An NAD kinase mutant, immobilized enzyme and its application

Abstract

This application belongs to the field of biotechnology, and specifically relates to a NAD kinase mutant, an immobilized enzyme and their applications. This application provides a NAD kinase mutant, which can efficiently utilize polyphosphate (poly(P)) derivatives to replace coenzyme ATP as a phosphoryl group donor, improve the synthesis efficiency of NADP, reduce the ATP residue in the product, facilitate the simplification of the product separation and purification process, and reduce the industrial-scale preparation cost. This application uses resin as a carrier, and an immobilized enzyme of NAD kinase is prepared with the crude enzyme solution obtained by fermentation and culture of the engineering bacteria containing the coding gene as the active component. The immobilized NAD kinase prepared by this method can still achieve a conversion rate of more than 90% after being continuously used for 10 batches, and has good industrial application potential.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, and particularly relates to a NAD kinase mutant, an immobilized enzyme and their applications. Background Art

[0002] Nicotinamide adenine dinucleotide phosphate (NADP) is the phosphorylated form of nicotinamide adenine dinucleotide (NAD), that is, coenzyme II. It is a natural nucleotide containing a 2'-phosphoribose fragment and serves as a hydrogen carrier in the process of biological oxidation. It participates in the synthesis of lipids, nucleotides, fatty acids, etc. in the form of reduced NADPH and is an essential coenzyme in organisms.

[0003] The preparation methods of nicotinamide adenine dinucleotide phosphate (NADP) mainly include chemical synthesis and biosynthesis and other routes. Compared with chemical synthesis, the research on the synthesis of NADP by biocatalytic methods shows significant advantages: the catalytic efficiency of enzymes is much higher than that of traditional inorganic catalysts, and they can operate efficiently under mild conditions (including normal temperature, normal pressure and near-neutral pH value), which not only reduces energy consumption and equipment requirements, but also reduces the impact on the environment. In addition, compared with chemical synthesis and traditional microbial fermentation, enzyme synthesis can significantly shorten the production cycle and reduce costs, showing higher economic benefits and environmental friendliness.

[0004] The biocatalytic synthesis of NADP is mainly achieved by the action of NAD kinase, using ATP or polyphosphate (poly(P)) derivatives as phosphate donors to catalyze the phosphorylation of NAD. NAD kinases are divided into two categories. One is the ATP-NAD kinase that catalyzes the phosphorylation of NAD with ATP as the phosphoryl donor, and the other is the poly(P) / ATP-NAD kinase that catalyzes the phosphorylation of NAD with ploy(P) and ATP as the phosphoryl donors. However, using ATP as the phosphoryl donor to generate NADP has the following disadvantages: the price of ATP is high; ADP generated during the reaction and residual ATP from the reaction process have very similar ionic distributions to the product NADP, and high salt concentrations are required to effectively separate them from the desired product, which increases the difficulty of subsequent product separation. However, the productivity of NAD kinase dependent on poly(P) for producing NADP is much lower than the level required for practical applications. Summary of the Invention

[0005] To solve the above technical problems, the present application mainly provides a NAD kinase mutant. The enzyme solution of the engineered bacteria of this NAD kinase mutant can improve the productivity of NADP in the case of using polyphosphate (poly(P)) derivatives as phosphate donors, and is specifically achieved through the following technical solutions:

[0006] In the first aspect, the present application provides a NAD kinase mutant, which is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 as follows: mutating glycine at position 170 to arginine; or mutating phenylalanine at position 259 to arginine; or mutating both glycine at position 170 and phenylalanine at position 259 to arginine.

[0007] In the second aspect, the present application further provides an immobilized enzyme, which uses resin as a carrier and the enzyme solution of the engineered bacteria of the above NAD kinase mutant as an active ingredient.

[0008] In the third aspect, the present application further provides the use of the above NAD kinase mutant or immobilized enzyme in the preparation of nicotinamide adenine dinucleotide phosphate.

[0009] In the fourth aspect, the present application further provides a method for preparing nicotinamide adenine dinucleotide phosphate, which uses NAD as a substrate, the wet cells of the engineered bacteria of the above NAD kinase mutant as a catalyst, and polyphosphate poly(P) derivatives as phosphoryl donors, and reacts in a buffer solution to obtain nicotinamide adenine dinucleotide phosphate.

[0010] Preferably, the pH value of the buffer solution is 6-9.

[0011] Preferably, the reaction temperature is 30-70°C.

[0012] Preferably, a metal ion activator is further added to the reaction system, and the metal ions include one or several of manganese, cobalt, nickel, calcium, zinc, copper and manganese ions.

[0013] Preferably, the metal ion is manganese ion, and the concentration of the manganese ion is 10-200 mM.

[0014] Preferably, the molar concentration ratio of the substrate to the phosphoryl donor is 1:(0.4-1.6).

[0015] Preferably, the polyphosphate poly(P) derivatives include one or several of sodium trimetaphosphate, sodium hexametaphosphate and sodium polyphosphate, and the number of phosphorus atoms in the sodium polyphosphate is greater than 10.

[0016] Compared with the prior art, the present application has the following beneficial effects:

[0017] The present application provides a NAD kinase mutant, which can efficiently utilize polyphosphate (poly(P)) derivatives to replace coenzyme ATP as a phosphoryl group donor, improve the synthesis efficiency of NADP, reduce the ATP residue in the product, facilitate the simplification of the product separation and purification process, and reduce the industrial-scale preparation cost.

[0018] In the present application, a resin is used as a carrier, and an immobilized enzyme of NAD kinase is prepared with the crude enzyme solution obtained by fermentation and culture of an engineered bacterium containing the coding gene as an active component. The immobilized NAD kinase prepared by this method can still achieve a conversion rate of more than 90% after being continuously used for 10 batches, and has good industrial application potential. Brief Description of the Drawings

[0019] For a clear introduction of the examples, the following will briefly introduce the drawings:

[0020] Figure 1 It is a reaction schematic diagram of NAD kinase using poly(P) as a phosphoryl group donor to generate NADP;

[0021] Figure 2 It is the influence of the molar concentration ratio of substrate NAD to phosphoryl group donor poly(P) on the enzymatic reaction;

[0022] Figure 3 It is the influence of various metal ions on the enzymatic reaction;

[0023] Figure 4 It is for Mn 2+ The influence of the concentration on the enzymatic reaction;

[0024] Figure 5 It is the influence of pH on the enzymatic reaction;

[0025] Figure 6 It is the influence of temperature on the enzymatic reaction. Detailed Embodiments

[0026] The following will further describe the present application in the form of specific examples. Those of ordinary skill in the art will be able to implement the present application based on these descriptions. In addition, the embodiments of the present application involved in the following description are usually only a part of the embodiments of the present application, rather than all the embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments in the present application should fall within the scope of protection of the present application.

[0027] In the following examples, the high performance liquid chromatography detection method is as follows: After sample treatment, 1 mL of the solution is sucked with a syringe and injected into a liquid phase bottle through a 0.22 μm filter membrane for detection. Analysis is carried out at a wavelength of 261 nm using a high performance liquid chromatograph equipped with an ultraviolet detector (UltiMate DAD 3000) and a Unitary C18 chromatographic column (5 μm, 100 Å, 4.6 mm x 250 mm). The flow rate is 1 mL / min and the column temperature is 30 °C. Mobile phase A: A solution of disodium hydrogen phosphate at 50 mM is mixed with a solution of sodium dihydrogen phosphate at 50 mM to make the pH of the solution 6.8. Mobile phase B: Pure methanol.

[0028] Example 1, Construction and Screening of NAD Kinase Mutants

[0029] 1. Construction of the NAD Kinase Mutant Library

[0030] After extracting the plasmid from wild NAD kinase (the amino acid sequence shown in SEQ ID NO.1), mutant PCR is carried out. The mutant PCR system is as follows: 25 μL of 2×PCR Buffer, 1 μL of PCR dNTP, 1 μL of Phanta DNA Polymerase, 18 μL of ddH2O, 1 μL of template plasmid, and 2 μL each of the upstream primer and the downstream primer (10 ng / μL). The PCR amplification program is as follows: After pre-denaturation at 95 °C for 5 min, 30 cycles are carried out as follows: denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 4 min; finally, extension is carried out at 72 °C for another 10 min. The PCR amplification product is digested with DpnI for 2 h, and the digested product is transformed into E. coli BL21(DE3) competent cells. Recombinant bacteria containing mutations are obtained by picking monoclonal colonies.

[0031] Table 1. Design of Site-Directed Saturation Mutation Primers for NAD Kinase

[0032] Primer Name <![CDATA[Primer sequence (5 , -3 , )]]> G170-F AATCGCCGnnkAGTTTTGGATGCAACG G170-R: GCGGCGATTCAGGTTTTCGAT F259-F AATGGACGGTnnkCGCCCCATTCCG F259-R: ACCGTCCATTACTGCCATAGCTG

[0033] Note: In Table 1, N represents A / C / G / T, and K represents G / T.

[0034] 2. Induced Expression of NAD Kinase Mutant Engineering Bacteria

[0035] The strains obtained in step 1 were respectively inoculated into LB liquid medium containing kanamycin with a final concentration of 50 μg / mL, and cultured at 37 °C for 6 - 8 h. Then, they were inoculated into fresh TB liquid medium containing kanamycin with a final concentration of 50 μg / mL at an inoculum volume concentration of 2%, and cultured at 37 °C and 180 r / min for 1 - 2 h. Subsequently, IPTG with a final concentration of 0.1 mM was added to the culture solution, and after culturing at 28 °C for 12 - 14 h, centrifugation was carried out at 4 °C and 8000 r / min for 10 min to obtain the corresponding wet bacteria. The cells obtained above produced the corresponding proteins, which could be used for the preparation of protein pure enzyme solution or for the preparation of immobilized enzyme.

[0036] 3. Screening of mutant library

[0037] Using the wet bacteria of NAD kinase mutants prepared in step 2 as a catalyst, NAD as a substrate, adding poly(P) and magnesium chloride externally, and using a pH 7, 50 mM Tris-Hcl buffer as a reaction medium to constitute a 1 mL reaction system. The dosage of the catalyst was 20 g / L based on the final concentration of wet bacteria, the final concentration of the substrate was 100 mM, the final concentration of poly(P) was 50 mM, and the final concentration of manganese chloride was 100 mM. The reaction was carried out at 55 °C and 600 r / min for 5 min. 100 μL of the reaction solution was taken, 5 μL of 6 M hydrochloric acid was added to terminate the reaction, the reaction solution was diluted 100 times with ultrapure water, centrifuged at 12000 rpm for 1 min, the supernatant was taken, passed through a 0.22 μM microfiltration membrane, and the filtrate was collected as a liquid phase sample to detect the substrate conversion rate and product formation rate for screening dominant mutants. Among them, through G170 site saturation mutagenesis and screening, the strain G170R with improved activity was screened; through F259 site saturation mutagenesis and screening, the strain F259R with improved activity was screened. Then, the two mutation sites G170R and F259R were combined for mutation, and it was found that the activity was further improved. Under the condition of catalyzing 100 mM NAD, the conversion rate could reach 96.21% in 2 h.

[0038] Example 2. Purification of NAD kinase parent and mutants and their specific enzyme activities

[0039] 1. Purification of NAD kinase and mutants

[0040] The wet bacteria were suspended in a 50 mM phosphate buffer at pH 7.0 to a concentration of 100 g / L, and ultrasonically broken for 30 min under the conditions of a breaking power of 240 W, breaking for 2 s and stopping for 4 s. The whole process needed to be operated on ice. The broken solution was centrifuged at 4 °C and 12000 rpm for 10 min, and the supernatant was the crude enzyme solution. The crude enzyme solution was purified using a Ni affinity column (40 × 12.6 mm, Bio-Rad, USA) connected to a protein purification instrument to obtain a pure enzyme solution. The steps were as follows:

[0041] Equilibrium baseline: First, rinse the Ni affinity column with ultrapure water for 5 - 10 column volumes at a flow rate of 2 mL / min; then rinse with the equilibration solution for 5 - 10 column volumes at a flow rate of 2 mL / min until the UV baseline is balanced. The equilibration solution: 50 mM sodium dihydrogen phosphate, 0.3 M sodium chloride, pH 7.0, dissolved with ultrapure water.

[0042] Sample loading: Load the crude enzyme solution prepared in step 1, with a sample loading volume of 10 mL and a flow rate of 2 mL / min.

[0043] Elute impurity proteins: After sample loading, rinse with the rinsing solution for 5 - 10 column volumes at a flow rate of 2 mL / min to flush the UV baseline flat. At this time, the impurity proteins and the unbound target protein are removed; the rinsing solution: 0.05 M sodium dihydrogen phosphate, 50 mM imidazole, pH 7.0, dissolved with ultrapure water.

[0044] Elute target protein: Rinse the Ni affinity column with the elution solution in step

[0045] Elute the target protein from the Ni affinity column for 10 column volumes at a flow rate of 1.0 mL / min. Start collecting the target protein eluate when the absorbance reaches 0.3 and starts to rise, and stop collecting when the absorbance drops to 0.3. The collection process is carried out on ice; the elution solution: 50 mM sodium dihydrogen phosphate, 30 mM sodium chloride, 30 mM imidazole, pH 7.0, dissolved with ultrapure water.

[0046] Equilibrium baseline: After collecting the eluate in step (4), continue to rinse the Ni affinity column with the equilibration solution, and adjust the flow rate to 3.0 mL / min until the baseline is flushed flat.

[0047] Preserve the nickel column: Rinse with 20% ethanol. After the baseline is stable, remove the column and store it in a 4°C refrigerator

[0048] Dialyze the target protein: Load the target protein eluate collected in step (4) into a dialysis bag, place it in a phosphate buffer solution with pH 7 and dialyze on ice. Replace the dialysis buffer every 6 h. Take the retentate to obtain the purified enzyme solution and place it on ice for use.

[0049] The protein concentration of the pure enzyme solution is measured using a BCA protein assay kit (Nanjing KeyGen Biotech Co., Ltd.), and the results are shown in Table 2.

[0050] Table 2. Protein concentrations of the pure enzyme solutions of NAD kinase parent and its mutants

[0051] Enzyme Protein Concentration WT 0.3(ug / uL) M1 (G170R) 0.23(ug / uL) M2 (F259R) 0.4(ug / uL) M3 (G170R / F259R) 0.28(ug / uL)

[0052] Note: WT is the parent.

[0053] 2. Specific enzyme activity of NAD kinase and mutants

[0054] The definition of enzyme activity unit (U) is as follows: Under the conditions of 35 °C and pH 7, the amount of enzyme that generates 1 μmol of NADP per minute is defined as one enzyme activity unit, U. The specific enzyme activity is defined as the number of activity units per milligram of enzyme protein, U / mg. Standard conditions for enzyme activity detection: Take the pure enzyme of the NAD kinase parent strain and its mutants with a protein content of 0.22 mg prepared by the above method, add NAD with a final concentration of 100 mM and sodium hexametaphosphate with a final concentration of 50 mM to form a 1 mL reaction system; React at 55 °C, pH 7, and 600 r / min for 5 min, and perform high-performance liquid chromatography detection. The results are shown in Table 3.

[0055] Table 3. Specific enzyme activities of the NAD kinase parent strain and its mutants

[0056] Enzyme Relative Enzyme Activity (%) WT 100 M1(G170R) 870±10.2 M2(F259R) 910±9.3 M3(G170R-F259R) 1276±13.1

[0057] Note: WT is the parent strain. Under standard conditions, the initial enzyme activity of each NAD kinase parent strain is designated as 100%.

[0058] Example 3. Effect of the molar concentration ratio of substrate NAD to sodium hexametaphosphate on the enzymatic reaction

[0059] The dosage and concentration of substrate NAD and the phosphoryl donor sodium hexametaphosphate directly affect the catalytic reaction rate of the entire system. Insufficient addition of the phosphoryl donor will hinder the conversion rate of this reaction, while excessive addition may inhibit the reaction and increase production costs. In this example, a 10 mL reaction system was constituted with a phosphate buffer solution at pH 7 as the reaction medium. The dosage of the catalyst was the wet cells of the NAD kinase mutant M3 at 20 g / L, the NAD concentration was 100 mM, the magnesium chloride concentration was 100 mM, the reaction temperature was 35 °C, and the rotation speed was 600 r / min. The molar concentration ratios of the reaction substrate NAD to the phosphoryl donor sodium hexametaphosphate were 1:0.4, 1:0.6, 1:0.8, 1:1, 1:1.2, 1:1.4, and 1:1.6 respectively. After reacting for 2 h, samples were taken to measure the conversion rate of NAD kinase. For details, please refer to Figure 2 . Figure 2 The data results show that as the molar ratio of the reaction substrate NAD to the phosphoryl donor sodium hexametaphosphate increases, the reaction conversion rate shows a trend of first increasing and then decreasing, and the optimal conversion situation is reached when the molar ratio of NAD to sodium hexametaphosphate is 1:1.2.

[0060] Example 4. Effect of different metal ions on the enzymatic reaction

[0061] This example is to illustrate the effect of metal ion types on the production of NADP by the enzyme. The same concentration of metal ions (Mn 2+ , Co 2+ , Ni2+ , Ca 2+ , Zn 2+ , Cu 2+ and Mg 2+ ) To investigate the influence of metal ion species on the enzymatic reaction, the relative enzyme activity was used to determine the influence of metal ion species. Specifically, the reaction was carried out in a 10 mL reaction system with a phosphate buffer solution at pH 7 as the reaction medium. The dosage of the catalyst was the wet cells of mutant M3 at 20 g / L, the NAD concentration was 100 mM, and the concentration of sodium hexametaphosphate was 120 mM. The reaction time was 5 min. Please refer to the attached Figure 3 data. It can be found that the above-mentioned metal ions can all enhance the activity of NAD kinase. Among them, Mn 2+ showed the highest relative enzyme activity approaching 100%, Mg 2+ showed a relative enzyme activity approaching 90%, Ca 2+ showed a relative enzyme activity approaching 80%, Co 2+ , Ni 2+ and Zn 2+ had a relative enzyme activity between 40% and 60%, and Cu 2+ had the lowest relative enzyme activity of about 20%.

[0062] Example 5. Influence of the concentration of Mn 2+ on the enzymatic reaction

[0063] This example was to illustrate the influence of the concentration of Mn 2+ on the enzymatic production of NADP. Different concentrations of metal ions (10 mM, 50 mM, 100 mM, 150 mM, and 200 mM) were added to the enzymatic system of NAD kinase. The reaction was carried out in a 10 mL reaction system with a phosphate buffer solution at pH 7 as the reaction medium. The dosage of the catalyst was the wet cells of mutant M3 at 20 g / L, the NAD concentration was 100 mM, and the concentration of sodium hexametaphosphate was 120 mM. After 2 h of reaction, the attached Figure 4 was obtained. Referring to the attached Figure 4 data results, it can be found that with the continuous increase of the metal ion concentration, the reaction conversion rate showed a trend of first increasing and then decreasing. When the concentration of Mn 2+ was 100 mM, the optimal conversion could be achieved.

[0064] Example 6. Influence of pH on the enzymatic reaction

[0065] This example was to illustrate the influence of different reaction pH values on the enzymatic production of NADP. Under the same other conditions of the enzymatic reaction, the reaction pH values of 6, 6.5, 7, 7.5, 8, 8.5, and 9 were investigated respectively. After 5 min of reaction, samples were taken and subjected to liquid phase detection to obtain the attached Figure 5, The experimental results show that when the reaction pH is 7 and it is Tris-HCl buffer, the relative enzyme activity is the highest, approaching 100%.

[0066] Example 7, Influence of Temperature on Enzymatic Reaction

[0067] This example is to illustrate the influence of different reaction temperatures on the production of NADP in the enzymatic reaction. Under the condition that other conditions of the enzymatic reaction are the same, the reaction temperatures are respectively 30, 35, 40, 45, 50, 55, 60, and 65 degrees Celsius. After reacting for 5 minutes, samples are taken and subjected to liquid phase detection, and the attached Figure 6 , Refer to the attached Figure 6 It can be found that as the temperature increases, the relative enzyme activity shows a trend of first increasing and then decreasing. When the reaction temperature is 55 °C, the relative enzyme activity is the highest, approaching 100%.

[0068] Example 8, Preparation of NADP

[0069] Please refer to the attached Figure 1 For the preparation mechanism, this reaction uses Tris-HCl buffer with a pH of 7 as the reaction medium to form a 10 mL reaction system. The dosage of the catalyst is 20 g / L of the mutant M3 wet cells. Add NAD with a concentration of 100 mM, sodium hexametaphosphate with a concentration of 120 mM, and react at a temperature of 55 °C and a rotation speed of 600 r / min for 1 h. The conversion rate in the system reaches 96.5%, and the yield of NADP reaches 95.53%.

[0070] Example 9, Transformation of 250 mM NAD by NAD Kinase Mutant

[0071] In a 3 L ordinary stirring reaction kettle, add 331.72 g of NAD powder, add sodium hexametaphosphate with a final concentration of 300 mM and manganese chloride with a concentration of 100 mM. Adjust the pH to 7 with sodium hydroxide, add 20 g / L of the NAD kinase mutant M3 wet cells, and then make up the reaction system to 2000 mL with Tris-HCl buffer with a pH of 7. React at a temperature of 55 °C and 150 rpm. The reaction solution is subjected to liquid phase detection. After reacting for 10 h, the conversion rate is 95.3%.

[0072] Example 10, Pretreatment of Immobilized Carrier Resin Material

[0073] 1. Pretreatment steps: Epoxy resin: Take an appropriate amount of epoxy resin and add it to a 50 mL beaker. Then add 50 mM Tris-hcl buffer solution and stir for 2 h. After that, rinse it repeatedly with distilled water three times and set aside the rinsed epoxy resin; Amino resin, take an appropriate amount of amino resin and add it to a 50 mL beaker. Then add 50 mM Tris-HCl buffer solution and stir for 2 h. After that, rinse it repeatedly with distilled water three times. Subsequently, take an appropriate amount of the treated resin and add it to 50 mL of 2% glutaraldehyde solution, stir at room temperature for 2 h and then filter by suction. The obtained amino resin is set aside; Ion exchange resin treatment: ① Cation exchange resin: Stir with 4% HCl for 12 h, wash three times with water; Stir with 4% NaOH for 12 h, wash three times with water; Stir with 4% HCl for 12 h, wash three times with water. ② Anion exchange resin: Stir with 4% NaOH for 12 h, wash three times with water; Stir with 4% HCl for 12 h and wash three times with water; Stir with 4% NaOH for 12 h, wash three times with water.

[0074] 2. Immobilization steps: Take the wet cells of NAD kinase mutant M3 and suspend them in 20 mM Tris-HCl buffer at pH 7.0 until the concentration reaches 100 g / L. Under the conditions of a crushing power of 240 W, crushing for 2 s and stopping for 4 s, ultrasonically crush for 30 min. The whole process needs to be carried out on ice. Centrifuge the crushed solution at 4 °C and 12000 rpm for 10 min, and take the supernatant as the crude enzyme solution. Weigh 1 g of each type of resin respectively, add it to 5 mL of the crude enzyme solution of NAD kinase mutant M3, place it in a water bath shaker at 25 °C, and shake at 130 rpm for 18 h. After that, wash it three times with distilled water and then filter to obtain the immobilized enzyme, which is placed in a refrigerator at 4 °C for standby.

[0075] Example 11. Screening of immobilized carrier resin materials

[0076] Screening of immobilized resin materials. Take 0.1 g of the immobilized enzyme respectively in a 1 ml reaction system: 50 mM Tris-HCl buffer at pH 7.0, add 100 mM substrate NAD, 120 mM sodium hexametaphosphate, and 100 mM manganese chloride, and react on a constant temperature metal pot at 55 °C and 1000 rpm. Use a BCA protein kit to measure the absorbance values of the crude enzyme solution at 562 nm before and after immobilization, calculate the protein content in the NAD kinase crude enzyme solution according to the standard curve, and then calculate the protein recovery rate.

[0077] Immobilized enzyme activity assay system: Weigh 0.1 g of immobilized NAD kinase. Add 50 mM, pH 7 Tris-HCl buffer, 100 mM substrate NAD, and 120 mM sodium hexametaphosphate to a 1 mL reaction system. React at 55 °C and 1000 rpm / min for 5 min. Then, take 100 μL and add 5 μL of 6 M hydrochloric acid, mix well to terminate the reaction. After centrifuging at 12,000 rpm for 1 min, take the supernatant, dilute it 100 times with deionized water, pass it through a 0.22 μm organic membrane, and then detect the product concentration by liquid chromatography to calculate the enzyme activity. Take the enzyme activity of the optimal carrier as 100%.

[0078] Table 4. Protein recovery rate and relative enzyme activity of immobilized enzyme

[0079] Vector Name Resin Type Protein Recovery Rate Relative Enzyme Activity (%) D290 Macroporous Weakly Basic Anion Exchange Resin 24.71 25.84 D301 Macroporous Weakly Basic Anion Exchange Resin 52.81 33.56 D113 Macroporous Weakly Acidic Cation Exchange Resin 26.92 40.24 D115 Macroporous Weakly Acidic Cation Exchange Resin 79.18 57.29 ES-103B Epoxy Resin 59.37 23.64 1000-EPC Epoxy Resin 49.49 20.10 1000-EPN Amino Resin 76.01 76.07 1000-NH Amino Resin 77.72 78.25 109F Amino Resin 74.82 49.78 1000-HA Amino Resin 70.17 54.43 1000-HFA Amino Resin 86.80 100 704 Amino Resin 85.76 65.94

[0080] Example 12. Batch reaction of NAD kinase-catalyzed synthesis of nicotinamide adenine dinucleotide phosphate

[0081] Add 0.1 g of immobilized NAD kinase to a 1 mL system: 50 mM Tris-HCl buffer with pH 7, add 100 mM substrate NAD, 120 mM sodium hexametaphosphate, and 100 mM magnesium chloride, and react in a small constant-temperature shaking metal bath reactor. Reaction batch: Define a reaction batch when the conversion rate exceeds 90%.

[0082] After each reaction, centrifuge at 12,000 rpm for 1 min with a high-speed centrifuge to collect the reaction solution. After washing the immobilized enzyme 3 - 5 times with deionized water, carry out the next batch of catalytic reactions. During the reaction process, sample and detect the substrate concentration using the method of Example 1 to calculate the substrate conversion rate. When a batch of reactions ends, detect the product concentration and calculate the product yield. The immobilized enzyme can still achieve a substrate conversion rate of over 90% after catalyzing 10 batches at 1 h per batch.

Claims

1. A NAD kinase mutant, characterized in that, The NAD kinase mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 as follows: Both glycine at position 170 and phenylalanine at position 259 are mutated to arginine.

2. An immobilized enzyme, characterized in that, The immobilized enzyme uses resin as a carrier and the enzyme solution of the engineered bacterium of a NAD kinase mutant as claimed in claim 1 as the active ingredient.

3. Use of a NAD kinase mutant as claimed in claim 1 or the immobilized enzyme as claimed in claim 2 in the preparation of nicotinamide adenine dinucleotide phosphate.

4. A preparation method of nicotinamide adenine dinucleotide phosphate, characterized in that, Using NAD as a substrate, the wet cells of the engineered bacterium of the NAD kinase mutant as claimed in claim 1 as a catalyst, and sodium hexametaphosphate as a phosphoryl group donor, nicotinamide adenine dinucleotide phosphate is obtained by reacting in a buffer reaction system.

5. The preparation method of nicotinamide adenine dinucleotide phosphate according to claim 4, wherein The pH value of the buffer is 6-9.

6. The preparation method of nicotinamide adenine dinucleotide phosphate according to claim 4, wherein, The reaction temperature is 30-70 °C.

7. The preparation method of nicotinamide adenine dinucleotide phosphate according to claim 4, characterized in that, A metal ion activator is further added to the reaction system, and the metal ions include one or more of manganese, cobalt, nickel, calcium, zinc, copper, and manganese ions.

8. A method for preparing nicotinamide adenine dinucleotide phosphate according to claim 7, characterized in that, The metal ion is manganese ion, and the concentration of the manganese ion is 10-200 mM.

9. The preparation method of nicotinamide adenine dinucleotide phosphate according to claim 4, characterized in that, The molar concentration ratio of the substrate to the phosphoryl group donor is 1:(0.4-1.6).

Images