Application of CD84 as therapeutic target in development, screening or preparation of medicine for preventing and treating pulmonary fibrosis

Abstract

The invention provides an application of CD84 as a therapeutic target in developing, screening or preparing a medicine for preventing and treating pulmonary fibrosis, and belongs to the technical field of biological medicines. The CD84 is used as a therapeutic target to be applied to development, screening or preparation of drugs for preventing and / or treating pulmonary fibrosis. A gene knockout technology is utilized to verify that inhibition of CD84 expression or inhibition of CD84 biological functions can effectively inhibit the pulmonary fibrosis process from the cellular level and the animal level respectively. The invention develops a new drug target for drug development, screening and preparation of pulmonary fibrosis, and has important social significance and medical significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and treating pulmonary fibrosis. Background Art

[0002] Pulmonary fibrosis (PF) is a disease characterized by persistent damage to the alveoli, which leads to varying degrees of inflammation and fibrosis in the alveoli and interstitium, and then to destruction of the lung structure and respiratory failure. It is therefore also called interstitial lung disease (ILD). The causes of pulmonary fibrosis include known causes such as physical, chemical, and biological factors, as well as pulmonary fibrosis of unknown etiology. Pulmonary fibrosis with known causes, such as interstitial lung disease associated with connective tissue diseases, includes rheumatoid arthritis-associated interstitial lung disease (RA-ILD), systemic sclerosis-associated interstitial lung disease (SSc-ILD), and systemic lupus erythematosus-associated interstitial lung disease (SLE-ILD). The cause and mechanism of the disease are mainly due to the body's excessive immune response to self- or foreign antigens, which causes the activation of multiple immune cells such as lung lymphocytes, which then secrete a large number of cytokines, causing pulmonary fibrosis by mediating immune responses. Pulmonary fibrosis of unknown etiology, including idiopathic pulmonary fibrosis (IPF), belongs to the idiopathic interstitial pneumonia (IIP) group in the interstitial lung disease (ILDs) family. It is the most common and most serious chronic interstitial lung disease of unknown etiology. IPF originates from abnormal repair after recurrent or persistent alveolar epithelial damage. Under the multiple continuous damage of known or unknown endogenous and exogenous damaging factors, the damaged lung epithelial cells start the damage repair mechanism, the epithelial regeneration and repair are insufficient, the residual cells undergo mesenchymal transformation, present a pro-fibrotic phenotype, secrete a large number of pro-fibrotic factors, abnormally activate and proliferate fibroblasts, produce excessive extracellular matrix deposition, lead to the formation of fibrous scars and honeycomb capsules, destroy the alveolar structure, and cause irreversible and continuous decline in lung function, eventually leading to respiratory failure and death. IPF clinically manifests as progressive dyspnea accompanied by irritating dry cough. The disease often continues to progress, with a median survival of approximately 2.8 years and a 5-year survival rate of less than 50%. Most patients die from respiratory failure and secondary lung infections.

[0003] Currently, there are two drugs for the treatment of pulmonary fibrosis on the market worldwide, namely pirfenidone and nintedanib. Both can slow down the rate of decline in patients' forced vital capacity (FVC), but are not very effective in improving acute exacerbations of IPF and prolonging survival. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide an application of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and treating pulmonary fibrosis, and to provide a new strategy for preventing and treating pulmonary fibrosis by adjusting the expression of CD84 at the gene level and protein level.

[0005] The present invention provides the use of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and / or treating pulmonary fibrosis.

[0006] Preferably, the pulmonary fibrosis includes idiopathic pulmonary fibrosis and / or pulmonary fibrosis indications.

[0007] Preferably, the pulmonary fibrosis indications include one or more of the following: systemic sclerosis-related interstitial lung disease, spontaneous systemic lupus erythematosus interstitial lung disease and rheumatoid arthritis-related interstitial lung disease.

[0008] Preferably, the pulmonary fibrosis is induced by bleomycin.

[0009] Preferably, the CD84 comprises macrophage CD84.

[0010] Preferably, the macrophages include pro-fibrotic macrophages and pro-inflammatory macrophages.

[0011] Preferably, the prevention and / or treatment of pulmonary fibrosis includes: the drug is a drug that causes CD84 deletion or down-regulates expression, and inhibits the activation of macrophages and / or reduces the migration of macrophages to the lungs.

[0012] Preferably, the prevention and / or treatment of pulmonary fibrosis includes: the drug is a drug that causes CD84 deletion or down-regulates expression and inhibits JAK1 / STAT3 signal activation.

[0013] The present invention provides the use of CD84 as a diagnostic marker in the preparation of a kit for diagnosing and / or evaluating prognosis of pulmonary fibrosis.

[0014] The present invention provides CD84 + Use of macrophages as diagnostic markers in the preparation of a kit for diagnosing and / or evaluating prognosis of pulmonary fibrosis.

[0015] The present invention provides the use of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and / or treating pulmonary fibrosis. The present invention found that CD84 is specifically upregulated in the peripheral blood of patients with pulmonary fibrosis, and CD84 is detected in the lung tissue of the pulmonary fibrosis model. +Increased macrophage infiltration promotes the formation of fibrotic foci. This shows that CD84 may be involved in the occurrence and development of pulmonary fibrosis. Profibrotic macrophages and proinflammatory macrophages can secrete profibrotic mediators or inflammatory factors, and are important cells that promote the progression of fibrosis. The present invention experiments have shown that CD84 deficiency can inhibit the migration of macrophages to lung tissue, and it has been proven at both gene and protein levels that the activation of profibrotic macrophages and proinflammatory macrophages can be significantly inhibited by downregulating the expression of CD84 or inhibiting the function of CD84. At the same time, the loss of CD84 in macrophages can significantly reduce hydroxyproline, thereby reducing the deposition of lung tissue collagen caused by bleomycin and reducing the area of ​​pulmonary fibrosis, thereby obtaining CD84 as a therapeutic target that can effectively regulate the degree of BLM-induced pulmonary fibrosis. The present invention further conducts in-depth research on the molecular mechanism of CD84 regulating pulmonary fibrosis in macrophages. The JAK1 / STAT3 signaling pathway is an important signaling pathway that mediates inflammatory responses. The relationship between CD84 and inflammatory responses was explored by verifying the effect of knocking down the expression of macrophage CD84 on the inflammatory response signaling pathway. The results showed that knocking down CD84 led to reduced phosphorylation levels of STAT3 and JAK1 in cells, and that CD84 and JAK1 had a direct interaction, indicating that CD84 can positively regulate JAK1 / STAT3 signal transduction. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a diagram of the infiltration of CD84+ macrophages in mouse lung tissue;

[0017] Figure 2 CD84 deficiency reduces the migration of macrophages into lung tissue; A is the in vivo imaging of fluorescently labeled macrophages in mice, and B is the quantification of the fluorescence intensity of macrophages in lung tissue;

[0018] Figure 3 The result is that CD84 deficiency reduces the proportion of macrophages migrating into lung tissue;

[0019] Figure 4 The results showed that CD84 deficiency in monocytes reduced the area of ​​BLM-induced lung fibrosis;

[0020] Figure 5 It is the result of the action of CD84 on profibrotic macrophages;

[0021] Figure 6 These are the results of CD84's effect on pro-inflammatory macrophages, where A is the expression result of IL-6; B is the expression result of TNF-α; C is IL-1β;

[0022] Figure 7 The results show the effect of CD84 knockdown on JAK1 / STAT3 signaling;

[0023] Figure 8 is the spectrum of EnCMV-Flag-JAK1 plasmid;

[0024] Fig. 9 is the spectrum of pENCMV-HA-CD84 plasmid;

[0025] Fig.10 This is the result of the interaction detection between CD84 and JAK1. DETAILED DESCRIPTION

[0026] The present invention provides the use of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and / or treating pulmonary fibrosis.

[0027] In the present invention, the pulmonary fibrosis preferably includes idiopathic pulmonary fibrosis and / or pulmonary fibrosis indications. The idiopathic pulmonary fibrosis (IPF) is manifested by abnormal repair after alveolar epithelial damage. Under multiple continuous damages from exogenous and exogenous damaging factors, the damage repair mechanism is activated, epithelial regeneration and repair are insufficient, and the remaining cells undergo mesenchymal-like transformation, presenting a pro-fibrotic phenotype, secreting a large amount of pro-fibrotic factors, causing abnormal activation and proliferation of fibroblasts, and producing excessive extracellular matrix deposition, leading to the formation of fibrous scars and honeycomb capsules, and the alveolar structure is destroyed, causing the irreversible continuous decline of lung function, and ultimately leading to respiratory failure and death. IPF is clinically manifested as progressive dyspnea with irritating dry cough, and the condition often continues to progress. In an embodiment of the present invention, the pulmonary fibrosis is preferably induced by bleomycin.

[0028] In the present invention, the CD84 preferably includes CD84 of macrophages. The macrophages preferably include profibrotic macrophages and proinflammatory macrophages. The prevention and / or treatment of pulmonary fibrosis includes: the drug is a drug that causes CD84 to be deleted or down-regulated, and inhibits the activation of macrophages and / or reduces the transfer of macrophages to the lungs. The present invention has no special restrictions on the method of CD84 functional loss, and any reagent known in the art to inhibit the function of CD84 protein can be used, including CD84 protein inhibitors, etc. The method for down-regulating CD84 expression is preferably achieved by interfering RNA, such as using SiRNA to inhibit the expression of CD84 gene or knocking out CD84 gene using gene editing technology. The sequence of the SiRNA is SEQ ID NO: 3.

[0029] In the present invention, the bleomycin-induced pulmonary fibrosis disease model was used as a research object to verify the effect of CD84 as a therapeutic target. First, by detecting the expression of CD84 in the peripheral blood of patients with pulmonary fibrosis, the results showed that compared with the healthy control group, the expression of CD84 in the peripheral blood of IPF patients was significantly increased, with a significant difference.+ Macrophages infiltrate and promote the formation of fibrotic foci in the lung tissue of the pulmonary fibrosis model. This suggests that CD84 may be involved in the development of pulmonary fibrosis. The present invention further confirms the connection between the development of pulmonary fibrosis by regulating the expression level of CD84 or the function of the protein. Compared with the control group, knocking out CD84 in macrophages or blocking the function of CD84 will reduce the migration of macrophages to the lungs in pulmonary fibrosis, and inhibit the activation of profibrotic macrophages and proinflammatory macrophages, thereby inhibiting the expression of profibrotic factors (TGF-β1 and IL-10) and proinflammatory factors (IL-6, TNF-α and IL-1β), and inhibiting the progress of pulmonary fibrosis to a certain extent. At the same time, the lack of CD84 in macrophages can significantly reduce the content of hydroxyproline, thereby effectively reducing the collagen deposition of lung tissue, and the lack of CD84 in macrophages can significantly reduce the area of ​​bleomycin-induced pulmonary fibrosis, thereby inhibiting the formation of pulmonary fibrosis.

[0030] In the present invention, the prevention and / or treatment of pulmonary fibrosis includes: the drug is a drug that causes CD84 to be missing or down-regulated, and inhibits the activation of JAK1 / STAT3 signals. In an embodiment of the present invention, in order to further explore the molecular mechanism between CD84 and pulmonary fibrosis, the relationship between CD84 gene expression and JAK1 / STAT3 signal after knocking down was carried out. JAK1 / STAT3 signal is an important pathway for mediating inflammatory response. Specifically in pulmonary fibrosis, it plays an important regulatory role in the process of pulmonary fibrosis by mediating pathological activation and damage of pulmonary macrophages, fibroblasts and alveolar epithelial cells. The results showed that the phosphorylation levels of STAT3 and JAK1 decreased after CD84 knockdown, indicating that CD84 can regulate JAK1 / STAT3 signal transduction, and CD84 and JAK1 have direct interactions, proving that CD84 can directly participate in the activation of JAK1 / STAT3 signals. Therefore, inhibiting CD84 gene expression or blocking the function of CD84 protein can effectively inhibit the activation of JAK1 / STAT3 signals, thereby achieving the purpose of inhibiting the process of pulmonary fibrosis.

[0031] The present invention provides the use of CD84 as a diagnostic marker in the preparation of a kit for diagnosing and / or evaluating prognosis of pulmonary fibrosis.

[0032] In the examples of the present invention, CD84 is differentially expressed in the peripheral blood of healthy controls and IPF patients, and is upregulated in the peripheral blood of IPF patients, which indicates that CD84 has good sensitivity and specificity as a diagnostic marker for pulmonary fibrosis.

[0033] The present invention provides CD84 + Use of macrophages as diagnostic markers in the preparation of a kit for diagnosing and / or evaluating prognosis of pulmonary fibrosis.

[0034] In another embodiment of the present invention, compared with the control group mice, the CD84 + Cell infiltration increased significantly, and α-SMA + Myofibroblasts are recruited to CD84 + cells, forming fibrosis foci. + Macrophages are used as diagnostic markers for the diagnosis of pulmonary fibrosis.

[0035] The following is a detailed description of the application of CD84 provided by the present invention as a therapeutic target in the development, screening or preparation of drugs for preventing and treating pulmonary fibrosis in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0036] Example 1

[0037] CD84 expression is upregulated in the peripheral blood of IPF patients

[0038] 1. Experimental Methods

[0039] Peripheral blood samples from 8 healthy controls and 10 IPF patients were collected in anticoagulant tubes containing sodium heparin, and then centrifuged at 3000rpm for 15min to allow blood cells to settle at the bottom. The supernatant was discarded, and red blood cell lysis buffer was added for 3min, followed by centrifugation at 800rpm for 5min. The cells were washed once with PBS, and then 1mL TRIZOL was added to extract RNA. The cells were allowed to stand for 10min for full lysis. 0.2mL chloroform was added to each EP tube, vortexed for 15s, allowed to stand at room temperature for 3min, and then centrifuged at 4℃ and 12000rpm for 15min. The upper aqueous phase was then transferred to a new 1.5mL RNase free EP tube, and an equal volume of isopropanol was added to mix. The tube was allowed to stand at room temperature for 10min, and then centrifuged at 4℃ and 12000rpm for 10min. At this time, white flocculent precipitate was visible at the bottom. Discard the supernatant, add 1 mL of 75% ethanol prepared with DEPC water to wash the precipitate, centrifuge at 4°C and 7000 rpm for 5 min, repeat the wash once, aspirate the supernatant, dry it at room temperature for 10 min, add 20 μL of RNase free water to dissolve the RNA, and store the RNA in a -80°C refrigerator.

[0040] 2. After the RNA extraction experiment, the expression of CD84 in the peripheral blood of healthy controls and IPF patients was detected. The frozen RNA was thawed in an ice box and the concentration was measured using an ultra-micro spectrophotometer. The corresponding volume of each sample was calculated according to the mass of 1000ng. 4μL 5× Super Mix and appropriate amount of RNA were added to the eight rows of tubes in sequence, and RNase free water was added to 20μL. The eight rows of tubes were placed in a PCR instrument and the program was set at 42℃ for 15min and 95℃ for 3min for reverse transcription. The qPCR system was prepared into a 20 μL system, including: 2 μL reverse transcription product cDNA, 10 μL Super Mix, 1 μL upstream primer (GGAGAAGAGGGTAATGTCCTTCA, SEQ ID NO: 1), 1 μL downstream primer (CCATTGCGATGTCT GCACA, SEQ ID NO: 2), and 6 μL RNase free water. Then eight rows of tubes were placed in the Roche LC96 instrument and the program was set as pre-denaturation: 95°C (300 s); denaturation: 95°C (30 s); annealing: 55°C (30 s); extension: 72°C (30 s), for a total of 40 cycles, to detect the expression of the target gene and perform data processing.

[0041] The results are shown in Table 1. As shown in Table 1, compared with the healthy control group, the expression of CD84 in the peripheral blood of IPF patients increased significantly, with significant differences.

[0042] Table 1 Expression of CD84 in peripheral blood of healthy controls and IPF patients

[0043] Grouping Health Group IPF patients CD84 0.98±0.17 1.73±0.69

[0044] Note: Data are expressed as "mean ± standard error".

[0045] Example 2

[0046] CD84 is expressed in lung tissues of BLM mice + Macrophage infiltration and promotion of fibrosis formation

[0047] 1. Model mouse construction and sample processing

[0048] C57BL6 / J male mice, 7-8 weeks old, were used to construct a pulmonary fibrosis model by tracheal injection of bleomycin (2U / kg). The day of modeling was day 0, and the control group was injected with NaCl. The mice were killed on the 21st day of modeling, and the lung tissues of the mice were embedded in paraffin and fixed. Specifically, the lung tissue samples were fixed with 4% formalin for 48 hours, and dehydrated in a gradient of 75% ethanol, 80% ethanol, 85% ethanol, 90% ethanol, 95% ethanol, 100% ethanol, and 100% ethanol, each gradient for 1 hour, and then passed through 1 / 2 xylene + 1 / 2 ethanol for 30 minutes, xylene for 1 hour, and infiltrated in paraffin for 12 hours, and then embedded in paraffin with a tissue embedding machine, and the wax block was cut into 5μm thick slices by a tissue slicer.

[0049] 2. After the experiment, the infiltration of CD84 in the lung tissue of BLM mice and its co-localization with the myofibroblast activation marker α-SMA were detected. The experimental results are as follows:

[0050] Immunofluorescence detection of CD84 infiltration and localization: paraffin sections were placed in an oven at 60°C for 2 hours, and then dewaxed in xylene I for 15 minutes, xylene II for 15 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, 95% ethanol for 5 minutes, 85% ethanol for 5 minutes, 75% ethanol for 5 minutes, and running water for 5 minutes. Then the sections were immersed in 3% hydrogen peroxide, incubated at room temperature for 10 minutes, and then washed with running water for 5 minutes. Next, the sections were infiltrated with citric acid repair solution, and the repair jar was placed in a microwave oven for antigen repair. High heat for 3 minutes, let it stand for 5 minutes, then high heat for 3 minutes, let it stand for 5 minutes, then medium-low heat for 1 minute, let it stand for 5 minutes, then take out the repair jar and cool it to room temperature, and wash the sections with PBST 3 times, each time for 5 minutes. After washing, the slices were immersed in 0.2% Triton X-100 solution prepared in PBS for permeabilization and perforation for 10 minutes, washed with PBST for 3 times, 5 minutes each time, immersed in 5% BSA solution prepared in PBS for blocking for 30 minutes, and then the blocking solution was discarded. The CD84 and α-SMA primary antibodies were diluted with 5% BSA in an appropriate proportion and dropped on the slices, and the slices were placed in a wet box at 4°C overnight. The next day, the wet box was taken out to recover the primary antibody, the slices were washed with PBST for 3 times, 5 minutes each time, and the fluorescent secondary antibody was added. After incubation at room temperature and away from light for 2 hours, the secondary antibody was recovered, and the slices were washed with PBST for 3 times, 5 minutes each time, and an appropriate amount of anti-fluorescence quenching sealing agent containing DAPI was added for sealing, and the slices were stored in a dark box. After drying, the slices were observed and filmed under a laser scanning confocal microscope (SP8) using 405nm, 488nm and 561nm channels.

[0051] The results are as follows Figure 1 As shown. Figure 1 It can be seen that compared with the control group mice, the CD84+ Cells and α-SMA + Cell infiltration increased significantly, and α-SMA + Myofibroblasts are recruited to CD84 + The cells together form fibrosis foci.

[0052] Example 3

[0053] CD84 deficiency in macrophages reduces macrophage migration into the lung in pulmonary fibrosis

[0054] 1. Model mouse construction and sample processing

[0055] C57BL6 / J male mice, 7-8 weeks old, were injected with 100 μL of chlorophosphate liposomes through the tail vein on day 0 to eliminate mononuclear macrophages in the mice. Two days later, the legs of wild-type mice (WT) and CD84 knockout mice (KO, purchased from Jiangsu Jicui Pharmaceutical Co., Ltd.) were removed under sterile conditions, and the bone marrow cells in the femur and tibia of the mice were flushed out with a 1mL syringe filled with culture medium. The red blood cell lysis buffer was used for 3 minutes and then washed with sterile PBS to obtain primary mouse bone marrow-derived macrophages (BMDM), namely WT BMDM and KO BMDM. BMDM was stained with the live cell dye CSFE (10 μM) for 15 minutes and then labeled with green fluorescence. These green fluorescent BMDM cells were returned to the mononuclear macrophage-depleted mice through the tail vein, and 1×10 were returned to each mouse. 6 cells. 24 hours later, BLM was instilled into the trachea of ​​these mice according to their body weight to induce pulmonary fibrosis. The experimental groups included WT BMDM-NaCl group, WT BMDM-BLM group, KO BMDM-NaCl group and KO BMDM-BLM group. In vivo imaging experiments were performed on days 7, 14 and 21 after modeling. On day 21, the mice were killed and their lung tissues were taken for flow cytometry detection.

[0056] 2. After the experiment, the number and proportion of macrophages recruited to the lung tissue were detected. The experimental results are as follows:

[0057] 2.1 In vivo imaging to detect macrophage recruitment: In vivo imaging was performed using the small animal three-dimensional optical in vivo quantitative analysis system IVIS Spectrum. Mice on days 7, 14, and 21 after modeling were anesthetized with isoflurane inhalation. Because the fur color of the black mice would block some fluorescence, the lungs of the black mice were depilated with depilatory cream. The anesthetized mice were placed supine on the animal platform of the in vivo imaging device. After the mice were stable, chemiluminescence imaging was selected and photographed with 490nm excitation light to record the imaging pictures of the mice emitting fluorescence.

[0058] The results are as follows Figure 2 As shown. Figure 2 As shown in the results in Figure A, the fluorescence began to appear in the lungs of mice in the BLM group on the 7th day and reached the maximum fluorescence intensity on the 21st day, but the fluorescence intensity of the lungs of mice in the WT-BLM group was stronger than that of the KO-BLM group, indicating that CD84 deficiency can inhibit the recruitment of macrophages to lung tissue. The fluorescence intensity of lung tissue was further quantified, as shown in Figure 2. Figure 2 As shown in B, at D14 and D21, the fluorescence intensity of the KO-BLM group was significantly lower than that of the WT-BLM group, proving that the absence of CD84 in macrophages can significantly prevent the migration of macrophages into lung tissue in pulmonary fibrosis.

[0059] 2.2 Flow cytometry detection of changes in the proportion of macrophages recruited to lung tissue: on the 21st day, the mouse lung tissue was separated, the lung tissue was minced with scissors, and an appropriate amount of 1 mg / mL collagenase II was added to immerse it, and digested in a 37°C water bath for 1-2 h until the lung tissue was digested into a single cell suspension. The single cell suspension was passed through a cell sieve with a pore size of 70 μm, and 800 uL PBS was added to wash it. After centrifugation at 800 rpm for 5 min, the supernatant was discarded. 1 mL of red blood cell lysis buffer was added to each tube for lysis for 3 min, and the supernatant was discarded after centrifugation at 800 rpm for 5 min. 1 mL of Cell Staining buffer was added for washing, and the supernatant was discarded after centrifugation at 800 rpm for 5 min. The cells were resuspended with 100 μL Cell Staining buffer, 1 μL of blocking solution TruStain FCXTM was added, and the cells were blocked on ice for 15 min. 800 μL Cell Staining buffer was added to wash once, and the cells were centrifuged at 800 rpm for 5 min to discard the supernatant, and resuspended with 100 μL Cell Staining buffer. Flow cytometry antibodies PE-Cy7-CD45, Violet-Gr-1, APC-CD64, PE-SiglecF and FITC-Cd11b were added according to the recommended dosage in the instruction manual, and incubated on ice in the dark for 30 minutes. After incubation, 800 μL Cell Staining buffer was added to wash twice, and then 500 μL Cell Staining buffer was added to resuspend the single cells, and the changes in the proportion of SiglecF+Cd11b+ macrophages were detected by flow cytometry.

[0060] The results are as follows Figure 3 As shown. Figure 3 The results showed that compared with WT-NaCl, the proportion of macrophages in the lung tissue of mice in the WT-BLM group increased significantly to 17.1%, while the proportion in the KO-BLM group decreased significantly to 9.96%, a decrease of 7.14% compared with the WT-BLM group, indicating that the absence of CD84 in macrophages can reduce the migration of macrophages to lung tissue in pulmonary fibrosis.

[0061] Example 4

[0062] CD84 deficiency in macrophages significantly alleviates BLM-induced pulmonary fibrosis

[0063] 1. Construction of model mice and sample processing

[0064] Using the Cre-LoxP system, CD11b Cre Mice (purchased from Jiangsu Jicui Pharmaceutical Co., Ltd.) and CD84 fl / fl Mice (purchased from Jiangsu Jicui Pharmaceutical Co., Ltd.) were hybridized for more than 3 generations, and male macrophage-specific CD84-deficient mice (CD11b Cre CD84 fl / fl , CD84-CKO) and littermate wild-type mice (CD11b Cre CD84 - / - , WT), and a pulmonary fibrosis model was established by tracheal injection of bleomycin (2U / kg). On the day of modeling, the mice were divided into groups according to their body weight, with 8 mice in each group. The specific groupings were as follows: control group (WT-NaCl), model group (WT-BLM), CD84 knockout group (CD84-CKO), and CD84 knockout model group (CD84-CKO-BLM). The day of modeling was day 0, and the mice were weighed and their general condition was observed every day. They were killed on the 21st day after modeling.

[0065] 2. Index detection

[0066] After the experiment, the hydroxyproline content in the lung tissue and the area of ​​pulmonary fibrosis in each group of mice were tested. The experimental results are as follows:

[0067] 2.1 Determination of Hydroxyproline Content: After the mice were dissected, the hydroxyproline (HYP) content of the mouse lung tissue was determined. Specifically, after the mice were killed, the right lung of the mouse was separated, placed in a 5mL ampoule, placed in a 120°C oven for drying, hydrolyzed under the action of hydrochloric acid, the pH value was adjusted to 6.5-8.0, the residue was filtered with a 0.5μm filter membrane, PBS (phosphate-balanced saline) was added to adjust the total volume to 10mL, 50μL of sample was taken, 350μL of deionized water was added, 200μL of chloramine T solution was added and incubated at room temperature for 20min, 200μL of perchloric acid was added and incubated at room temperature for 5min, 200μL of p-dimethylaminobenzaldehyde (P-DMAB) was added and incubated at 65°C for 20min. Take 200 μL to a 96-well plate to measure the absorbance of the sample at 570 nm, draw a standard curve using the standard reading, and then calculate the hydroxyproline concentration Cs of the measured sample according to the formula obtained from the standard curve. Convert it to the amount of hydroxyproline contained in the entire right lung according to formula I.

[0068] The amount of hydroxyproline in the right lung = Cs × 8 (dilution factor of the sample) × 10 (total sample volume) Formula I

[0069] The specific results are shown in Table 2. Compared with the control group, the HYP content in the right lung of the model group was significantly increased, and the HYP content in the CD84-CKO-BLM group was significantly reduced compared with the WT-BLM group, indicating that the loss of CD84 in macrophages can significantly reduce the collagen deposition in lung tissue caused by bleomycin.

[0070] Table 2 Effect of CD84 deficiency on hydroxyproline content in mouse lung tissue

[0071]

[0072] Note: Data are expressed as "mean ± standard error".

[0073] 2.2 Statistics of pulmonary fibrosis area

[0074] The mouse lung tissue was obtained and embedded in paraffin, and then the mouse lung tissue sections were stained with H&E. After collecting images, the pulmonary fibrosis area in the sections was calculated using Image-Pro Plus software, and the percentage of pulmonary fibrosis area was calculated according to Formula II.

[0075] Pulmonary fibrosis area percentage = pulmonary fibrosis area / total lung section area × 100% Formula II

[0076] like Figure 4 As shown, obvious fibrosis foci appeared in the lung tissues of mice in the WT-BLM group, while the fibrosis area in the CD84-CKO-BLM group was significantly reduced.

[0077] The fibrosis area was further counted. As shown in Table 3, the average lung fibrosis area of ​​mice in the WT-BLM group reached 36.6%, while that of the CD84-CKO-BLM group decreased to 20.2%, indicating that the absence of CD84 in macrophages can significantly reduce the formation of bleomycin-induced lung fibrosis.

[0078] Table 3 Effect of CD84 deficiency on the area of ​​pulmonary fibrosis in mice

[0079]

[0080] Note: Data are expressed as "mean ± standard error".

[0081] Example 5

[0082] CD84 is responsible for the activation of profibrotic macrophages

[0083] 1. Treatment of Macrophages

[0084] Current studies have shown that the expression profiles of profibrotic macrophages and IL-4 / 13-induced macrophages are very similar (doi:10.1183 / 13993003.02441-2018.). Therefore, the IL-4 / 13-induced macrophage activation model was used to study the role of CD84. THP1 monocytes were inoculated in six-well plates under sterile conditions at a density of approximately 1×10 6 / well, add PMA after 24h to make the working solution concentration 100ng / mL to induce monocyte adhesion. Then siRNA will be used to knock down the CD84 gene. The sequence of Scrambled siRNA is CUUACGCUGAGUACUUCGA (SEQ ID NO: 3), and the sequence of CD84 siRNA is GCUACAACCUGCAAAUCUAUU (SEQ ID NO: 4). The experiment is divided into four groups: Scrambled siRNA, Scrambled siRNA+IL-4 / 13, CD84 siRNA, and CD84siRNA+IL-4 / 13. Each well uses 200μL of OPTI-MEM as the dispersion system, adds 2μg of siRNA and 6μL of transfection reagent (Lipo2000), and incubates for 5min respectively. Then mix the two, flick the bottom of the tube to mix them thoroughly, incubate for 10min, and then add them to the well plate. After 48 h of small interfering RNA knockdown, interleukin 4 (IL-4) and interleukin 13 (IL-13) were added to the two stimulation groups at a working concentration of 20 ng / mL to co-stimulate THP1 cells, and the cells and supernatant were collected after 24 h.

[0085] 2. After the experiment, the expression of activation markers and secreted pro-inflammatory factors of pro-fibrotic macrophages was detected. The experimental results are as follows:

[0086] 2.1 Profibrotic macrophage markers: The cells were collected with RIPA lysis buffer, ultrasonically disrupted, centrifuged at 4°C 12000rpm for 10min, and the supernatant was taken as the protein extract. The protein concentration was quantified using the BCA kit, and the absorbance was measured at 562nm using an enzyme marker. A standard curve was prepared based on the absorbance and protein standard concentration, and the sample loading volume was calculated. Loading buffer was added to the protein extract, the sample was boiled at 100°C, the sample was loaded according to the calculated sample volume, and protein electrophoresis was performed in sequence of 80V30min for the concentrated gel and 120V for 1h for the separation gel. After the protein electrophoresis was completed, the gel plate was removed, the gel block near the target protein was cut off and placed in the transfer folder, and placed in the order of filter paper-gel-PVDF membrane-filter paper, and transferred at 100V for 2h. After the transfer was completed, the PVDF membrane was quickly immersed in 5% skim milk prepared in TBST solution, and the shaker was slowly shaken to seal for 1h. Afterwards, cut the membrane positions corresponding to GAPDH, CD163, CD206 and Arg-1, put them into the incubation box containing the corresponding antibodies, and incubate them on a shaker at 4°C overnight. The next day, take out the incubation box to recover the primary antibody, add an appropriate amount of TBST solution to wash, each time for 10 minutes, add the corresponding secondary antibody according to the primary antibody properties of the strip, incubate on a shaker at room temperature for 2 hours, wash with TBST solution, each time for 10 minutes, prepare the exposure solution, use a chemiluminescence imager to take pictures and analyze the strip results.

[0087] Depend on Figure 5 It can be seen that compared with the control group, the expression of CD206, CD163 and Arg1 in the model group was significantly increased. Compared with the two stimulation groups with IL4 / 13, the expression level of markers in the CD84 siRNA+IL-4 / 13 stimulation group was significantly lower than that in the Scrambled siRNA+IL4 / 13 group, which indicates that the knockdown of CD84 can significantly inhibit the expression and activation of profibrotic macrophage marker proteins.

[0088] 2.2 Content of profibrotic factors in cell supernatant

[0089] Take the ELISA kit (purchased from Shanghai ELISA Co., Ltd.) out of the 4°C refrigerator and equilibrate to room temperature in advance. First, dilute the standard sample in a gradient according to the instructions, centrifuge the cell culture fluid to be tested at 1000rpm for 20min, take 100μL of the cell supernatant and the standard sample of different concentrations and add them to the pre-coated 96-well ELISA plate, cover with a sealing film, incubate at 37°C for 1h, take out the ELISA plate after incubation, discard the liquid, add 100μL of the 1x biotinylated antibody working solution diluted in advance with the diluent directly to each well, cover with a sealing film, incubate at 37°C for 1h, discard the liquid, add 300μL of washing solution to each well, and let it stand for 1min , shake off the washing solution, pat dry on absorbent paper, repeat washing 3 times, add 100μL of 1x enzyme conjugate working solution diluted with diluent to each well, cover with sealing film, incubate at 37℃ for 30min, discard the liquid, wash the plate 5 times according to the above washing steps, add 90μL substrate to each well after completion, cover with sealing film, incubate at 37℃ in the dark for 15min, take out the ELISA plate, add 50μL stop solution to each well, immediately measure the OD value of each well at a wavelength of 450nm, draw a standard curve, and calculate the sample content according to the standard curve. Calculate and count the Elisa results.

[0090] The results are shown in Table 4. As shown in Table 4, compared with the control group, the expression levels of profibrotic factors TGF-β, Ccl18, Ccl22 and IL-10 secreted by the Scrambled siRNA+IL-4 / 13 stimulation group were significantly increased, and after CD84 knockdown, the expression levels of these profibrotic factors in the CD84siRNA+IL-4 / 13 stimulation group decreased, indicating that CD84 knockdown can inhibit the expression of profibrotic factors.

[0091] Table 4 Effects of CD84 knockdown on profibrotic factors

[0092]

[0093] Note: Data are expressed as "mean ± standard error".

[0094] Example 6

[0095] CD84 is responsible for pro-inflammatory macrophage activation

[0096] 1. Treatment of pro-inflammatory macrophages

[0097] THP1 monocytes were inoculated in six-well plates under sterile conditions at a density of approximately 1×10 6 / well, add PMA after 24h to make the working solution concentration 100ng / mL to induce monocyte adhesion. Then replace 10% of 1640 medium with 1‰ medium, and use siRNA to knock down the CD84 gene. The sequence of Scrambled siRNA is CUUACGCUGAGUACUUCGA (SEQID NO: 3), and the sequence of CD84 siRNA is GCUACAACCUGCAAAUCUAUU (SEQ ID NO: 4). The experiment is divided into four groups: Scrambled siRNA (NC), Scrambled siRNA+LPS / IFN-γ, CD84siRNA, and CD84 siRNA+LPS / IFN-γ. Each well uses 200μL of OPTI-MEM as the dispersion system, adds 2μg of siRNA and 6μL of transfection reagent (Lipo2000), and incubates for 5min respectively. Then mix the two, flick the bottom of the tube to mix them thoroughly, incubate for 10min, and then add them to the well plate. After 48 h of small interfering RNA knockdown, LPS / IFN-γ was added to the two stimulation groups at a working concentration of 100 ng / mL to co-stimulate THP1 cells, and the cells were harvested after 24 h.

[0098] 2. Index detection

[0099] Add 1mL Trizol to each well, blow off the cells, transfer to a 1.5mL RNase free centrifuge tube, and let stand for 5-10min to fully lyse the cells. Add 200μL chloroform to each tube, vortex thoroughly for 15s, and let stand at room temperature for 2-3min. Centrifuge at 4℃12000rpm for 15min, transfer 400μL of the upper water layer to a new RNase free1.5mL centrifuge tube, add 400μL isopropanol, mix well, and let stand at room temperature for 10min. Centrifuge at 4℃12000rpm for 10min to obtain flocculent precipitate as RNA, discard the supernatant, add 1mL 75% ethanol, wash the precipitate, repeat once, aspirate the excess solution, evaporate at room temperature, and the RNA becomes colorless, indicating that the ethanol has evaporated completely. Add RNasefree water to dissolve, place in an ice box for 15min, and use a micro-spectrophotometer to detect and record the RNA concentration. Then reverse the RNA into cDNA, and the reversal program is: 42℃15min, 95℃3min. Then, the RT-PCR system was configured as follows: 2×SYBR GreenMix 10 μL per tube, upstream and downstream primers 1 μL per tube, RNase free water 6 μL, cDNA template 2 μL. The primer sequences used are shown in Table 5.

[0100] Table 5 Primer sequences

[0101]

[0102] After completion, Roche LC96 was used to detect the expression of the target gene. The program was set as pre-denaturation: 95°C (300s); denaturation: 95°C (30s); annealing: 55°C (30s); extension: 72°C (30s), for a total of 40 cycles, to detect the expression of the target gene and perform data processing.

[0103] like Figure 6 As shown, CD84 knockdown can inhibit LPS / IFN-γ-induced macrophage activation, as evidenced by the significant inhibition of the expression of inflammatory factors IL-6, TNF-α, and IL-1β.

[0104] Example 7: CD84 directly regulates JAK1 / STAT3 signaling

[0105] 1. Experimental Methods

[0106] THP1 monocytes were seeded in six-well plates at a density of approximately 1×10 6 / well, and PMA inducer was added 24 hours later to induce monocyte adhesion. Then, 10% of 1640 medium was replaced with 1‰ medium, and siRNA was used to knock down the CD84 gene, including control small interfering RNA (Scrambled siRNA) and CD84 small interfering RNA (CD84 siRNA). The sequence of Scrambled siRNA is CUUACGCUG AGUACUUCGA (SEQ ID NO: 3), and the sequence of CD84 siRNA is GCUACAACCUGCAAAUCUAUU (SEQ ID NO: 4). The experiment was divided into four groups: Scrambled siRNA, Scrambled siRNA+IL-4 / 13, CD84 siRNA, and CD84 siRNA+IL-4 / 13. Each well was dispersed with 200 μL of OPTI-MEM, and 2 μg of siRNA and 6 μL of transfection reagent (Lipo2000) were added. They were incubated for 5 min, then the two were mixed, and the bottom of the tube was flicked to mix them thoroughly. After incubation for 10 min, they were added to the well plate. After 48 h of small interfering RNA knockdown, interleukin 4 (IL-4) and interleukin 13 (IL-13) were added to the two stimulation groups at a working concentration of 20 ng / mL to co-stimulate THP1 cells, and the cells were collected 1 h later.

[0107] 2. Collect cells with RIPA lysis buffer, ultrasonically disrupt 7 times, centrifuge at 4℃12000rpm for 10min, take supernatant as protein extract, quantify protein concentration using BCA kit, measure absorbance at 562nm with microplate reader, make standard curve based on absorbance and protein standard concentration, and calculate sample loading volume. Add 5X Loading buffer to protein extract, boil at 100℃ for 7min, load sample according to calculated sample volume, and perform protein electrophoresis in sequence of 80V 30min for concentrated gel and 120V 1h for separation gel. After protein electrophoresis, remove the gel plate, cut off the gel block near the target protein and place it in the transfer folder, place it in the order of filter paper-gel-PVDF membrane-filter paper, place the transfer folder in the transfer tank filled with transfer solution, place the transfer tank in an ice box, and transfer at 100V for 2h. After the transfer is completed, quickly immerse the PVDF membrane in 5% skim milk prepared with TBST solution, and slowly shake the shaker to seal for 1h. After that, cut the membrane position corresponding to the target gene, put it into the incubation box containing the corresponding antibody, and incubate it on a shaker at 4°C overnight. The next day, take out the incubation box to recover the primary antibody, add an appropriate amount of TBST solution to wash 3 times, 10 minutes each time, add the corresponding secondary antibody according to the primary antibody properties of the strip, and incubate it on a shaker at room temperature for 2 hours. Recover the secondary antibody, wash it 3 times with TBST solution, 10 minutes each time, prepare the exposure solution, use a chemiluminescence imager to take pictures and analyze the strip results.

[0108] Depend on Figure 7 It can be seen that compared with the control group, the phosphorylation levels of STAT3 and JAK1 in the Scrambled siRNA+IL-4 / 13 group were significantly increased, and the JAK / STAT signal-related proteins PPARγ and SOCS3 were also significantly increased; after CD84 knockdown, the phosphorylation levels of STAT3 and JAK1 decreased, indicating that CD84 can regulate JAK1 / STAT3 signal transduction.

[0109] Example 8

[0110] CD84 directly interacts with JAK1

[0111] 1. Experimental Methods

[0112] 293T tool cells were inoculated in a P100 culture dish. When the density reached 70-80%, the 10% DMEM medium was replaced with 1‰ DMEM for plasmid transfection. The experimental groups were divided into CTL group, Flag-JAK group and Flag-JAK1+HA-CD84 group. The specific operation was as follows: the constructed pEnCMV-Flag-JAK1 plasmid (see the spectrum) was transfected into Figure 8 , wherein the JAK1 gene sequence is SEQ ID NO: 11, purchased from Miaoling Biotechnology Co., Ltd.), pENCMV-HA-CD84 plasmid (see the spectrum Fig. 9 , CD84 gene sequence is SEQ ID NO:12, purchased from Miaoling Biotechnology Co., Ltd.) and empty control plasmid according to the experimental grouping requirements, each was added with 8 μg and incubated with 500 μL OPTI medium, and liposome transfection reagent was added to 500 μL OPTI medium at a ratio of 3:1 to plasmid mass volume for co-incubation. After 5 minutes, the two OPTIs were mixed and incubated again for 20 minutes, and then the mixture was added to the culture dish. After 12 hours of transfection, the culture medium was replaced with normal 10% DMEM. After 48 hours of co-transfection, the cell samples were collected for CO-IP experiments.

[0113] Prepare lysis buffer and add protease inhibitors, pre-cool on ice. Wash the cells in the P100 dish once with 800μL PBS, scrape the cells with 800μL lysis buffer, sonicate briefly, centrifuge at 12000rpm for 10min, aspirate 50μL supernatant and add loading buffer to cook the sample as input, and then transfer 700μL to a new EP tube for target protein extraction. Add 4μL Flag antibody to each sample, place on a shaker, and call overnight at 4℃. Add ProteinA / G to the sample the next day and incubate for 4h. Then centrifuge the sample at 1000rpm, discard the supernatant, wash with 1mL washing buffer, 1min each time for a total of 6 times, and try to dry the supernatant for the last time, add an equal volume of loading buffer to the ProteinA / G beads, and then perform immunoblotting analysis.

[0114] Depend on Fig.10 It can be seen that CD84 and JAK1 have a direct interaction, proving that CD84 can directly participate in the activation of JAK1 / STAT3 signaling.

[0115] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of CD84 as a therapeutic target in the development, screening or preparation of drugs for the prevention and / or treatment of pulmonary fibrosis.

2. The application according to claim 1, characterized in that: The pulmonary fibrosis includes idiopathic pulmonary fibrosis and / or pulmonary fibrosis indications.

3. The application according to claim 1, characterized in that: The pulmonary fibrosis indications include one or more of the following: systemic sclerosis-related interstitial lung disease, spontaneous systemic lupus erythematosus interstitial lung disease and rheumatoid arthritis-related interstitial lung disease.

4. The use according to claim 1, characterized in that: The pulmonary fibrosis was induced by bleomycin.

5. The use according to claim 1, characterized in that: The CD84 includes CD84 of macrophages.

6. The use according to claim 1, characterized in that: The macrophages include profibrotic macrophages and proinflammatory macrophages.

7. The use according to claim 1, characterized in that: The method for preventing and / or treating pulmonary fibrosis includes: the drug is a drug that causes CD84 deletion or down-regulates expression, and inhibits the activation of macrophages and / or reduces the migration of macrophages to the lungs.

8. The use according to claim 1, characterized in that: The method for preventing and / or treating pulmonary fibrosis includes: the drug is a drug that causes CD84 deletion or down-regulates expression and inhibits JAK1 / STAT3 signal activation.

9. Use of CD84 as a diagnostic marker in the preparation of a kit for diagnosing and / or evaluating prognosis of pulmonary fibrosis. 10.CD84 + Use of macrophages as diagnostic markers in the preparation of a kit for diagnosing and / or evaluating prognosis of pulmonary fibrosis.

Images