Mutant gene and application thereof, primer pair for detecting virulence of largemouth bass frog iridovirus and application of primer pair

Abstract

The invention relates to the technical field of animal virology, in particular to a mutant gene and application thereof, and a primer pair for detecting virulence of a largemouth bass frog iridovirus and application of the primer pair. The invention provides a mutant gene. The sequence of the mutant gene is as shown in SEQ ID NO: 1. The invention also provides a primer pair and a detection method for detecting the virulence of the micropterus salmoides iridovirus, the detection method can quickly and accurately identify whether the micropterus salmoides iridovirus is a virulent strain or a low virulent strain, and the detection method is simple and convenient to operate.

Description

Technical Field

[0001] The invention relates to the technical field of animal virology, and in particular to a mutant gene and an application thereof, a primer pair for detecting the toxicity of a largemouth bass frog iridovirus and an application thereof. Background Art

[0002] Largemouth bass, commonly known as California bass, is a high-quality freshwater fish with the advantages of strong adaptability, fast growth, easy fishing, and short breeding cycle. In addition, the meat is delicious and tender, without intramuscular spines, and has a beautiful appearance. It is very popular among breeders and consumers. In recent years, the national production of California bass has exceeded 500,000 tons, with an output value of over 10 billion. With the expansion of breeding scale, the increase in breeding density, and the deterioration of the water environment, the disease problems of largemouth bass have become more and more prominent, seriously restricting the sustainable development of the industry. The mortality rate of viral diseases of largemouth bass is high and difficult to prevent and control, which poses a serious threat to the breeding industry of largemouth bass. Among them, the largemouth bass frog iridovirus disease caused by infection with largemouth bass ranavirus (LMBV) of the iridovirus genus is the most harmful, and its virulence difference is closely related to the difference in strains. However, the relevant genes for detecting the virulence of LMBV have not been reported in the prior art. Therefore, it is necessary to discover the virulence-related genes of LMBV so as to detect and effectively prevent LMBV.

[0003] Based on this, the present invention is proposed. Summary of the invention

[0004] The invention aims to provide a mutant gene and application thereof, a primer pair for detecting the toxicity of largemouth bass frog iridovirus and application thereof.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a mutant gene, the sequence of the mutant gene is shown in SEQ ID NO:1.

[0007] Preferably, the mutant gene is obtained by deleting 186 bp from the ORF81 gene;

[0008] The 186 bp sequence is shown in SEQ ID NO: 2;

[0009] The 186 bp are located at positions 438 to 623 of the ORF81 gene;

[0010] The sequence of the ORF81 gene is shown in SEQ ID NO:3.

[0011] The invention also provides application of the mutant gene in preparing a product for detecting the toxicity of the iridovirus of the largemouth bass frog.

[0012] The present invention also provides a primer pair for detecting the toxicity of the largemouth bass frog iris virus, the primer pair comprising an upstream primer and a downstream primer;

[0013] The sequence of the upstream primer is shown in SEQ ID NO:4;

[0014] The sequence of the downstream primer is shown in SEQ ID NO:5.

[0015] The invention also provides application of the primer pair in preparing a kit for detecting the toxicity of the Rana iridovirus.

[0016] The invention also provides a kit for detecting the toxicity of the largemouth bass frog iridovirus, comprising the primer pair.

[0017] The present invention also provides a method for detecting the virulence of the largemouth bass frog iridovirus, comprising the following steps:

[0018] The DNA of the largemouth bass frog iridovirus strain is used as a template and the primer pair is used to perform PCR amplification to obtain an amplified product; the amplified product is detected by agarose gel electrophoresis, and the toxicity of the largemouth bass frog iridovirus is determined according to the amplified product.

[0019] Preferably, the reaction system of the PCR amplification is 0.5-1.5 μL template DNA, 1-3 μL upstream primer, 1-3 μL downstream primer, 11-14 μL 2×Es TaqMasterMix, and 7-10 μL ddH2O.

[0020] Preferably, the reaction conditions for the PCR amplification are pre-denaturation at 90-96°C for 0.5-1.5 min, denaturation at 90-94°C for 20-40 s, annealing at 50-60°C for 0.5-1.5 min, extension at 70-74°C for 1-3 min, for a total of 33-37 cycles; extension at 70-74°C for 8-12 min.

[0021] Preferably, if the amplified product is the ORF81 gene, the largemouth bass frog iridovirus strain is a strong strain; if the amplified product is the mutant gene, the largemouth bass frog iridovirus strain is a weak strain.

[0022] Beneficial effects of the present invention:

[0023] The present invention provides a mutant gene, which is obtained by deleting 186 bp from the ORF81 gene; wherein the 186 bp is located at positions 438 to 623 of the ORF81 gene;

[0024] The present invention also provides a primer for detecting the virulence of the largemouth bass frog iridovirus and a detection method. The DNA of the largemouth bass frog iridovirus strain is used as a template, and the primer pair is used for PCR amplification to obtain an amplified product; the amplified product is detected by agarose gel electrophoresis, and the virulence of the largemouth bass frog iridovirus is judged according to the amplified product. If the amplified product is the ORF81 gene, the largemouth bass frog iridovirus strain is a strong strain; if the amplified product is the mutant gene, the largemouth bass frog iridovirus strain is a weak strain. The detection method can quickly and accurately identify whether the largemouth bass frog iridovirus is a strong strain or a weak strain, and the detection method is simple and convenient to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a sequence comparison diagram of the strong strain LMBV-ZJDSS-F1 and the weak strain LMBV-ZJDSS-F110;

[0026] Figure 2 It is the electrophoresis result diagram of the amplified product, in which lane 1 is the strong strain LMBV-ZJDSS-F1, and lane 2 is the weak strain LMBV-ZJDSS-F110;

[0027] Figure 3 This is the electrophoresis result of 16 strains of Rana iridovirus in Example 2. DETAILED DESCRIPTION

[0028] The present invention provides a mutant gene, the sequence of the mutant gene is shown in SEQ ID NO: 1;

[0029] The SEQ ID NO: 1 is:

[0030] ATGGCATTTACTATGAACCTCAAAGTTTGTGGCAAATCAGTTGTCATTTACGGGCAACTTGGACTTACCTTTGACACAATTTGCAAAAGCGCTTACGCGTTTATAGACGAACCGTTTGACGATTCCGTATCCGTCAAAGCTGTAACTGCGCAAGGTTTGTTTGGCTGCGGAGACTCTGTCATAACGTTTGACGCTGGCGTGTACGTTTGCATGAACCCAGATGGTACCAGCGCCCCCGTCATTCTATTTGGACGTCATTTGGACAAAACTCCTGCAATAAAGTTTACCACCGTAAAGAAAACGGTACAAACTGCCGAATGCGGTACGCAGACAGATTCACCTGCTTTGCCAACGCTGTTTAACCCTTCTCAGTCTTCCACTTCTCTGTTTGGCCCCGCAACCCCTCCTCAGCCATCCACTTCTCTGTTTGGTCCTGGCCCAAAACCAGCCGAGACGCAGCAACCCTCCACCTCTGCAGCGCAGGCTTCCCTCTCTGGCAGTTTACGTCAAGTAAACTTTGCCCCAGCTGAGGCAAACAATGGTTATGTTTGCCCATTTGCCGCACATAGGCAAGCTTTAAGAACTGCATCACCTCAAGGTGGCCTTAACCAAGACTTGGCCCTGCAAGAGCCACTCCCAGCAGGTATAATAAAATATAGTATAAAATAA。

[0031] In the present invention, the mutant gene is obtained by deleting 186 bp from the ORF81 gene;

[0032] The sequence of the 186 bp is shown as SEQ ID NO:2;

[0033] The SEQ ID NO:2 is:

[0034] AGCTAAACCGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTGGTCCTGGAGCTAAACCGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTTGGTCCTGGAGCTAAACAGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTTGGTCCTGGAGCTAAACCAGTCTCTACTCTGTTTGGTCCTGG.

[0035] The 186 bp are located at positions 438 to 623 of the ORF81 gene;

[0036] The sequence of the ORF81 gene is shown in SEQ ID NO: 3;

[0037] The SEQ ID NO:3 is:

[0038] .

[0039] The invention also provides application of the mutant gene in preparing a product for detecting the toxicity of the iridovirus of the largemouth bass frog.

[0040] The present invention also provides a primer pair for detecting the toxicity of the largemouth bass frog iris virus, the primer pair comprising an upstream primer and a downstream primer;

[0041] The sequence of the upstream primer is shown in SEQ ID NO:4;

[0042] The sequence of the downstream primer is shown in SEQ ID NO:5;

[0043] The SEQ ID NO:4 is GGCGCTATGGTCCATCTT;

[0044] The SEQ ID NO:5 is TATCTTGACGAAACCCTCACA.

[0045] The invention also provides application of the primer pair in preparing a kit for detecting the toxicity of the Rana iridovirus.

[0046] The invention also provides a kit for detecting the toxicity of the largemouth bass frog iridovirus, comprising the primer pair.

[0047] The present invention also provides a method for detecting the virulence of the largemouth bass frog iridovirus, comprising the following steps:

[0048] The DNA of the largemouth bass frog iridovirus strain is used as a template and the primer pair is used to perform PCR amplification to obtain an amplified product; the amplified product is detected by agarose gel electrophoresis, and the toxicity of the largemouth bass frog iridovirus is determined according to the amplified product.

[0049] In the present invention, the reaction system of PCR amplification is:

[0050] Template DNA 0.5-1.5 μL, preferably 0.8-1.2 μL, more preferably 1 μL;

[0051] 1 to 3 μL of upstream primer, preferably 1.5 to 2.5 μL, more preferably 2 μL;

[0052] 1 to 3 μL of downstream primer, preferably 1.5 to 2.5 μL, more preferably 2 μL;

[0053] 2×Es Taq MasterMix 11-14 μL, preferably 12-13 μL, more preferably 12.5 μL;

[0054] ddH2O 7 to 10 μL, preferably 8 to 9 μL, more preferably 8.5 μL.

[0055] In the present invention, the reaction conditions of the PCR amplification are pre-denaturation at 90-96°C for 0.5-1.5 min, denaturation at 90-94°C for 20-40 s, annealing at 50-60°C for 0.5-1.5 min, extension at 70-74°C for 1-3 min, for a total of 33-37 cycles; extension at 70-74°C for 8-12 min;

[0056] Preferably, the pre-denaturation is at 92-94°C for 0.8-1.2 min, the denaturation is at 91-93°C for 25-35 s, the annealing is at 53-57°C for 0.8-1.2 min, the extension is at 71-73°C for 1.5-2.5 min, for a total of 34-36 cycles; the extension is at 71-73°C for 9-11 min;

[0057] More preferably, the pre-denaturation is at 93°C for 1 min, the denaturation is at 92°C for 30 s, the annealing is at 55°C for 1 min, the extension is at 72°C for 2 min, for a total of 35 cycles; and the extension is at 72°C for 10 min.

[0058] In the present invention, if the amplified product is the ORF81 gene, the largemouth bass frog iridovirus strain is a strong strain; if the amplified product is the mutant gene, the largemouth bass frog iridovirus strain is a weak strain.

[0059] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0060] Example 1

[0061] The strong strain of largemouth bass frog iridovirus and the weak strain of largemouth bass frog iridovirus were selected, and the ORF81 coding frame was used as the amplification region (NCBI GenBank: OQ267587). The upstream and downstream primers were designed as LMBV-ORF-up: GGCGCTATGGTCCATCTT (SEQ ID NO: 4), LMBV-ORF-dn: TATCTTGACGAAACCCTCACA (SEQ ID NO: 5).

[0062] A commercial DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used to extract DNA from the strong strain of largemouth bass frog iridovirus LMBV-ZJDSS-F1 (from Zhejiang Freshwater Fisheries Research Institute) and its 110th generation variant strain LMBV-ZJDSS-F110 weak strain (purchased from China Center for Type Culture Collection, with a collection number of CCTCC NO: V202485), and the DNA of the largemouth bass frog iridovirus strain was used as a template to perform PCR amplification using the primers described above to obtain an amplified product;

[0063] The reaction system for PCR amplification was: 1 μL template DNA, 2 μL upstream primer, 2 μL downstream primer, 12.5 μL 2×Es Taq MasterMix, 8.5 μL ddH2O;

[0064] The reaction conditions for PCR amplification were pre-denaturation at 93°C for 1 min, denaturation at 92°C for 30 s, annealing at 55°C for 1 min, and extension at 72°C for 2 min, for a total of 35 cycles; extension at 72°C for 10 min;

[0065] The amplified products of the strong strain LMBV-ZJDSS-F1 and the weak strain LMBV-ZJDSS-F110 were analyzed by electrophoresis. Figure 1 shown.

[0066] from Figure 1 It can be seen that the strong strain LMBV-ZJDSS-F1 obtained an amplified band of 673bp, while the weak strain LMBV-ZJDSS-F110 obtained an amplified band of 487bp; it can be seen that the sequences of the strong strain and the weak strain in the ORF81 coding region are not the same.

[0067] The amplified products of the strong strain LMBV-ZJDSS-F1 and the weak strain LMBV-ZJDSS-F110 were sequenced. The amplified sequences of the strong strain LMBV-ZJDSS-F1 and the weak strain LMBV-ZJDSS-F110 are shown in SEQ ID NO: 1, SEQ ID NO: 3 and Figure 2 As shown;

[0068] The sequence SEQ ID NO:3 of the amplification product of the virulent strain LMBV-ZJDSS-F1 is: ATGGCATTTACTATGAACCTCAAAGTTTGTGGCAAATCAGTTGTCATTTACGGGCAACTTGGACTTACCTTTGACACAATTTGCAAAAGCGCTTACGCGTTTATAGACGAACCGTTTGACGATTCCGTATCCGTCAAAGCTGTAACTGCGCAAGGTTTGTTTGGCTGCGGAGACTCTGTCATAACGTTTGACGCTGGCGTGTACGTTTGCATGAACCCAGATGGTACCAGCGCCCCCGTCATTCTATTTGGACGTCATTTGGACAAAACTCCTGCAATAAAGTTTACCACCGTAAAGAAAACGGTACAAACTGCCGAATGCGGTACGCAGACAGATTCACCTGCTTTGCCAACGCTGTTTAACCCTTCTCAGTCTTCCACTTCTCTGTTTGGCCCCGCAACCCCTCCTCAGCCATCCACTTCTCTGTTTGGTCCTGGAGCTAAACCGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTGGTCCTGGAGCTAAACCGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTGGTCCTGGAGCTAAACAGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTGGTCCTGGAGCTAAACCAGTCTCTACTCTGTTTGGTCCTGGCCCAAAACCAGCCGAGACGCAGCAACCCTCCACCTCTGCAGCGCAGGCTTCCCTCTCTGGCAGTTTACGTCAAGTAAACTTTGCCCCAGCTGAGGCAAACAATGGTTATGTTTGCCCATTTGCCGCACATAGGCAAGCTTTAAGAACTGCATCACCTCAAGGTGGCCTTAACCAAGACTTGGCCCTGCAAGAGCCACTCCCAGCAGGTATAATAAAATATAGTATAAAATAA;

[0069] The amplified sequence SEQ ID NO:1 of the attenuated strain LMBV-ZJDSS-F110 is ATGGCATTTACTATGAACCTCAAAGTTTGTGGCAAATCAGTTGTCATTTACGGGCAACTTGGACTTACCTTTGACACAATTTGCAAAAGCGCTTACGCGTTTATAGACGAACCGTTTGACGATTCCGTATCCGTCAAAGCTGTAACTGCGCAAGGTTTGTTTGGCTGCGGAGACTCTGTCATAACGTTTGACGCTGGCGTGTACGTTTGCATGAACCCAGATGGTACCAGCGCCCCCGTCATTCTATTTGGACGTCATTTGGACAAAACTCCTGCAATAAAGTTTACCACCGTAAAGAAAACGGTACAAACTGCCGAATGCGGTACGCAGACAGATTCACCTGCTTTGCCAACGCTGTTTAACCCTTCTCAGTCTTCCACTTCTCTGTTTGGCCCCGCAACCCCTCCTCAGCCATCCACTTCTCTGTTTGGTCCTGGCCCAAAACCAGCCGAGACGCAGCAACCCTCCACCTCTGCAGCGCAGGCTTCCCTCTCTGGCAGTTTACGTCAAGTAAACTTTGCCCCAGCTGAGGC AAACAATGGTTATGTTTGCCCATTTGCCGCACATAGGCAAGCTTTAAGAACTGCATCACCTCAAGGTGGCCTTAACCAAGACTTGGCCCTGCAAGAGCCACTCCCAGCAGGTATAATAAAATATAGTATAAAATAA;

[0070] From Figure 2As can be seen from the sequences SEQ ID NO: 1 and SEQ ID NO: 3, after the toxicity of the strong strain weakened, the ORF81 gene mutated. The mutant gene (the amplified sequence of the weak strain) lacked 186bp compared with the ORF81 gene. The 186bp sequence is located at positions 438 to 623 of the ORF81 gene, and its sequence is: AGCTAACCGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTGGTCCTGGAGCTAAACCGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTGGTCCTGGAGCTAAACAGGCCGCTCCCCCCCAGCCGTCCACTTCTCTGTTTGGTCCTGGAGCTAAACCAGTCTCTACTCTGTTTGGTCCTGG (SEQ ID NO: 2).

[0071] Example 2

[0072] The method described in Example 1 was used to detect 8 strong strains and 8 weak strains of Rana iridovirus from different sources (see Table 1 for strain information). The test results are as follows: Figure 3 shown.

[0073] Table 1 Information of largemouth bass frog iridovirus strains

[0074]

[0075]

[0076] from Figure 3 It can be seen that all the strong strains obtained an amplified band of 673bp, that is, while the weak strains obtained an amplified band of 487bp.

[0077] The amplified products were sequenced, and the amplified product of the strong strain was the ORF81 gene, and the amplified product of the weak strain was the mutant gene in Example 1, indicating that the detection results of this method were consistent with the actual strain situation.

[0078] It can be seen from the above embodiments that the present invention provides a mutant gene and its application, a primer pair for detecting the virulence of the largemouth bass frog iridovirus and its application. The detection method can quickly and accurately identify whether the largemouth bass frog iridovirus is a strong strain or a weak strain, and the detection method is simple and convenient to operate.

[0079] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A mutant gene, characterized in that: The sequence of the mutant gene is shown in SEQ ID NO:

1.

2. The mutant gene according to claim 1, characterized in that The mutant gene is obtained by deleting 186 bp from the ORF81 gene; The 186 bp sequence is shown in SEQ ID NO: 2; The 186 bp are located at positions 438 to 623 of the ORF81 gene; The sequence of the ORF81 gene is shown in SEQ ID NO:

3.

3. Use of the mutant gene according to claim 1 or 2 in the preparation of a product for detecting the toxicity of the Rana iridovirus.

4. A primer pair for detecting the virulence of the largemouth bass frog iridovirus, characterized in that: The primer pair includes an upstream primer and a downstream primer; The sequence of the upstream primer is shown in SEQ ID NO:4; The sequence of the downstream primer is shown in SEQ ID NO:

5.

5. Use of the primer pair according to claim 4 in preparing a kit for detecting the virulence of Rana iridovirus.

6. A kit for detecting the toxicity of the largemouth bass frog iris virus, characterized in that: Comprising the primer pair described in claim 5.

7. A method for detecting the virulence of the iridovirus of the largemouth bass frog, characterized in that: The steps include: The DNA of the largemouth bass frog iridovirus strain is used as a template, and the primer pair described in claim 4 is used for PCR amplification to obtain an amplified product; the amplified product is detected by agarose gel electrophoresis, and the toxicity of the largemouth bass frog iridovirus is determined according to the amplified product.

8. The method according to claim 7, characterized in that The reaction system of the PCR amplification is 0.5-1.5 μL template DNA, 1-3 μL upstream primer, 1-3 μL downstream primer, 11-14 μL 2×Es Taq MasterMix, and 7-10 μL ddH2O.

9. The method according to claim 8, characterized in that The reaction conditions of the PCR amplification are pre-denaturation at 90-96°C for 0.5-1.5 min, denaturation at 90-94°C for 20-40 s, annealing at 50-60°C for 0.5-1.5 min, extension at 70-74°C for 1-3 min, a total of 33-37 cycles; extension at 70-74°C for 8-12 min.

10. The method according to claim 9, characterized in that If the amplified product is the ORF81 gene, the largemouth bass frog iridovirus strain is a strong strain; if the amplified product is the mutant gene described in claim 1, the largemouth bass frog iridovirus strain is a weak strain.

Images