Lysine cyclodeaminase, mutant, recombinant genetically engineered bacteria and application thereof
By mutating the amino acid sequence of lysine cyclization deaminase, a highly efficient lysine cyclization deaminase mutant was developed, solving the problems of insufficient enzyme activity and long reaction time in the enzyme-catalyzed synthesis of L-piperidine carboxylic acid, and realizing the industrial application of efficient and green synthesis of L-piperidine carboxylic acid.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2026-03-31
AI Technical Summary
Existing enzyme-catalyzed methods for synthesizing L-piperidinecarboxylic acid suffer from insufficient enzyme activity and long reaction times, which limit their widespread application in industry.
By using lysine cyclization deaminase from Streptomyces sp. NRRL B-1568, various mutants, including I61V/I94V/I233V/A235S, were developed through amino acid sequence mutations, which improved catalytic efficiency and substrate tolerance.
High conversion rates and short reaction times were achieved under high substrate concentrations. The mutants I61V/I94V/I233V/A235S achieved a conversion rate of 99% and a space-time yield of 1033.28 g L⁻¹d⁻¹ in 3 hours with 1000 mM substrate, which is the highest level to date. Moreover, the catalytic conditions are mild and environmentally friendly.
Smart Images

Figure CN119876106B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme engineering, specifically to a lysine cyclization deaminase, a mutant, a coding gene, recombinant plasmids containing these coding genes, and recombinant genetically engineered bacteria, and their application in catalyzing the synthesis of L-piperidine carboxylic acid from L-lysine. Background Technology
[0002] L-piperidinecarboxylic acid (L-PA) is a key chiral intermediate in the synthesis of many important drugs. High-optical-purity L-PA is widely used as a precursor for the local anesthetic ropivacaine, the immunosuppressant rapamycin, and FK-506 and FK-520. The bioactivity of these drugs depends on the stereochemical structure of the piperidine moiety, making the synthesis of high-purity L-piperidinecarboxylic acid particularly important. Furthermore, L-piperidinecarboxylic acid can be used to derive compounds with significant industrial applications.
[0003] The synthesis of L-piperidinecarboxylic acid can be broadly categorized into three methods: chemical methods require amino protection and deprotection operations, with a yield of only 45%. Photocatalytic methods have stringent requirements for catalytic conditions and reactors, and the reaction process is difficult to control. Multi-enzyme cascade processes are complex, and the reaction system exhibits uncertainties. In contrast, enzymatic catalysis offers several advantages, such as low catalyst loading, high specificity, high enantioselectivity, and the ability to reduce or eliminate reaction byproducts, making it more suitable for L-PA production. In 2015, Tani et al. used purified rAIP / DpkA racemic enzyme to catalyze the production of 45.1 g of L-piperidinecarboxylic acid. -1 Pyridinecarboxylic acid. In 2018, Cheng et al. reported the production of pyridinecarboxylic acid at a titer of 46.7 g / L from L-lysine hydrochloric acid solution using the same enzyme and a fed-batch fermentation system with a recombinant body decarboxylase (CADA) gene knockout strain containing lysine permease (LysP) and glucose dehydrogenase (GDH). In 2015, Ying et al. produced 17.25 g L of pyridinecarboxylic acid using *E. coli* containing lysine cyclization deaminase as a whole-cell biocatalyst. -1 L-PA was used to demonstrate its sustained enzymatic activity and its ability to self-regenerate NAD through cyclization. +This provides a better option for the two-step enzymatic method using rAIP and DpkA. In 2018, Ying et al., to overcome substrate inhibition, manipulated the enzyme structure related to substrate and product transport channels through saturation mutagenesis, producing 73.4 g / L L-PA via a whole-cell reaction. In 2020, Han et al. chose LCD and improved the overall conversion rate by introducing multiple copies of pipA without requiring any complex manipulation of the LCD itself, thus using an enhanced whole-cell system. After optimizing the enhanced whole-cell reaction, a conversion rate of 72.4% was obtained under 1000 mM L-lysine loading for 5 days. In 2024, Gao et al. used a novel ornithine cyclic deaminase to catalyze the synthesis of L-PA. Through a multi-regional synergistic strategy consisting of pocket remodeling, co-evolutionary design guided by dynamic cross-correlation matrix, and surface modification, they obtained a quadruple mutant that could catalyze a 91% conversion rate of 1000 mM L-lysine for 10 hours, producing 282.1 g / L L. -1 d -1 The spacetime productivity is the highest level reported to date.
[0004] Lysine cyclization deaminase catalyzes the synthesis of L-PA from L-lysine and has the following advantages: 1. The substrate L-lysine is inexpensive, readily available, and regenerable. 2. High-purity L-PA can be synthesized in one step, and the reaction system is simple and easy to control. 3. Lysine cyclization deaminase can achieve coenzyme self-circulation, requiring only the addition of a small amount of coenzyme to initiate the reaction.
[0005] To date, the enzymatic synthesis of L-PA still faces problems such as insufficient activity and long reaction time, which limits its industrial application. Only one lysine cyclization deaminase has been used to study the synthesis of L-PA, but it suffers from low catalytic activity and low substrate conversion in the asymmetric catalysis of L-lysine. Therefore, there is an urgent need to find novel lysine cyclization deaminases with high substrate tolerance and catalytic efficiency. Summary of the Invention
[0006] The purpose of this invention is to provide a novel lysine cyclization deaminase, mutant, encoding gene, recombinant plasmid, recombinant genetically engineered bacteria capable of synthesizing L-PA, and its application in catalyzing the synthesis of L-PA from L-lysine, thereby solving the problems of insufficient enzyme activity and long reaction time in the current enzyme-catalyzed synthesis of L-PA.
[0007] To solve the above problems, the present invention adopts the following technical solution:
[0008] According to a first aspect of the present invention, a lysine cyclization deaminase is provided, the amino acid sequence of which is shown in SEQ ID No. 1.
[0009] This wild-type lysine cyclization deaminase is a lysine cyclization deaminase from *Streptomyces sp. NRRL B-1568*, with NCBI accession number KJY42626.1. It should be understood that although the gene sequence of the wild-type lysine cyclization deaminase had previously been published on NCBI, its function was annotated as lysine decarboxylase, a dehydrogenase. The inventors first discovered that it could catalyze the synthesis of piperidine carboxylic acid, and therefore named it lysine cyclization deaminase. In fact, this invention is the first disclosure of such a lysine cyclization deaminase.
[0010] According to a second aspect of the present invention, a lysine cyclization deaminase mutant is provided, comprising a lysine cyclization deaminase mutant formed by mutations occurring on a wild-type lysine cyclization deaminase with the amino acid sequence shown in SEQ ID NO.1 as a template, comprising: mutant I61V obtained by mutation of isoleucine at position 61, with the amino acid sequence shown in SEQ ID NO.2; mutant I94V obtained by mutation of isoleucine at position 94, with the amino acid sequence shown in SEQ ID NO.3; mutant I233V obtained by mutation of isoleucine at position 233, with the amino acid sequence shown in SEQ ID NO.4; mutant A235S obtained by mutation of alanine at position 235, with the amino acid sequence shown in SEQ ID NO.5; mutant I233V / A235S obtained by iterative saturation mutation of isoleucine at position 233 and alanine at position 235, with the amino acid sequence shown in SEQ ID NO.6; and I94V / I233V / A235S obtained by combining the above-mentioned double-point mutation with position 94, with the amino acid sequence shown in SEQ ID NO. As shown in NO.7, the mutant I61V / I94V / I233V / A235S obtained by combining mutations at the above four amino acid sites has the amino acid sequence shown in SEQ ID NO.8.
[0011] According to a third aspect of the present invention, a coding gene is provided that encodes either the wild-type lysine cyclization deaminase as described above or a mutant of the lysine cyclization deaminase as described above.
[0012] According to a fourth aspect of the present invention, a recombinant expression vector comprising a gene encoding a lysine cyclization deaminase mutant as described above is provided.
[0013] According to a fifth aspect of the present invention, a recombinant expression transformant comprising the coding gene of the lysine cyclization deaminase mutant as described above is provided. The recombinant expression transformant can be prepared by transforming a constructed recombinant expression vector into a host cell. The host cell can be any conventional host cell in the art, provided that the recombinant expression vector can stably replicate spontaneously and can effectively express the target protein after induction with an inducer. The present invention preferentially uses *Escherichia coli* as the host cell, and *E. coli* BL21(DE3) is preferred for efficient expression of the lysine cyclization deaminase mutant described herein.
[0014] According to a sixth aspect of the present invention, a lysine cyclization deaminase mutant catalyst is provided, wherein the recombinant lysine cyclization deaminase mutant catalyst is any one of the following forms: 1) culturing the recombinant expression transformant as described above, and isolating transformant cells containing the lysine cyclization deaminase mutant; 2) culturing the recombinant expression transformant as described above, and isolating crude enzyme solution containing the lysine cyclization deaminase mutant; 3) culturing the recombinant expression transformant as described above, and isolating crude enzyme solution containing the lysine cyclization deaminase mutant, and drying the prepared crude enzyme powder or purifying the prepared pure enzyme; 4) culturing the recombinant expression transformant as described above, isolating transformant cells containing the lysine cyclization deaminase mutant, and then freeze-drying to obtain lyophilized bacterial powder.
[0015] According to a seventh aspect of the present invention, there is a method for using a lysine cyclization deaminase mutant as described above or a lysine cyclization deaminase mutant catalyst as described above in the catalytic production of L-lysine from L-PA.
[0016] Using the lysine cyclization deaminase mutant or the lysine cyclization deaminase mutant catalyst, the deaminization cyclization reaction of L-lysine is catalyzed to obtain L-PA.
[0017] Preferably, the lysine cyclization deaminase mutant catalyzes the deamination cyclization reaction of L-lysine in the presence of coenzyme NAD. + It takes place in the presence of [something].
[0018] The lysine cyclization deaminase mutant catalyst can catalyze the formation of L-PA from L-lysine. In this application, the concentration of the substrate L-lysine is 10–1000 mM, and the coenzyme NAD+ is... + The addition amount is 0.2–0.4 mM, and the dosage of the lysine cyclization deaminase is 5–30 g / L of lyophilized bacterial powder. -1 The disodium hydrogen phosphate / sodium dihydrogen phosphate buffer (but not limited to disodium hydrogen phosphate / sodium dihydrogen phosphate buffer) required for the reaction is a conventional buffer in the art, with a concentration of 50–200 mM.
[0019] The reaction is carried out at pH 6–10, preferably pH 7.5, under shaking or stirring conditions. The reaction temperature is 20–50°C, preferably 37°C. The reaction time is determined by the time it takes for the substrate to completely convert or for the reaction to terminate spontaneously, preferably less than 24 hours.
[0020] The key inventive point of this invention is that, through rational design of the enzyme, a lysine cyclization deaminase mutant with excellent catalytic efficiency at high substrate concentrations is provided, which solves the problems of incomplete conversion and long reaction time at high substrate concentrations, and lays the foundation for the industrial application of lysine cyclization deaminase to synthesize L-piperazine PA.
[0021] Specifically, this invention relates to a lysine cyclization deaminase, a mutant and its gene, a recombinant expression vector containing the gene and a recombinant expression transformant, derived from Streptomyces sp. NRRL B-1568, and its application in catalyzing the deamination and cyclization reaction of L-lysine to generate L-PA using the recombinant lysine cyclization deaminase or the recombinant expression transformant. This biocatalyst exhibits excellent catalytic performance at high substrate concentrations and shows promising application prospects in the synthesis of L-PA.
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0023] This invention discovers a novel lysine cyclization deaminase with high enantioselectivity and catalytic activity, which can catalyze the synthesis of L-lysine from L-PA. Through rational design, several mutants with significantly improved catalytic efficiency were obtained. The various lysine cyclization deaminase mutants provided by this invention exhibit advantages such as high substrate concentration tolerance, high catalytic efficiency, and short reaction time. Among them, the quadruple mutant I61V / I94V / I233V / A235S achieves a 99% conversion rate of 1000mM substrate in 3 hours, with an ee value >99.9% and a space-time yield of 1033.28 g L. -1 d -1 This is the highest level of reporting to date.
[0024] Meanwhile, the method for L-lysine to L-PA catalyzed by lysine cyclization deaminase provided by this invention has advantages over other preparation methods, including simple and mild catalytic conditions, environmental friendliness, and easy subsequent separation and purification of the product. The one-step synthesis has advantages such as high atom economy and high product optical purity, and shows good application prospects in the green industrial catalytic synthesis of L-PA. Attached Figure Description
[0025] Figure 1 The reaction formula for the production of L-PA from L-lysine catalyzed by lysine cyclization deaminase is shown. Detailed Implementation
[0026] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0027] Materials and methods
[0028] L-Lysine and L-PA standards were purchased from Aladdin, Inc. (USA). All chemical reagents used in the experiments were purchased from Maclean's (China). Taq DNA polymerase was purchased from Yesen Biotech (China). Restriction endonucleases and T4 DNA ligases were purchased from Thermo Fisher Scientific (USA). The expression vector [pET28a(+)] and Escherichia coli BL21(DE3) were purchased from Novagen, Inc. (Germany).
[0029] Primer synthesis and sequence sequencing were performed by Beijing Qingke Biotechnology Co., Ltd. (Shanghai).
[0030] Example 1: Strain Construction
[0031] The sequence of the lysine cyclization deaminase Ssp from Streptomyces sp. NRRL B-1568 was cloned. Based on the target sequence, primers with restriction enzyme sites were designed using Agilent's primer design program (https: / / www.agilent.com / store / primerDesignProgram.jsp). Using metagenomic DNA as a template, polymerase chain reaction (PCR) was used to obtain the target enzyme gene, which was then digested and ligated into the pET28a(+) vector and transformed into E. coli BL21(DE3). Positive clones were screened. After sequencing verification, pET28a(+)-Ssp was transformed into the expression host E. coli BL21(DE3) for subsequent recombinase expression.
[0032] Example 2: Mutant Construction
[0033] Using recombinant plasmid pET28 a(+)-Ssp as a template, primers were designed for the proposed mutation sites. The sequences of the forward and reverse primers are shown in Table 1. PCR system: 10 μL DNA polymerase P515, 1 μL each of forward and reverse primers, 1 μL template, 7 μL double-distilled water, total volume 20 μL. PCR program: First, pre-denaturation at 95℃ for 5 min; then, cycle the following program 30 times: 95℃ denaturation for 30 s, Tm+5℃ annealing for 30 s, 72℃ extension for 5.5 min; final extension at 72℃ for 3 min, and maintenance at 4℃.
[0034] Table 1. Primers used for constructing the Ssp mutant (SEQ ID NO. 9-16)
[0035] Primer Name Primer Sequence (5’-3’) I61V-F GCATCCATTCCCAAACACCCGGAACCGGCTC I61V-R GAGCCGGTTCCGGGTGTTTGGGAATGGATGC I94V-F GCAACAGTCCCAATAACGGTCGGCAGACCAAAG I94V-R CTTTGGTCTGCCGACCGTTATTGGGACTGTTGC I233V-F TCCGCATTTACATATTAATGCAGTTGGTGCCGATTTAGTTGG I233V-R CCAACTAAATCGGCACCAACTGCATTAATATGTAAATGCGGA A235S-F GTCCGCATTTACATATTAATGCAATTGGTAGCGATTTAGTTGGTAAAACC A235S-R GGTTTTACCAACTAAATCGCTACCAATTGCATTAATATGTAAATGCGGAC
[0036] A series of mutants of the L-lysine cyclization deaminase Ssp were obtained through mutation, including:
[0037] 1) A recombinant protein formed by replacing isoleucine at position 61 of the amino acid sequence shown in SEQ ID NO.1 with valine, the amino acid sequence of which is shown in SEQ ID NO.2, is named I61V;
[0038] 2) The recombinant protein formed by replacing isoleucine at position 94 of the amino acid sequence shown in SEQ ID NO.1 with valine, whose amino acid sequence is shown in SEQ ID NO.3, is named I94V;
[0039] 3) The recombinant protein formed by replacing isoleucine at position 233 of the amino acid sequence shown in SEQ ID NO.1 with valine, whose amino acid sequence is shown in SEQ ID NO.4, is named I233V;
[0040] 4) A recombinant protein formed by replacing the amino acid sequence C at position 235 as shown in SEQ ID NO.1 with serine, the amino acid sequence of which is shown in SEQ ID NO.5, is named A235S;
[0041] 5) The recombinant protein formed by the optimal mutant obtained by iterative saturation mutation of isoleucine at position 233 and alanine at position 235 of the amino acid sequence shown in SEQ ID NO.1, has the amino acid sequence shown in SEQ ID NO.6 and is named I233V / A235S.
[0042] 6) The recombinant protein formed by combining the optimal mutant obtained by iterative saturation mutation of isoleucine at position 233 and alanine at position 235 of the amino acid sequence shown in SEQ ID NO.1 with position 94 has the amino acid sequence shown in SEQ ID NO.7 and is named I94V / I233V / A235S.
[0043] 7) The above four amino acid sites of the amino acid sequence shown in SEQ ID NO.1 are combined and mutated to obtain a recombinant protein, the amino acid sequence of which is shown in SEQ ID NO.7 and named I61V / I94V / I233V / A235S.
[0044] Example 3: Strain Culture
[0045] The recombinant plasmid was introduced into Escherichia coli strain BL21(DE3) for gene expression. The expression was performed at 37°C using a solution containing 50 mg / mL... -1Kanamycin was cultured in Luria-Bertani broth until the optical density at 600 nm reached 0.6–0.8. Isopropyl-β-d-thiogalactopyranoside was added to a final concentration of 0.1 mM to induce overexpression at 20 °C for 20 h. The culture medium was removed by centrifugation at 8000 g for 10 min, and 0.85 g L... -1 The wet bacterial cells were washed with physiological saline, then centrifuged at 8000g for 10 minutes. The bacterial cells were collected and stored at -20℃ for further experiments.
[0046] Example 4: Lysine cyclization deaminase Ssp mutant catalyzes L-lysine reaction to generate L-PA
[0047] A schematic diagram illustrating the principle of L-lysine to L-PA catalyzed by the recombinant lysine cyclization deaminase Ssp mutant is shown below. Figure 1 As shown.
[0048] The reaction was carried out in 100 mM phosphate buffer (pH 7.5) containing a defined concentration of L-lysine and 10 mg / mL of [unspecified ingredient]. -1 Whole-cell catalyst and 0.4 mM NAD + The pH was adjusted to 7.5 with phosphoric acid; the reaction mixture was brought to a final volume of 1 mL. The reaction was carried out at 37 °C and 220 rpm, then terminated by heating at 95 °C for 5 minutes. The supernatant was collected by centrifugation, and the conversion was determined by high-performance liquid chromatography (HPLC). All experiments were performed in triplicate.
[0049] Table 2 Wild-type lysine cyclization deaminase Ssp and mutant conversion rates and ee values
[0050]
[0051] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the claims of this patent. All aspects not described in detail in this invention are conventional technical content.
Claims
1. A lysine cyclodeaminase mutant having improved L-piperidinecarboxylic acid-producing ability, characterized by comprising a substitution of an amino acid residue at position 1 1 1 of SEQ ID NO: 1 with an amino acid residue having a hydrophobic side chain. lysine cyclodeaminase with the amino acid sequence shown in SEQ ID NO. 1 as a template, a mutant I233V obtained by mutating the isoleucine at position 233, the amino acid sequence of which is shown in SEQ ID NO. 4; or a mutant I233V / A235S obtained by iterative saturation mutation of the isoleucine at position 233 and the alanine at position 235, the amino acid sequence of which is shown in SEQ ID NO. 6; or I94V / I233V / A235S obtained by combining double-point mutation with the 94th position, the amino acid sequence of which is shown in SEQ ID NO. 7; or a mutant I61V / I94V / I233V / A235S obtained by mutating the isoleucine at position 61 to valine, the isoleucine at position 94 to valine, the isoleucine at position 233 to valine, and the alanine at position 235 to serine, the amino acid sequence of which is shown in SEQ ID NO.
8.
2. A coding gene encoding the lysine cyclodeaminase mutant of claim 1.
3. A recombinant plasmid comprising the coding gene of claim 2.
4. A recombinant genetically engineered bacterium comprising the recombinant plasmid of claim 3.
5. The recombinant genetically engineered bacteria according to claim 4, characterized in that, The host cell employed is E. coli BL21(DE3) Escherichia coli BL21(DE3).
6. A method for producing a lysine cyclodeaminase mutant, characterized by, comprising the following steps: 1) culturing the recombinant genetically engineered bacterium of claim 4 and inducing expression of the lysine cyclodeaminase mutant; 2) isolating the lysine cyclodeaminase mutant of claim 1 from the culture obtained in 1).
7. Use of the lysine cyclodeaminase mutant of claim 1 in catalyzing the synthesis of L-piperidinecarboxylic acid from L-lysine.
8. Use according to claim 7, characterized in that, the use comprising the following steps: S1: culturing the recombinant genetically engineered bacterium of claim 4, inducing expression to obtain crude enzyme liquid or wet bacterium or freeze-dried bacterium powder; S2: adding phosphate buffer solution and mother liquor containing L-lysine, NAD + to the crude enzyme solution or wet mycelium or freeze-dried mycelium powder, and mixing well after adding all components, and placing in a 37℃ shaker for reaction, thereby achieving high-efficiency synthesis of L-piperidinecarboxylic acid.