A Schizosaccharomyces pombe genetic engineering strain with improved acetic acid tolerance, construction method and application thereof

By knocking out the gene-engineering strain SPAC922.07c gene of S. cerevisiae, the genetically engineered strain SPAC922.07cΔ was solved, which significantly improved the glucose consumption rate and ethanol production rate of the strain under acetic acid stress, and improved the winemaking efficiency of the yeast bacteria.

CN119875867BActive Publication Date: 2025-07-29TIANJIN UNIV OF SCI & TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510389387.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-31
Publication Date
2025-07-29
Estimated Expiration
2045-03-31

AI Technical Summary

Technical Problem

Saccharomyces cerevisiae has weak tolerance to organic acids, which limits the development of high-tolerance industrial strains, affecting the growth and metabolism of the yeast population and the efficiency of liquor brewing.

Method used

By knocking out the SPAC922.07c gene in Schizosacia samaritus, the genetically engineered strain SPAC922.07cΔ was constructed, and homologous recombination method was used and G418 resistance was used as a screening marker to improve the strain's tolerance to acetic acid.

Benefits of technology

It significantly improves the tolerance of Schizolipoon to acetic acid, shortens the growth delay period, improves the glucose consumption rate and ethanol production rate, and enhances the fermentation efficiency under acetic acid stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119875867B_ABST
    Figure CN119875867B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biotechnology, and discloses a Schizosaccharomyces pombe genetic engineering strain with improved acetic acid tolerance, a construction method and an application thereof. The engineering strain is obtained by knocking out the gene SPAC922.07c in the starting strain Schizosaccharomyces pombe, so as to achieve the purpose of improving the acetic acid tolerance performance of Schizosaccharomyces pombe. For the engineering strain of the present invention, the experimental results of the YPD100 fermentation medium show that under the stress of 15 g / L acetic acid, the engineering strain SPAC922.07cΔ consumed all the glucose in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate increased by 22.08%; the engineering strain reached the maximum ethanol yield of 44.57 g / L in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate increased by 26.44%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a genetically engineered strain of Schizosaccharomyces pombe with improved acetic acid tolerance, a construction method thereof, and an application thereof. Background Art

[0002] The high-acid microenvironment is a characteristic property of Baijiu brewing. The increase in acidity in the fermented grains affects the growth and metabolism of brewing microorganisms, especially the yeast flora. The normal growth and metabolism of the yeast flora are the determining factors for the normal production of Baijiu. Therefore, breeding yeast strains with excellent fermentation traits under high-acid conditions is of great significance for the efficient and stable production of Baijiu. At the same time, it also provides a new strategy for the construction of high-performance cell factories in the bio-manufacturing industry.

[0003] In recent years, although the acid tolerance mechanism of Saccharomyces cerevisiae has been relatively deeply analyzed, the development of industrial strains with higher tolerance has been limited to a certain extent due to the relatively weak tolerance of Saccharomyces cerevisiae to organic acids. Some non-Saccharomyces cerevisiae, such as Zygosaccharomyces bailii, Schizosaccharomyces pombe, etc., have begun to attract the attention of researchers because of their better stress resistance. These non-Saccharomyces cerevisiae strains with outstanding stress resistance not only enrich the industrial microbial strain library but also provide important resources for comprehensively analyzing the stress resistance mechanism of microorganisms.

[0004] Non-Saccharomyces cerevisiae has similarities with Saccharomyces cerevisiae in responding to organic acid stress. For example, a thicker cell wall and a more rigid cell membrane endow strains such as Zygosaccharomyces bailii with stronger acetic acid tolerance. In addition to the common ways of resisting environmental stress with Saccharomyces cerevisiae, some non-Saccharomyces cerevisiae also have unique response mechanisms when dealing with organic acid stress. For example, Stratford M et al. found that Zygosaccharomyces bailii exhibits population heterogeneity under acetic acid stress, that is, through asymmetric mitosis, it ensures that some strains have relatively less intracellular acetic acid accumulation, thereby reducing the cell stress caused by acetic acid accumulation. Guerreiro JF et al. found that some Zygosaccharomyces bailii can break the glucose repression effect and have the ability to use both glucose and acetic acid as available carbon sources, thereby reducing the cell stress caused by acetic acid accumulation. The team of Zhang Cuiying from Tianjin University of Science and Technology first reported that eisosomes are key elements for yeast to resist acetic acid stress. The disruption of eisosomes leads to various lipid changes and lipid homeostasis imbalance, destroying the integrity of the cell membrane, thereby causing a decrease in acetic acid tolerance.

[0005] The present invention uses non - Saccharomyces cerevisiae as the starting strain and for the first time proposes that knocking out the SPAC922.07c gene significantly improves the acetic acid tolerance of Schizosaccharomyces pombe and significantly increases the fermentation efficiency under acetic acid stress. The SPAC922.07c gene encodes aldehyde dehydrogenase, and its homologous genes in Saccharomyces cerevisiae are ALD2, ALD3, ALD4, ALD5, and ALD6. The gene with relatively high homology to it is ALD2 (homology is 52.6%). There is currently no research on the relationship between aldehyde dehydrogenase and acetic acid tolerance. Therefore, the discovery of the present invention provides new materials and ideas for the construction of chassis cells with high acetic acid tolerance. Summary of the Invention

[0006] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a genetically engineered strain of Schizosaccharomyces pombe with improved acetic acid tolerance, a construction method, and its application.

[0007] The technical solution adopted by the present invention to solve its technical problems is:

[0008] A genetically engineered strain of Schizosaccharomyces pombe with improved acetic acid tolerance, which is obtained by knocking out the SPAC922.07c gene in the starting strain Schizosaccharomyces pombe, so as to achieve the purpose of improving the acetic acid tolerance of Schizosaccharomyces pombe.

[0009] Furthermore, the nucleotide sequence of the SPAC922.07c gene is as shown in SEQ ID No.1, and the amino acid sequence of the SPAC922.07c gene is as shown in SEQ ID No.2.

[0010] Furthermore, the starting strain Schizosaccharomyces pombe is Schizosaccharomyces pombe Sujiu.065, selected from Chinese Patent Publication No. CN113215007A, Application No. 202110280090.4, a highly acid - tolerant Schizosaccharomyces pombe and its application in the brewing of Maotai - flavored liquor.

[0011] Furthermore, the homologous recombination method is used to knock out the target gene, and G418 resistance is used as a screening marker to screen positive clones.

[0012] Furthermore, when the strain is cultured in a YPD100 fermentation medium with an initial sugar concentration of 100 g / L and containing 15 g / L acetic acid, the glucose is consumed completely in 106 h, which is 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate is increased by 22.08%; the engineered strain reaches the maximum ethanol production of 44.57 g / L in 106 h, which is 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate is increased by 26.44%.

[0013] The method for constructing the Schizosaccharomyces pombe genetic engineering strain as described above includes the following steps:

[0014] (1) Using the genome of the starting strain Schizosaccharomyces pombe as a template, the upstream homologous arm Up and the downstream homologous arm Low were amplified by PCR, and using the plasmid PUG6 as a template, the selection marker KanMX was amplified by PCR;

[0015] (2) The upstream homologous arm Up, the downstream homologous arm Low, and the selection marker KanMX fragments were fused together by fusion PCR as the gene SPAC922.07c knockout expression cassette;

[0016] (3) The gene SPAC922.07c knockout expression cassette was transformed into the starting strain Schizosaccharomyces pombe strain Sujiu.065 by the lithium acetate transformation method to obtain a recombinant strain.

[0017] Application of the Schizosaccharomyces pombe genetic engineering strain as described above in improving the glucose consumption rate and ethanol production rate under acetic acid stress.

[0018] The advantages and positive effects obtained by the present invention are as follows:

[0019] 1. Compared with the starting strain, the recombinant Schizosaccharomyces pombe SPAC922.07cΔ provided by the present invention has a significantly improved tolerance to acetic acid, shortens the growth lag phase, and improves the fermentation efficiency of the strain under acetic acid stress conditions, can effectively improve the acetic acid tolerance performance of the strain, and can improve the glucose consumption rate and ethanol production rate of the strain under acetic acid stress.

[0020] 2. Using the Schizosaccharomyces pombe Sujiu.065 with excellent acetic acid tolerance performance as the starting strain, the acetic acid tolerance of the strain was further improved by knocking out the gene SPAC922.07c. The experimental results of the YPD100 fermentation medium found that under the stress of 15 g / L acetic acid, the engineered strain SPAC922.07cΔ consumed all the glucose in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate increased by 22.08%; the engineered strain reached the maximum ethanol yield of 44.57 g / L in 106 h, which was 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate increased by 26.44%.

[0021] 3. The present invention modifies Schizosaccharomyces pombe by genetic engineering means to construct an engineered strain SPAC922.07cΔ with the SPAC922.07c gene knocked out. The acetic acid tolerance performance of SPAC922.07cΔ was evaluated through semi - quantitative spot - inoculation experiments, growth curve determination, and fermentation experiments. The present invention first proposes that knocking out the SPAC922.07c gene significantly shortens the growth lag phase of Schizosaccharomyces pombe, improves the acetic acid tolerance performance, and effectively increases the glucose consumption rate and ethanol production rate of Schizosaccharomyces pombe under acetic acid stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a schematic diagram of the construction process of the knockout strain SPAC922.07cΔ in the present invention;

[0023] Figure 2 It is a PCR verification diagram of the positive transformant in the present invention. Among them, M, 1 - 4 are Marker, the amplified band (1268 bp) with the genomic DNA of SPAC922.07cΔ as the template and T1 - F / T1 - R as primers, the amplified band (1648 bp) with the genomic DNA of SPAC922.07cΔ as the template and T2 - F / T2 - R as primers, no amplified band with the genomic DNA of the starting strain Sujiu.065 as the template and T1 - F / T1 - R as primers, and no amplified band with the genomic DNA of the starting strain Sujiu.065 as the template and T2 - F / T2 - R as primers;

[0024] Figure 3 It is a growth curve diagram of the starting strain Sujiu.065 under different acetic acid stresses in the present invention;

[0025] Figure 4 It is a growth state diagram of the knockout strain SPAC922.07cA and the starting strain Sujiu.065 in a liquid medium without stress (fully automatic microbial growth curve analyzer) in the present invention;

[0026] Figure 5 It is a growth state diagram of the knockout strain SPAC922.07cA and the starting strain Sujiu.065 in a liquid medium supplemented with 15 g / L acetic acid (fully automatic microbial growth curve analyzer) in the present invention:

[0027] Figure 6 It is a growth state diagram of the knockout strain SPAC922.07cΔ and the starting strain Sujiu.065 in a liquid medium without stress (100 mL shake - flask scale) in the present invention;

[0028] Figure 7Growth status diagrams of the knockout strain SPAC922.07cΔ and the parental strain Sujiu.065 in a liquid medium supplemented with 15 g / L acetic acid (100 mL shake flask scale) in the present invention;

[0029] Figure 8 Growth status diagrams of the knockout strain SPAC922.07cΔ and the parental strain Sujiu.065 in a solid medium in the present invention; among them, (a) is the growth status diagram of the knockout strain SPAC922.07cΔ and the parental strain Sujiu.065 in a non-stress solid medium, and (b) is the growth status diagram of the knockout strain SPAC922.07cΔ and the parental strain Sujiu.065 in a solid medium supplemented with 15 g / L acetic acid;

[0030] Figure 9 Diagrams of glucose consumption and ethanol production of the knockout strain SPAC922.07cΔ and the parental strain Sujiu.065 in a non-stress state in the present invention;

[0031] Figure 10 Diagrams of glucose consumption and ethanol production of the knockout strain SPAC922.07cΔ and the parental strain Sujiu.065 in a state supplemented with 15 g / L acetic acid in the present invention. Detailed implementation manners

[0032] The present invention will be further described below in conjunction with embodiments. The following embodiments are narrative and not restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0033] All kinds of experimental operations involved in the specific embodiments are conventional techniques in the art. For parts not specifically noted in this article, those of ordinary skill in the art can refer to various commonly used reference books, scientific and technological literatures, or relevant specifications, manuals, etc. before the filing date of the present invention for implementation.

[0034] A Schizosaccharomyces pombe genetic engineering strain with improved acetic acid tolerance. The engineering strain is obtained by knocking out the gene SPAC922.07c in the parental strain Schizosaccharomyces pombe to achieve the purpose of improving the acetic acid tolerance of Schizosaccharomyces pombe.

[0035] Preferably, the nucleotide sequence of the SPAC922.07c gene is as shown in SEQ ID No.1, and the amino acid sequence of the SPAC922.07c gene is as shown in SEQ ID No.2.

[0036] Preferably, the starting strain Schizosaccharomyces pombe is Schizosaccharomyces pombe Sujiu.065, which is selected from Chinese Patent CN113215007A, a highly acid-tolerant Schizosaccharomyces pombe and its application in the brewing of Maotai-flavor liquor.

[0037] Preferably, the homologous recombination method is used to knock out the target gene, and G418 resistance is used as a screening marker to screen positive clones.

[0038] Preferably, the strain is cultured in a YPD100 fermentation medium with an initial sugar concentration of 100 g / L and containing 15 g / L acetic acid. The glucose is consumed completely in 106 h, which is 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate is increased by 22.08%. The engineered strain reaches the maximum ethanol yield of 44.57 g / L in 106 h, which is 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate is increased by 26.44%.

[0039] The method for constructing the Schizosaccharomyces pombe genetic engineering strain as described above includes the following steps:

[0040] (1) Using the genome of the starting strain Schizosaccharomyces pombe as a template, the upstream homologous arm Up and the downstream homologous arm Low are amplified by PCR, and using the plasmid PUG6 as a template, the screening marker KanMX is amplified by PCR.

[0041] (2) The upstream homologous arm Up, the downstream homologous arm Low, and the screening marker KanMX fragments are fused together by fusion PCR to serve as the gene SPAC922.07c knockout expression cassette.

[0042] (3) The gene SPAC922.07c knockout expression cassette is transformed into the starting strain Schizosaccharomyces pombe strain Sujiu.065 by the lithium acetate transformation method to obtain a recombinant strain.

[0043] The application of the Schizosaccharomyces pombe genetic engineering strain as described above in improving the glucose consumption rate and ethanol production rate under acetic acid stress.

[0044] Specifically, the related preparation and detection are as follows:

[0045] An engineered strain (SPAC922.07cΔ) with improved acetic acid tolerance performance was obtained through the following methods. Using the acetic acid-tolerant Schizosaccharomyces pombe Sujiu.065 previously screened from a high-acid environment as the starting strain, the gene SPAC922.07c knockout expression cassette was introduced through the lithium acetate chemical transformation method to complete the construction of the knockout strain. The nucleotide sequence of the said SPAC922.07c is shown as SEQ ID No.1. For the said nucleotide sequence, the amino acid sequence encoded by it is shown in SEQ ID No.2. The method for constructing the gene SPAC922.07c knockout expression cassette is to design primers using the genome of the Schizosaccharomyces pombe model strain 927h- as a template, PCR amplify the upstream homologous arm Up and the downstream homologous arm Low, and use the plasmid PUG6 as a template to PCR amplify the selection marker KanMX; fuse the upstream homologous arm Up, the downstream homologous arm Low, and the selection marker KanMX fragments together through fusion PCR as the gene SPAC922.07c knockout expression cassette. The said integrated knockout expression cassette is based on the principle of homologous recombination, using KanMX as the selection marker, and introducing the fusion fragment into the starting strain Sujiu.065 through the lithium acetate chemical transformation method.

[0046] Example 1: Construction of strain SPAC922.07cΔ

[0047] The starting strain Schizosaccharomyces pombe used in this example is Schizosaccharomyces pombe Sujiu.065, selected from Chinese Patent CN113215007A, a highly acetic acid-tolerant Schizosaccharomyces pombe and its application in the brewing of Maotai-flavor Baijiu. The said YPD medium is a common complete medium, and the solid medium contains 2% imported agar powder by mass percentage.

[0048] According to the genomic data of the Schizosaccharomyces pombe model strain 927h- and the integrated plasmid sequence in Genebank, the following primers were designed.

[0049] Table 1 Primers used in this example

[0050] Primers were designed using the genome of the Schizosaccharomyces pombe model strain 927h- as a template. Using Up-F / Up-R and Low-F / Low-R as primers respectively, the upstream homologous arm and the downstream homologous arm were amplified using the KOD OneTM PCR Master Mix enzyme. PCR reaction conditions: 95°C for 3 min; 98°C for 10 s, 55°C for 5 s, 68°C for 10 s, 30 cycles; 68°C for 3 min.

[0051] Using the commercial plasmid PUG6 as a template and KanMX-F / KanMX-R as primers, the selection marker KanMX was amplified using KOD OneTM PCR Master Mix (Beijing Bailingke Biotechnology Co., Ltd., product number: KMM-201S). The PCR reaction conditions were: 95°C for 3 min; 98°C for 10 s, 55°C for 5 s, 68°C for 10 s, 30 cycles, and 68°C for 3 min.

[0052] After mixing the upstream and downstream homologous arms and the selection marker KanMX fragment, Up-F and Low-R were used as PCR primers, and KOD OneTM PCR Master Mix was used to fuse these three fragments together. The fusion PCR reaction conditions were: 95°C for 3 min; 98°C for 10 s, 55°C for 5 s, 68°C for 20 s, 30 cycles, and 68°C for 3 min.

[0053] Table 2 PCR amplification system of KOD OneTM PCR Master Mix enzyme used in this example

[0054]

[0055] Based on the principle of homologous recombination, the fusion fragment was introduced into the starting strain by the lithium acetate chemical transformation method ( Figure 1 ).

[0056] The specific method is as follows: (1) After the starting strain is cultured on a shaker at 30 °C and 250 r / min for 24 h, the next day it is transferred to a fresh YPD medium at an inoculation ratio of 10% and continued to be cultured at 30 °C and 250 r / min until the mid-log phase; (2) Take 10 mL of the bacterial solution and centrifuge it at 5000 r / min and 4 °C for 2 min to remove the medium and collect the bacterial cells; (3) Wash the bacterial cells twice with pre-cooled sterile double-distilled water; (4) Wash once with 1×TE / LiAc working solution and collect the bacterial cells; (5) Re-add an appropriate amount of 1×TE / LiAc working solution (prepared by mixing 10×TE solution, 10×LiAc solution and sterile distilled water in a volume ratio of 1:1:8). Resuspend the bacterial cells and incubate them on a shaker at 100 r / min and 30 °C for 1 h; (6) After the incubation is completed, centrifuge again at 5000 r / min and 4 °C for 2 min to collect the bacterial cells. After adding 100 μL of 1×TE / LiAc working solution to resuspend the bacterial cells, add 5 μL of salmon sperm single-stranded ssDNA pre-denatured at high temperature (95 °C - 100 °C) (Beijing Ruier Xinde Technology Co., Ltd., product number: D1626, concentration: 100 mg / mL) and 34 μL of the DNA fragment for transformation. After pipetting and mixing evenly, incubate in a water bath at 30 °C for 30 min; (7) Add 700 μL of 1×TE / LiAc-PEG working solution (prepared by mixing 10×TE solution, 10×LiAc solution and 50% PEG3350 solution in a volume ratio of 1:1:8), pipette and mix evenly with a pipette, and continue to incubate in a water bath at 30 °C for 1 h; (8) After the incubation at 30 °C is completed, transfer it to a water bath at 42 °C and heat shock for 15 min; (9) Naturally cool to room temperature, centrifuge at 5000 r / min and 4 °C for 2 min, remove the supernatant, add 1 mL of fresh YPD medium, and repair and culture at 100 r / min and 30 °C for 3 h; (10) After centrifuging to collect the bacterial cells, wash them with sterile double-distilled water, take an appropriate amount of the bacterial solution and spread it on a YPD medium containing 150 μg / L of Kanamycin, and statically culture at 30 °C for 72 h; (11) Pick the transformants, transfer and culture them, extract the genome, and perform site-directed PCR verification using the verification primers. Use T1-F / T1-R and T2-F / T2-R as the verification primers to obtain positive transformants. The lengths of the PCR products are 1268 bp and 1648 bp ( Figure 2 , lanes 1-2), and the starting strain has no corresponding bands ( Figure 2 , lanes 3-4). The strain with correct verification is named SPAC922.07cΔ.

[0057] Example 2: Evaluation of the acetic acid tolerance of the knockout strain - growth in liquid medium (microplate scale)

[0058] When selecting the acetic acid stress concentration, a preliminary experiment was conducted with the starting strain Sujiu.065. After the starting strain Sujiu.065 was cultured in a shaker at 30 °C and 250 r / min for 24 h, it was inoculated into YPD liquid medium containing 0 g / L, 5 g / L, 10 g / L, 15 g / L, and 20 g / L acetic acid at an inoculation ratio of 5%, and the initial OD 600 differences among the strains and different treatments were not greater than 0.05. The growth status of each strain was monitored using a fully automatic microbial growth curve analyzer, and the culture conditions were 30 °C and 800 r / min, and data were recorded every 2 hours.

[0059] As Figure 3 shown, it can be seen that 5 g / L and 10 g / L of acetic acid hardly posed stress to the strains, while 20 g / L of acetic acid had too much stress on the strains, resulting in an overly long lag phase and affecting the progress of the experiment. Considering comprehensively, selecting 15 g / L of acetic acid was the best choice for the evaluation experiment.

[0060] After the strain SPAC922.07cΔ and the starting strain Sujiu.065 were cultured in a shaker at 30 °C and 250 r / min for 24 h, they were inoculated into YPD liquid medium containing 15 g / L acetic acid and no added acid at an inoculation ratio of 5%, and the initial OD 600 differences among the strains and different treatments were not greater than 0.05. The growth status of each strain was monitored using a fully automatic microbial growth curve analyzer, and the culture conditions were 30 °C and 800 r / min, and data were recorded every 2 hours.

[0061] As Figure 4 and Figure 5 shown, the growth of the two strains was almost indistinguishable under non-stress conditions. The starting strain Sujiu.065 was slightly better than the engineered strain SPAC922.07cΔ, and both entered the stationary phase at 36 h, indicating that knocking out the SPAC922.07c gene did not affect the growth of the strains under non-stress conditions. Under 15 g / L acetic acid stress, the engineered strain SPAC922.07cΔ entered the logarithmic phase at 48 h, and the starting strain Sujiu.065 entered the logarithmic phase at 62 h. Compared with the starting strain, the lag phase of the engineered strain was shortened by 14 h, further proving that the knockout of the gene SPAC922.07c could significantly improve the acetic acid tolerance of Schizosaccharomyces pombe, which was beneficial to the growth of Schizosaccharomyces pombe under high-concentration acetic acid conditions and thus also beneficial to preventing the growth of other miscellaneous bacteria.

[0062] Example 3: Evaluation of the acetic acid tolerance of the knockout strain - growth in liquid medium (100 mL shake flask scale)

[0063] After the strain SPAC922.07cΔ and the parental strain Sujiu.065 were cultured in a shaker at 30 °C and 250 r / min for 24 h, they were inoculated into YPD liquid medium containing 15 g / L acetic acid and no added acid at an inoculation ratio of 5%, and the difference in the initial OD600 among the strains and different treatments was adjusted to be no greater than 0.05. They were continuously cultured in a shaker at 30 °C and 250 r / min, and the OD was measured using a UV-visible spectrophotometer. 600 to monitor the growth status of each strain.

[0064] As Figure 6 and Figure 7 shown, there was no difference in the growth of the two strains under non-stress conditions, and they both entered the stationary phase at 42 h, indicating that the knockout of the SPAC922.07c gene had no effect on the basic growth performance of the strains. Under 15 g / L acetic acid stress, the engineered strain SPAC922.07cΔ entered the logarithmic phase at 55 h, and the parental strain Sujiu.065 entered the logarithmic phase at 70 h. Compared with the parental strain, the lag phase of the engineered strain was shortened by 15 h. This further proved that the knockout of the gene SPAC922.07c could significantly improve the acetic acid tolerance of Schizosaccharomyces pombe, which was beneficial to the growth of Schizosaccharomyces pombe under high-concentration acetic acid conditions, and thus also beneficial to preventing the growth of other miscellaneous bacteria.

[0065] Example 4: Evaluation of the acetic acid tolerance of the knockout strain - semi-quantitative dot blot experiment

[0066] The acetic acid tolerance of the strain SPAC922.07cΔ was evaluated by a semi-quantitative dot blot experiment, and the parental strain Sujiu.065 was used as a control strain. After the strain SPAC922.07cΔ and the parental strain were cultured in a shaker at 30 °C and 250 r / min for 24 h, they were transferred to fresh YPD liquid medium at an inoculation ratio of 10% and continuously cultured in a shaker at 30 °C and 250 r / min. After culturing to the mid-logarithmic phase, the cells were collected by centrifugation and washed twice with sterile double-distilled water. The cells were resuspended in sterile double-distilled water again, and according to the results measured by the UV-visible spectrophotometer, the OD 600 of the cell suspension was adjusted to 1. Using the serial dilution method, the cell suspension was successively diluted to 10 -1 , 10 -2 , 10 -3 . 3 μL of each gradient sample was taken and inoculated on YPD solid medium with an acetic acid concentration of 15 g / L and no added acid. They were cultured in a constant temperature incubator at 30 °C for 2 - 3 d, and the growth of the strains was observed and photographed.

[0067] As Figure 8As shown, under the culture conditions without the addition of acid, the growth status of SPAC922.07cΔ was the same as that of the starting strain Sujiu.065, indicating that the knockout of gene SPAC922.07c had no effect on the basic growth performance of the strain. Under the stress of 15 g / L acetic acid, the strain SPAC922.07cΔ showed obvious growth advantages, suggesting that the knockout of gene SPAC922.07c could significantly improve the tolerance of Schizosaccharomyces pombe to acetic acid.

[0068] Example 5: Analysis of the fermentation performance of the knockout strain

[0069] YPD medium was used as the seed medium, containing 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose.

[0070] YPD100 medium was used as the fermentation medium, containing 4 g / L yeast extract, 3 g / L peptone, and 100 g / L glucose. Meanwhile, acetic acid with a final concentration of 15 g / L was added as the acid stress medium.

[0071] Fermentation method:

[0072] The strains SPAC922.07cΔ and the starting strain Sujiu.065 were cultured in a shaker at 30 °C and 250 r / min for 24 h, then transferred to fresh YPD liquid medium at an inoculation ratio of 10%, and continued to be cultured in a shaker at 30 °C and 250 r / min; after culturing to the mid-logarithmic phase, the cells were collected by centrifugation and washed twice with sterile double-distilled water; the cells were resuspended in sterile double-distilled water again, and according to the results measured by the ultraviolet-visible spectrophotometer, the OD of the cell suspension was 600 adjusted to 0.5; added to the fermentation medium without stress and containing 15 g / L acetic acid, and samples were taken at regular intervals for the determination of the remaining amount of glucose and the amount of ethanol produced in the fermentation broth. Detection of glucose and ethanol content:

[0073] The remaining amount of glucose and the amount of ethanol produced were detected by a high-performance liquid chromatograph. The detector was a differential refractometer, and the chromatographic column was Rezex TM RFQ-Fast ACID H + (8%), LC Column 100×7.8 mm, the mobile phase was 5 mmol / L sulfuric acid with a flow rate of 0.6 mL / min, the column temperature was 55 °C, and the detector temperature was 35 °C.

[0074] As Figure 9 and Figure 10As shown, under non-stress conditions, there is no difference in the fermentation rate and ethanol yield between the two strains. The fermentation ends at 37 h, and the ethanol yield is 40.86 g / L, indicating again that knocking out the SPAC922.07c gene has no effect on the fermentation performance of the strain. Under 15 g / L acetic acid stress, the engineered strain SPAC922.07cΔ consumed all the glucose in 106 h, 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate increased by 22.08%. The engineered strain reached the maximum ethanol yield of 44.57 g / L at 106 h, 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate increased by 26.44%. This shows that knocking out the SPAC922.07c gene is beneficial to improving the glucose consumption rate and ethanol production rate of the strain, further proving that knocking out the gene SPAC922.07c can significantly improve the tolerance of Schizosaccharomyces pombe to acetic acid.

[0075] The present invention uses non-Saccharomyces cerevisiae as the starting strain and for the first time proposes that knocking out the SPAC922.07c gene significantly improves the tolerance of Schizosaccharomyces pombe to acetic acid. Compared with the starting strain Sujiu.065, the engineered strain SPAC922.07cΔ shortens the lag phase by 14 - 15 h under 15 g / L acetic acid conditions and significantly increases the biomass, which is beneficial to the growth of Schizosaccharomyces pombe under high-concentration acetic acid conditions and prevents the generation of other miscellaneous bacteria. Moreover, the glucose consumption rate increases by 22.08% and the ethanol production rate increases by 26.44%, indicating that the fermentation efficiency of Schizosaccharomyces pombe under acetic acid stress is significantly improved.

[0076] 1. Nucleotide sequence of the SPAC922.07c gene (Unknown)

[0077]

[0078] 2. Amino acid sequence of the SPAC922.07c gene

[0079] Met Ser Glu Asp Leu Phe Val Ser Ile Asn Phe Pro Asn Gly Arg Ser Val Lys Gln Pro Ile Gly Leu Tyr Ile Asn Gly Glu Trp His Lys Ser Ala Glu Thr Trp Glu Thr Val Asp Pro Ser Thr Glu Glu Val Ile Ala Lys Val Tyr Leu Ala Gly Glu Lys Glu Ile Asp Tyr Ala Val Lys Ser Ala Lys Glu Ala Phe Lys Thr Trp Lys Lys Val Pro Gly Ser Glu Lys Gly Glu Leu Leu Met Lys Leu Ala Glu Leu Thr Glu Lys His Ala Asp Thr Leu Ala Ala Ile Glu Ala Met Asp Ser Gly Lys Pro Leu Val Ser Asn Ala Arg Gly Asp Val Asp Gly Thr Ile Ala Leu Leu Arg Tyr Cys Ala Gly Trp Ala Asp Lys Ile Tyr Gly Gln Val Ile Pro Thr Gly Pro Glu Lys Leu Ala Tyr Ala Lys Arg Thr Pro Ile Gly Val Cys Gly Gln Ile Val Pro Trp Asn Tyr Pro Leu Asn Met Ala Gly Trp Lys Ile Ala Pro Ala Leu Ala Ala Gly Asn Cys Ile Ile Ile Lys Ser Ala Glu Thr Thr Pro Leu Ser Leu Leu Tyr Phe Ala Thr Leu Val Glu Glu Ala Gly Phe Pro Lys Gly Val Val Asn Ile Ile Ser Gly Leu Gly Thr Val Ala Gly Ser Tyr Met Ala Lys His Pro Gly Ile Asp Lys Ile Ala Phe Thr Gly Ser Thr Lys Val Gly Val Ile Val Gln Gln Leu AlaAla Ser Asn Leu Lys Ala Val Thr Leu Glu CysGly Gly Lys Ser Pro Phe Leu Val Phe Glu Asp Ala Asp Leu Asp Gln Ala Val LysTrp Ala Ala Leu Gly Ile Met Tyr Asn Ser Gly Gln Ile Cys Thr Ser Asn Ser ArgIle Tyr Val Gln Asp Ser Val Tyr Asp Lys Phe Ile Glu Leu Phe Lys Lys His ValIle Gln Asp Tyr Ile Val Gly Met Pro Phe Asp Asp Asn Thr Val Val Gly Pro ValVal Asn Lys Thr Gln Tyr Asn Arg Ile Lys Asn Tyr Ile Glu Gln Gly Lys Lys GluGly Ala Lys Leu Val Leu Gly Asp Glu Pro Leu Pro Leu Lys Gln Gly Tyr Phe IleSer Pro Thr Ile Phe Ala Asp Cys Ser Glu Asn Met Thr Ile Val Lys Glu Glu IlePhe Gly Pro Val Val Ala Ile Ser Lys Phe Lys Thr Glu Asp Glu Ala Ile Glu LysAla Asn Asn Thr Thr Tyr Gly Leu Ala Ala Met Cys Phe Thr Lys Asp Leu Glu ArgAla His Arg Val Ser Asp Glu Leu Glu Ala Gly Met Val Phe Ile Asn Ser Thr GluAsn Ser Asp Ile Gln Ala Pro Phe Gly Gly Ile Lys Met Ser Gly Ile Gly Asn GluLeu Gly Ser Asn Gly Ile Glu Met Tyr Thr Gln Ile Lys Ala Val His Ile Asn PheAsn Asn Lys Leu *

[0080] 3. The nucleotide sequence of the upstream homologous arm

[0081] gaagcgaacatcgtaagcacaagtttatttttaagtttgaatacctctctatttcgaattatagtagtgcccataaccaatgtttaaactcgaatctaataatggtttacattcactcttgcaactttacacaaacgttacaagtataattttaatcaagtttgggataattgttattttaaaacaattctaaagaattagtaataataaagtaacattttctttgaatttcttatctggttactaggacagttaatatgtcgtgtaacttgatcatgatgatatactcgtgagcagctataagatttttatcgtatgtccgtgcaatttcgccaataacacttcgctagcttagatggtttaaaaattagctcaaagatagataataataagtacatatttattaagtagatggttgttaagttttcttctcaatattcccaaattgtcaatctttcagaataagtttagaatttcagcccaatgtcagaagatttatttgtctccattaatttccctaacggaagatctgtcaaacaac

[0082] 4. The nucleotide sequence of the downstream homologous arm

[0083] gggctccaacggtattgagatgtatacacaaattaaagctgttcatattaattttaataacaaactttgaaagggctcctttctgaaatttttccttggctgctattaaattttttatttaattaagagtgttactcattaccttgtgcgctcattgtcttcatactcaaagttggtagctgtttgggcagtaaaaaatttgcagaataaacaagaacgtgaactgtcttacctggctagcaaatggattactgtaaaacaatagtccatgatccgttccgccgttttaccagtgtacctcaagtcagattgaagtttatctataattatcgctccgtttatgaaaaatataataattgtaattttataaatattcaattatctaattataaatgacaatgccacgatttccaccaatttaatattgaagcatacatataaaccaagtttattaatttaatacttaagttttatcgagaaagtgcttatacaatattattgaattaaatttaagagattatattttccatatagttcaatagtaggctcagctacagtatatttaaaaaagtactcttgaaaagtatatttatcgccttaaatccatgaattgatgtctatgccatcg

[0084] 5. Nucleotide sequence of plasmid PUG6

[0085]

[0086] 6. Nucleotide sequence of the KanMX fragment

[0087]

[0088] Although embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes, and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the content disclosed in the embodiments.

Claims

1. A Schizosaccharomyces pombe genetic engineering strain with improved acetic acid tolerance, characterized in that: The engineered strain is obtained by knocking out the SPAC922.07c gene in the starting strain Schizosaccharomyces pombe to improve the acetic acid tolerance of Schizosaccharomyces pombe; The nucleotide sequence of the SPAC922.07c gene is shown in SEQ ID No.1, and the amino acid sequence of the SPAC922.07c gene is shown in SEQ ID No.2; The starting strain Schizosaccharomyces pombe is Schizosaccharomyces pombe Sujiu.065; The homologous recombination method is used to knock out the target gene, and G418 resistance is used as a screening marker to screen positive clones; When the strain is cultured in the YPD100 fermentation medium with an initial sugar concentration of 100 g / L and containing 15 g / L acetic acid, the glucose is consumed completely at 106 h, which is 24 h earlier than the starting strain Sujiu.065, and the glucose consumption rate is increased by 22.08%; The engineered strain reaches the maximum ethanol production at 106 h, which is 44.57 g / L, 24 h earlier than the starting strain Sujiu.065, and the ethanol production rate is increased by 26.44%.

2. The construction method of the Schizosaccharomyces pombe genetic engineering strain according to claim 1, characterized in that: It includes the following steps: (1) Using the genome of the starting strain Schizosaccharomyces pombe as a template, the upstream homologous arm Up and the downstream homologous arm Low are amplified by PCR, and using the plasmid PUG6 as a template, the screening marker KanMX is amplified by PCR; (2) The upstream homologous arm Up, the downstream homologous arm Low, and the screening marker KanMX fragments are fused together by fusion PCR to serve as the SPAC922.07c gene knockout expression cassette; (3) The SPAC922.07c gene knockout expression cassette is transformed into the starting strain Schizosaccharomyces pombe strain Sujiu.065 by the lithium acetate transformation method to obtain a recombinant strain.

3. The application of the Schizosaccharomyces pombe genetic engineering strain according to claim 1 in improving the glucose consumption rate and ethanol production rate under acetic acid stress.

Citation Information

Patent Citations

  • High-acid-resistant schizosaccharomyces pombe and application of schizosaccharomyces pombe in brewing of Maotai-flavor liquor

    CN113215007A

  • Method for improving acid stress resistance of lactic acid bacteria

    CN107236694A

  • Genetically altered microorganisms with modified metabolism

    WO2005087940A1