0123] 6. TRPS1 antibody gene retrieval

[0124] (1) Total RNA extraction

[0125] Resuscitate the TRPS1 hybridoma cell strain, and collect the cells after detecting the cell titer. Add 1 mL Trizol to the cell suspension, mix thoroughly by blowing, and stand at room temperature for 5-10 minutes until the cells are completely lysed. Then centrifuge at 12000 rpm for 5 minutes, and discard the precipitate. Add 200 μL of chloroform to the supernatant, mix vigorously, stand for 15 minutes, and then centrifuge at 12000 rpm at 4°C for 15 minutes to take the upper aqueous phase. Add an equal volume of isopropanol, mix gently, stand for 10 minutes, and then centrifuge at 12000 rpm at 4°C for 10 minutes to discard the supernatant. Add 1 mL of pre-cooled 75% ethanol to the precipitate, mix by tapping the bottom of the tube, and centrifuge again at 12000 rpm at 4°C for 5 minutes to discard the supernatant. Add 30-50 μL of pre-cooled DEPC water to dissolve at room temperature, and the RNA product is obtained. The RNA product can be stored at -80°C for a long time. During the entire RNA extraction process, a mask and gloves should be worn to prevent RNase contamination.

[0126] (2) 5' RACE to obtain TRPS1 antibody gene

[0127] The SMARTer RACE 5' / 3' Kit (Clontech, Cat. No. 634859) was used to isolate the 5' sequence of the TRPSl antibody. 1 μg of total RNA was used as a template to prepare 5'-RACE-Ready cDNA by first-strand cDNA synthesis using the 5'-CDS primer A, the SMART II A oligo, and the 3'-CDS primer A provided in the kit according to the manufacturer's instructions. Then, PCR amplification of the cDNA ends (RACE) was performed using these cDNAs as templates. The UPM (Universal Primer) and a GSP (gene specific primer) primer designed according to the specific sequence of the TRPSl gene were used in the 5'-RACE PCR reaction.

[0128] The reaction system for the first round of PCR was 50 μL, and the components are shown in Table 1. The reaction program for the PCR is shown in Table 2.

[0129] Table 1. PCR reaction system

[0130] Component Amount 5'-RACE-Ready cDNA cDNA 2.5 μL 10 x UPM 5 μL 10 μM GSP 1 μL 2 x SeqAmp buffer 25 μL SeqAmp DNA polymerase 1 μL ddH2O 15.5 μL

[0131] Table 2. PCR reaction program

[0132]

[0133] The PCR products were stored at 4°C. 5 μL of the PCR products were used for electrophoresis detection using a 1.0% agarose gel. If the electrophoresis results showed a single band, the remaining product was recovered by cutting the gel and cloned into the pRACE vector. Positive clones were selected and sequenced. If the electrophoresis results showed multiple bands, a nested PCR was performed to further amplify the products, which were then cloned into the pRACE vector. Positive clones were selected and sequenced to obtain the TRPSl antibody gene.

[0134] 7. Preparation of recombinant monoclonal antibodies

[0135] (1) Determination of antibody heavy chain and light chain gene information and IMGT database analysis

[0136] The nucleotide sequence of the heavy chain variable region gene of the anti-human TRPS1 monoclonal antibody of the application is shown in SEQ ID NO. 9, and the amino acid sequence is shown in SEQ ID NO. 7; the nucleotide sequence of the light chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO. 10, and the amino acid sequence is shown in SEQ ID NO. 8. Further analysis shows that the amino acid sequences of the VHCDR1-3 of the heavy chain variable region of the monoclonal antibody are shown in SEQ ID NO. 1-3, respectively; and the amino acid sequences of the VLCDR1-3 of the light chain variable region of the monoclonal antibody are shown in SEQ ID NO. 4-6, respectively.

[0137] (2) Primer design and vector construction

[0138] According to the sequencing results, the light chain primer and the heavy chain primer are designed, and the primer sequences are as follows:

[0139] Light chain forward primer (LF): TAAACGGATCTCTAGCGAATTCATGGAGTCAGACACACTCCTG (shown as SEQ ID NO. 13);

[0140] Light chain reverse primer (LR): CGAGCGGCCGCTAGCAAGCTTTCAACACTCATTCCTGTTGAAG (shown as SEQ ID NO. 14);

[0141] Heavy chain forward primer (HF): TAAACGGATCTCTAGCGAATTCATGGGCTTGGGTGTGGACCTG (shown as SEQ ID NO. 15);

[0142] Heavy chain reverse primer (HR): CGAGCGGCCGCTAGCAAGCTTTTATTTACCAGGAGAGTGGGAGAG (shown as SEQ ID NO. 16).

[0143] The cDNA obtained in step 6 is used as a template, and PrimeSTAR Max DNA Polymerase (TAKARA Code No. R045Q) is used for amplification, and the PCR reaction conditions are shown in Table 3.

[0144] Table 3 PCR reaction conditions

[0145]

[0146] PCR amplified fragments and pTT5 vector were digested with EcoR I / Hind III for 3 hours, and the gel was recovered by agarose gel electrophoresis. Then the antibody expression vector was constructed by recombination, and the positive clones with correct sequencing were extracted for plasmid extraction.

[0147] (3) Anti-human TRPS1 recombinant antibody expression and purification

[0148] 1) Cell culture before transfection

[0149] CHO-K1 cells were placed in a 5% CO2 constant temperature incubator and incubated at 37°C, 120 rpm. Before subculture, the cell count was determined, and after confirming the density, the cell suspension was directly added to the culture medium without centrifugation. If there are too many dead cells, the batch of cells should be discarded and new cells should be used.

[0150] 2) Preparation of transfected cells

[0151] Before transient transfection, the cell density and survival rate were determined; without centrifugation, the cell density was directly diluted to 3x10 6 6 / mL and incubated at 37°C, 120 rpm for 10 minutes before transfection.

[0152] 3) Transient transfection

[0153] Use a 15 mL sterile centrifuge tube to mix 5 mL KPM and sterile plasmid DNA at a ratio of heavy chain:light chain 1:1, and mix gently; take another 15 mL sterile centrifuge tube, add 5 mL KPM and 500 μL TA-CHO transfection reagent, and mix gently; mix the contents of the two centrifuge tubes, stand for 10 minutes to prepare the plasmid-vector complex; then add the complex to the cell suspension and return to the 37°C CO2 constant temperature incubator for shaking culture. 3 hours later, add appropriate amount of antibiotic as needed.

[0154] 4) Expression of products

[0155] 600 μL of CHO cell protein expression enhancer can be added 24 hours after transfection; transient transfection nutrient supplement can be added 24 hours after transfection; cell supernatant can be collected 6-8 days after transfection.

[0156] 5) Antibody purification

[0157] The cell culture supernatant was purified using a Protein G column, and the antibody was collected and concentrated in PBS (pH 7.4) by ultrafiltration.

[0158] 6) Verification of anti-human TRPS1 monoclonal antibody

[0159] The effect of the purified anti-human TRPS1 monoclonal antibody was verified using WB, and the specific implementation steps are as described in step 4, and the results are shown in Figure 4 It can be seen from the figure that the TRPS1 target band appears in the 293T and HeLa cell lysate samples.

[0160] The specific implementation steps for verifying the anti-human TRPS1 monoclonal antibody provided in the application on breast cancer tissues using IHC are as described in step 5, and the results are shown in Figure 5 It can be seen from the figure that the TRPS1 protein is localized in the nucleus and shows specific expression in breast cancer tissues, and the staining results are expected to show specific nuclear positive signals.

[0161] Experimental Example 1

[0162] There are few TRPS1 monoclonal antibody products on the market at present, and most of them are rabbit monoclonal antibodies. Among them, the rabbit monoclonal antibody TRPS1 (EPR16171) of Abeam is more commonly used. In this experimental example, the rabbit monoclonal antibody TRPS1 (EPR16171) of Abeam was used for ICH detection on human breast cancer tissues, and the specific implementation steps are as described in step 5 of Example 5.

[0163] The specific detection results are shown in Figure 6 It can be seen from the figure that the rabbit monoclonal antibody TRPS1 (EPR16171) of Abeam and the anti-human TRPS1 monoclonal antibody provided in the application show specific expression in breast cancer tissues, and the staining results are expected to show specific nuclear positive signals. Moreover, under the same concentration and dilution conditions, the positive signal is stronger and the effect is better when the anti-human TRPS1 monoclonal antibody provided in the application is used for immunohistochemical staining, and it is more suitable for detecting tissues and cells with low expression of TRPS1.

[0164] The above results show that the anti-human TRPS1 monoclonal antibody provided in the application has comparable specificity and sensitivity compared with the commonly used rabbit monoclonal antibody TRPS1 (EPR16171) of Abeam on the market; and the anti-human TRPS1 monoclonal antibody provided in the application is a unique mouse monoclonal antibody on the market, which can meet the different needs of consumers.

[0165] In summary, the application provides the variable region amino acid sequences of the heavy chain and the light chain of the anti-human TRPS1 monoclonal antibody, on the basis of which, the monoclonal antibody of the application can be obtained by using the conventional antibody engineering method, and the specific method is described in the examples of the application. The WB and IHC specificity verification test proves that the obtained anti-human TRPS1 recombinant antibody can specifically recognize the human TRPS1 protein and can be used for the WB and IHC immunohistochemical detection. Compared with the conventional monoclonal antibody preparation method, the anti-human TRPS1 monoclonal antibody prepared by using the genetic engineering method has the advantages of known sequence, stable antibody property, good repeatability and the like, the standardized antibody production process avoids the risk factors in the conventional monoclonal antibody production and preservation process. Further, on the basis of the antibody amino acid sequences provided by the application, one or more amino acid addition, deletion, substitution and the like modification can be used to obtain the active fragments or conservative variants, which lay the foundation for further improving the specificity and affinity of the antibody.

[0166] Finally, it should be pointed out that the above embodiments are only used to illustrate the technical solutions of the application, rather than limit the same; although the application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can still be modified, or some or all of the technical features can be replaced by the equivalent; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the application.

Claims

1. A monoclonal antibody against human TRPS1, characterized in that: The anti-human TRPS1 monoclonal antibody comprises VHCDR1, VHCDR2 and VHCDR3 as shown in SEQ ID NO. 1~3, and VLCDR1, VLCDR2 and VLCDR3 as shown in SEQ ID NO. 4~6; the amino acid in SEQ ID NO. 5 is LMS.

2. The anti-human TRPS1 monoclonal antibody according to claim 1, characterized in that: The heavy chain of the anti-human TRPS1 monoclonal antibody has the amino acid sequence shown in SEQ ID NO.7, and the light chain has the amino acid sequence shown in SEQ ID NO.

8.

3. The use of an anti-human TRPS1 monoclonal antibody as described in claim 1 or 2 in the preparation of TRPS1 detection reagents or kits.

4. A detection reagent or kit, characterized in that: The detection reagent or kit contains the anti-human TRPS1 monoclonal antibody as described in claim 1 or 2.

5. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the anti-human TRPS1 monoclonal antibody as described in claim 1 or 2.

6. The nucleic acid molecule according to claim 5, characterized in that: The nucleotide sequence of the heavy chain gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO.9; the nucleotide sequence of the light chain gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO.

10.

7. An expression cassette, expression vector, or recombinant bacteria comprising the nucleic acid molecule of claim 5 or 6.

8. A host cell comprising the nucleic acid molecule of claim 5 or 6.

9. The use of a nucleic acid molecule as described in claim 5 or 6, or an expression cassette, expression vector, or recombinant bacteria as described in claim 7, or a host cell as described in claim 8, in the preparation of an anti-human TRPS1 monoclonal antibody.

10. A method for preparing an anti-human TRPS1 monoclonal antibody as described in claim 1 or 2, characterized in that: The nucleic acid molecule described in claim 5 or 6 is introduced into a host cell, the cell supernatant is collected, and purified by ultrafiltration.

11. The method for preparing the anti-human TRPS1 monoclonal antibody according to claim 10, characterized in that: The host cells include HEK293 cells and CHO cells.

Images