Lipase mutant

Abstract

The invention relates to the technical field of gene engineering and protein modification, in particular to a lipase mutant and application thereof in synthesis of a pregabalin key chiral intermediate. According to the invention, on the basis of thermomyces lanuginosus lipase TL, a large amount of mutation screening is carried out, so that the lipase mutant of which the catalytic efficiency of hydrolysis of 2-carboxyethyl-3-cyano-5-methyl ethyl hexanoate (CNDE) is remarkably improved is finally obtained. Wherein the catalytic constant Kcat of the single-point mutant containing S254A reaches 100.2 and is 45 times of that of a wild type, the enantiomer selectivity ee value of the single-point mutant containing S254A is also higher than that of the wild type, and an unexpected technical effect is achieved. The lipase mutant can be applied to efficient synthesis of a pregabalin key chiral intermediate, and has a wide prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and protein modification technology, specifically relating to a lipase mutant and its application in the synthesis of a key chiral intermediate of pregabalin. Background Technology

[0002] Currently, most chiral drugs synthesized chemically are racemic compounds. However, typically only one enantiomer exhibits strong affinity for the receptor, high activity, good efficacy, and few adverse reactions, while the other enantiomer not only lacks efficacy but may also counteract some of the active enantiomer's effects or even cause serious adverse reactions. To obtain single chiral drugs, various chiral techniques have been used in recent years for the preparation of pharmaceutical intermediates. Chiral techniques usually involve the asymmetric synthesis or resolution of a chiral intermediate in a chemical synthesis route, followed by the synthesis of a single chiral drug. Compared to chemical resolution methods, enzymatic resolution offers advantages such as fewer side reactions, easier product separation and purification, and less environmental pollution.

[0003] Enzymatic resolution often utilizes hydrolases, among which lipases (EC 3.1.1.3) are frequently used. Lipases, also known as glycerol ester hydrolases or triacylglycerol acyl hydrolases, are a class of hydrolases that can hydrolyze triglycerides to produce free fatty acids of varying chain lengths and glycerol. From a catalytic perspective, lipases exhibit mild reaction conditions, produce few byproducts, and do not require coenzymes. They also possess high chemoselectivity and stereoisomerism. Furthermore, lipases can catalyze ester hydrolysis, ester synthesis, transesterification, ammonolysis, alcoholysis, and drug synthesis.

[0004] Lipases primarily originate from plants, animals, and microorganisms. Microorganisms are characterized by their diversity, rapid reproduction, and high variability, secreting a wide variety of lipases with broad substrate diversity. They can adapt to different pH and temperature ranges, and some microbial strains obtained from extreme environments exhibit even more pronounced enzymatic characteristics. Currently, lipase-producing microorganisms are widely distributed, with over 60 genera identified, including 10 genera of yeasts, 23 genera of other fungi, 4 genera of actinomycetes, and 28 genera of bacteria. High-producing lipase fungal strains are mostly derived from Rhizopus, Aspergillus, Penicillium, Mucor, Geotrichum, and others.

[0005] In the synthesis of non-aqueous chiral drugs, lipases catalyze reactions such as ester hydrolysis, transesterification, and ammonolysis, resolving racemic alcohols, acids, esters, and amines. They have become an important technique for preparing optically pure chiral drugs. Pregabalin is a marketed γ-aminobutyric acid (GABA) analog used to treat adult epilepsy, neuropathic pain, migraines, and generalized anxiety disorder. Due to the increasing demand for pregabalin, numerous chemical and enzymatic synthetic routes have been developed. (S)2-carboxyethyl-3-cyano-5-methylhexanoic acid is a key chiral intermediate in the synthesis of pregabalin. Currently, it has been reported to use commercially available lipases Lipolase and Lipozyme TLIM as biocatalysts to kinetically resolve ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) to prepare (S)2-carboxyethyl-3-cyano-5-methylhexanoic acid. However, existing lipases have low catalytic efficiency and poor enantioselectivity in the CNDE resolution process, resulting in high production costs. Therefore, it is necessary to develop lipases with higher catalytic efficiency and better enantioselectivity. Summary of the Invention

[0006] This invention addresses the problems of existing technologies by providing a lipase mutant and its application in the synthesis of a key chiral intermediate for pregabalin. This invention relates to *Thermophilus spp.* (a type of lipase). Thermomyces Lanuginosus Based on lipase TL, through extensive mutation screening, a lipase mutant with a significantly enhanced catalytic reaction rate for the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) was finally obtained, laying the foundation for its widespread use in the efficient synthesis of key chiral intermediates of pregabalin.

[0007] The present invention provides a lipase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:2, and comprising an amino acid substitution at at least one position selected from the group consisting of: 3, 27, 38, 58, 91, 96, 111, 163, 226, 227, 228, 230, 231, 232, 233, 235, 236, 237, 238, 240, 241, 251, 254, 256.

[0008] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:2.

[0009] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:2.

[0010] In some embodiments of the present invention, the mutant comprises a substitution or combination of at least one amino acid from the following group: S3C, S3C / R232C, D27R, G38A, S58M, G91T, D96E, D111A, G163K, T226A, L227T, V228A, V230T, T231A / E / G / N / R / S, R232C / T, N233C / T, I235T, V236A, K237R, I238T, G240A, I241A, N251T, D254A / S, P256T.

[0011] The present invention also relates to DNA molecules encoding the above-mentioned lipase mutants.

[0012] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0013] The present invention also relates to a host cell comprising the above-described recombinant expression vector.

[0014] The host cell is Pichia pastoris ( Pichia pastoris ).

[0015] The host cell is Aspergillus niger ( Aspergillus niger ).

[0016] The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

[0017] This invention provides mutants based on wild-type lipase TL, containing at least one amino acid from the following group, or combinations thereof: S3C, S3C / R232C, D27R, G38A, S58M, G91T, D96E, D111A, G163K, T226A, L227T, V228A, V230T, T231A / E / G / N / R / S, R232C / T, N233C / T, I235T, V236A, K237R, I238T, G240A, I241A, N251T, D254A / S, and P256T. These mutants significantly improve the catalytic efficiency for the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE). Among these, the single-point mutant containing S254A exhibits a catalytic constant... KThe cat value reached 100.2, which is 45 times that of the wild type, and the enantioselectivity ee value reached 98.8%, which is also higher than that of the wild type, achieving unexpected technical results. This lipase mutant can be widely used in the synthesis of key chiral intermediates of pregabalin, showing broad application prospects. Attached Figure Description

[0018] Figure 1 The image shows the recombinant plasmid pPIC9K-TL. Detailed Implementation

[0019] The method of the present invention will be further illustrated below with examples. Experimental methods in the following examples that do not specify specific conditions can generally be operated under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention through these examples. However, the protection and scope of the claims of the present invention are not limited to the specific examples provided, but should include the scope of protection that can be extended by those skilled in the art based on this specification without inventive effort.

[0020] Experimental materials and reagents: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, and vector pPIC9k were purchased from Invitrogen.

[0021] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutation kits from Beijing Bomais Biotechnology Co., Ltd.

[0022] Culture medium formulation: Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; LB+Amp medium: LB medium with 100 μg / mL ampicillin; LB+Kanamycin medium: LB medium supplemented with 50 μg / mL kanamycin; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast selection medium (MD medium): 2% glucose, 1.34% YNB, 4×10⁻⁶ -5 % Biotin, 2% Agar Powder; BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10-5 % Biotin, 1% Glycerin; BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % Biotin, 0.5% Methanol.

[0023] The present invention will now be described in detail with reference to the embodiments.

[0024] Example 1: Synthesis of adipose-derived genes and acquisition of recombinant plasmids The wild-type lipase gene was named TL, with its nucleotide sequence SEQ ID NO: 1 and its encoding amino acid sequence SEQ ID NO: 2. This gene was synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0025] PCR primers were designed based on the 5' end of the gene, containing an EcoRI restriction enzyme site, and the 3' end, containing a NotI restriction enzyme site. The primer sequences are as follows: 5' primer TL-F: GGC GAATTC GAAGTGAGCCAGGACCTGTTC (The underlined part is the EcoRI restriction enzyme recognition site); 3' primer TL-R: ATA GCGGCCGC TCACAGACAGGTGCCGATCAG (The underlined part is the NotI restriction enzyme recognition site).

[0026] Using the synthesized lipase TL gene SEQ ID NO: 1 as a template, PCR amplification was performed using the above primers. The PCR amplification system consisted of: 1 μL template, 1 μL upstream primer TL-F, 1 μL downstream primer TL-R, 10 μL 5×PS Buffer, 4 μL dNTPs (2.5 mM), 1 μL Primer-Star DNA polymerase, and 32 μL ddH2O, with a total reaction volume of 50 μL. The PCR cycling program was as follows: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 56℃ for 30 sec, 72℃ for 1 min, 72℃ for 10 min; PCR products were recovered from the gel, digested with EcoRI and NotI, and then ligated into the pPIC-9k vector digested with the same enzymes overnight at 16℃. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37℃. After transformants appeared, positive clones were verified by colony PCR, and the correct recombinant plasmid pPIC9K-TL was finally obtained after sequencing verification. Figure 1 ).

[0027] Example 2: Screening of lipase mutants To further improve the catalytic efficiency of lipase TL in the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE), a large number of mutation sites were randomly screened for on the enzyme without destroying the protein's secondary structure and active site.

[0028] (1) Construction of mutant library Using the synthesized lipase TL gene SEQ ID NO: 1 as a template, error-prone PCR amplification was performed with the above primers for TL-F and TL-R, respectively. The 100 μL error-prone PCR reaction system contained Mg. 2+ The buffer, 0.2 μM primers, 7 mM MgCl2, 0.2 mM MnCl2, 0.2 mM dGTP, 0.2 mM dATP, 1.0 mM dCTP, 1.0 mM dTTP, 50 ng template, and 5 U Taq polymerase were used. The PCR cycling program was: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 56℃ for 30 sec, 72℃ for 1 min, and 72℃ for 10 min. The PCR products were recovered from the gel, digested with EcoRI and NotI, and ligated into the pPIC-9k vector digested with the same enzymes overnight at 16℃. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37℃. After the transformants appeared, all colonies were washed with water, and the plasmid was extracted to obtain the lipase mutant library.

[0029] (2) Pichia pastoris transformation Pichia pastoris GS115 strain was activated on YPD plates and cultured at 30°C for 48 hours. Then, a single activated GS115 colony was inoculated into 5 mL of YPD liquid medium and cultured at 30°C and 220 rpm for approximately 18 hours. The culture was then transferred to 50 mL of YPD liquid medium. In Erlenmeyer flasks containing YPD liquid culture medium, the cells were incubated at 30°C and 220 rpm for approximately 5 hours. The cell density was then measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 5 ml of cells were collected by centrifugation at 4°C and 6000 rpm for 3 minutes into sterile EP tubes. The supernatant was gently discarded, and any remaining supernatant was blotted dry with sterile filter paper. The cells were then resuspended in 2 mL of pre-cooled sterile water. After centrifugation at 4°C and 6000 rpm for 3 minutes, the supernatant was gently discarded, and the cells were resuspended in 2 mL of pre-cooled sorbitol (1 mol / L). After centrifugation at 4°C and 6000 rpm for 3 minutes, the supernatant was gently discarded, and the cells were gently resuspended in 100–150 μl of pre-cooled sorbitol (1 mol / L).

[0030] The constructed lipase TL and lipase mutant library plasmids were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were obtained by screening on MD plates.

[0031] Single-clone transformants were selected and transferred to 48-well plates containing 1 ml of BMGY medium. After incubation at 30°C and 800 rpm for 1 day with shaking, 0.5% methanol was added daily. After 2 days of induced expression, the bacterial cells were removed by centrifugation, yielding a supernatant containing lipase, i.e., lipase enzyme solution. The catalytic rate of lipase in the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate was detected using a high-throughput screening method.

[0032] (3) Mutant screening Take 20 μL of lipase solution and add it to 180 μL of pH 8.0 buffer to dilute it 10 times.

[0033] Add 180 μL of substrate (10 mM potassium phosphate buffer, pH 7.2, 0.01% bromophenol blue, 100 mM ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate) and 20 μL of diluted lipase solution to an ELISA plate, mix well, and obtain the reaction solution; use lipase TL solution as a control. The rate at which the reaction solution changes from blue to yellow is used as the screening index; a faster color change from blue to yellow reflects a high reaction rate of lipase catalyzing the hydrolysis of the substrate ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate.

[0034] Multiple rounds of error-prone PCR screening results showed that 33 lipase mutants significantly increased the catalytic reaction rate of the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate. Lipase sequences were cloned from these mutants and sequenced. After sequence alignment, the mutation sites and their combinations that significantly increased the catalytic rate of lipase hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate were finally identified as follows: S3C, S3C / R232C, D27R, G38A, S58M, G91T, D96E, D111A, G163K, T226A, L227T, V228A, V230T, T231A / E / G / N / R / S, R232C / T, N233C / T, I235T, V236A, K237R, I238T, G240A, I241A, N251T, D254A / S, and P256T.

[0035] Example 3 Catalytic efficiency of lipase mutant for the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) Michaelis constant ( K m) means that the enzyme-catalyzed reaction reaches its maximum rate ( V The concentration of substrate (S) at half the maximum value (max) is a characteristic physical quantity of the enzyme, and its magnitude is related to the properties of the enzyme. K The smaller the value of m, the lower the substrate concentration required for the enzyme to react, indicating a greater affinity between the enzyme and the substrate.

[0036] K CAT, also known as a turnover number, utilizes... V The maximum value is calculated by dividing the enzyme concentration by the maximum value. K cat indicates how many moles of substrate can be converted into product per mole of enzyme per unit time. K The larger the cat, the higher the enzyme activity.

[0037] The recombinant Pichia pastoris strains expressing lipase TL and its lipase mutants, constructed in Example 2, were inoculated into shake flasks containing BMGY medium and cultured at 30°C and 220 rpm for 1 day. Afterward, they were transferred to fresh BMGY medium, with 0.5% methanol added daily. After 3 days of induced expression, the bacterial cells were removed by centrifugation, yielding a supernatant containing lipase, i.e., the lipase solution. The enzyme solution was diluted with PBS buffer to an enzyme activity of 50 U / ml.

[0038] The kinetic constant and enantioselectivity of lipase in the supernatant were determined using the following methods.

[0039] (1) Determination of enzyme-catalyzed reaction kinetic constants Michaelis constants of lipase TL and its mutants ( K m) and maximum reaction rate ( V The maximum value was determined according to the standard Michaelis constant equation. The reaction temperature was 40°C, the buffer pH was 7.5 (100mM Tris-HCl), and the substrate ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (2-100mM) was diluted to the appropriate concentration with 5% acetonitrile.

[0040] (2) Determination of enantioselectivity ee value The 1L reaction system contained 150mM calcium acetate, 3M ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate, and 5% lipase solution. The temperature was controlled at 30℃, and the mixture was stirred at 400rpm. The pH was automatically controlled to 7.0 using 5M NaOH. Samples were taken every 10 hours for gas chromatography to determine the conversion rate and enantiomeric ee value.

[0041] The specific results are shown in Table 1.

[0042] Table 1. Kinetic constants and enantioselectivity ee values ​​of lipase mutants for CNDE. Lipase m (mM) <![CDATA[ V max(mol mg) −1 min −1 )]]> <![CDATA[ K how much (min) -1 )]]> <![CDATA[ K cat / K m(min −1 mM −1 )]]> ee value Wild type TL 37.5 0.075 2.2 0.06 95.1% S3C single-point mutant 19.8 2.21 66.3 3.35 98.4% R232C single-point mutant 18.6 1.53 45.9 2.47 98.25% S3C / R232C two-point mutant 15.3 2.71 81.3 5.31 96.41% V228A single-point mutant 15.8 2.81 88.6 5.61 99.34% I238T single-point mutant 17.2 1.89 56.7 3.30 98.38% S254A single-point mutant 16.9 3.34 100.2 5.93 98.8% As shown in Table 1, compared with the wild-type lipase TL, the kinetic constants of the lipase mutant provided in this invention for the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) were significantly improved, indicating that its catalytic efficiency for CNDE hydrolysis was greatly enhanced. Among them, the S254A single-point mutant had the highest catalytic constant Kcat value of 100.2, which is 45 times that of the wild type, and its enantioselectivity ee value reached 99.34%, which is significantly higher than that of the wild type.

[0043] The lipase mutant provided by this invention can significantly improve the catalytic efficiency of hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) and can be widely used in the preparation of the key chiral intermediate (S) 2-carboxyethyl-3-cyano-5-methylhexanoate for the synthesis of pregabalin.

Claims

1. A lipase mutant, characterized in that, The mutant was obtained by mutating the lipase shown in the amino acid sequence SEQ ID NO:2 by changing the 232nd amino acid from Arg to Cys.

2. A DNA molecule encoding the lipase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3; the host cell is a non-animal or non-plant variety.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

6. The host cell as described in claim 4, characterized in that, The host cell is Aspergillus niger ( Aspergillus niger ).

7. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

Images