Fluorescent quantitative PCR primer composition and application thereof

Abstract

The invention discloses a fluorescent quantitative PCR (Polymerase Chain Reaction) primer composition and application thereof. The fluorescent quantitative PCR primers capable of accurately and sensitively detecting the four drug-resistant genes are respectively obtained aiming at the drug-resistant genes blaCMY, blaTEM, blaCTX-M and blaDHA of the beta-lactam antibiotics, and the fluorescent quantitative PCR primers can be used for detecting the drug resistance of bacteria to the beta-lactam antibiotics. The fluorescent quantitative PCR primers for the four drug-resistant genes can be independently used, and can be mixed for detecting the drug resistance of the bacteria to the beta-lactam antibiotics, and the four drug-resistant genes can be simultaneously detected through single reaction, so that the detection efficiency of the drug resistance of the bacteria to the beta-lactam antibiotics is improved, and the detection waiting time is shortened.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular detection, and more specifically, relates to a fluorescent quantitative PCR primer composition and application thereof. Background Art

[0002] β-lactam antibiotics are a class of antibiotics with a β-lactam ring structure, including penicillin and cephalosporin, as well as other atypical β-lactam antibiotics such as the newly developed cephalomycins, thiomycins, and monocyclic β-lactams. β-lactam antibiotics can hinder the synthesis of cell wall mucopeptides, resulting in defects in the bacterial cell wall, causing the bacteria to swell and lyse and die. Since mammalian cells do not have cell walls, β-lactam antibiotics are less toxic to host cells and only have selective bactericidal effects on bacteria. They are the most commonly used antibiotics in clinical practice. In recent years, with the widespread spread of β-lactam antibiotic resistance genes among strains, it has posed a serious threat to public health and the medical system. Detecting whether bacteria are resistant to β-lactam antibiotics is not only conducive to guiding medication and reducing unnecessary use of antibiotics, but also helps to timely detect and monitor the spread trend of resistant bacteria and avoid the spread of resistance.

[0003] Common β-lactam antibiotic-resistant bacteria are Enterobacteriaceae that produce extended-spectrum β-lactamases (ESBLs). The development of resistance to β-lactam antibiotics in Enterobacteriaceae is mainly due to the high expression of extended-spectrum β-lactamases and / or efflux pumps, and / or the overexpression of cephalosporinase (AmpC) combined with porins to reduce outer membrane permeability. The β-lactam antibiotic resistance genes that have been discovered include blaCTX-M, blaTEM, blaCMY, and blaDHA. The blaCTX-M gene is a resistance gene that encodes CTX-M type ESBLs. Bacteria carrying the blaCTX-M gene usually show multidrug resistance. The blaTEM gene is a resistance gene that encodes TEM type β-lactamase. The blaCMY gene encodes AmpC type β-lactamase, which can hydrolyze a variety of β-lactam antibiotics including cephalosporins, leading to bacterial resistance. The blaDHA gene is also a resistance gene encoding AmpC type β-lactamase.

[0004] Although there have been reports on primers and / or probes for detecting β-lactamase, which can be used to detect bacterial resistance to β-lactam antibiotics, there are no reports on detecting blaCTX-M, blaTEM, blaCMY and blaDHA genes. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a fluorescent quantitative PCR primer composition.

[0006] The first object of the present invention is to provide a fluorescent quantitative PCR primer composition.

[0007] The second object of the present invention is to provide a kit containing the fluorescent quantitative PCR primer composition.

[0008] The third object of the present invention is to provide the use of the primer combination or the kit in the preparation of a β-lactam antibiotic resistance gene detection product.

[0009] The fourth object of the present invention is to provide the use of the primer composition or the kit in preparing a product for treating bacterial resistance to β-lactam antibiotics.

[0010] The above-mentioned purpose of the present invention is achieved by the following technical solutions:

[0011] The present invention targets the β-lactam antibiotic resistance genes blaCMY, blaTEM, blaCTX-M and blaDHA, and obtains fluorescent quantitative PCR primers that can accurately and sensitively detect the four resistance genes, which can be used for bacterial resistance detection to β-lactam antibiotics. In addition to being used alone, the fluorescent quantitative PCR primers of the four resistance genes can also be mixed for bacterial resistance detection to β-lactam antibiotics. That is, the present invention provides a fluorescent quantitative PCR primer composition, which can be used to detect β-lactam antibiotic resistance genes, and detect bacterial resistance to β-lactam antibiotics by detecting resistance genes.

[0012] The present invention provides a fluorescent quantitative PCR primer composition, which contains primer pairs 1 to 4; the nucleotide sequences of the primer pair 1 are respectively shown as SEQ ID NOs. 1 to 2; the nucleotide sequences of the primer pair 2 are respectively shown as SEQ ID NOs. 3 to 4, SEQ ID NOs. 5 to 6 or SEQ ID NOs. 7 to 8; the nucleotide sequences of the primer pair 3 are respectively shown as SEQ ID NOs. 9 to 10; and the nucleotide sequences of the primer pair 4 are respectively shown as SEQ ID NOs. 11 to 12.

[0013] As an optional solution, the primer composition contains primers shown in SEQ ID NOs. 1 to 2 and SEQ ID NOs. 5 to 12.

[0014] As an optional solution, the primer composition contains primers shown in SEQ ID NOs. 1 to 4 and SEQ ID NOs. 7 to 12.

[0015] As an optional solution, the primer composition contains primers shown in SEQ ID NOs. 1 to 6 and SEQ ID NOs. 9 to 12.

[0016] As an optional solution, the primer composition contains primers shown in SEQ ID NOs. 1 to 12.

[0017] As an optional solution, the primer composition further contains a primer pair for detecting the internal reference gene using 16S rRNA as an internal reference gene, and the nucleotide sequences thereof are shown in SEQ ID NO.13 and SEQ ID NO.14.

[0018] Specifically, the usage concentration of each primer in the primer composition is 1 to 12 μM / L.

[0019] The present invention also provides a kit, which contains the primer combination and reagents required for PCR fluorescence quantitative reaction.

[0020] Specifically, the reagents include a reaction buffer and an enzyme.

[0021] Specifically, when the kit is used to detect drug-resistant genes, the pre-denaturation temperature is 92-98°C, and the pre-denaturation time is 30-40s; the denaturation temperature is 92-98°C, and the denaturation time is 5-10s; the annealing / extension temperature is 56-60°C, and the annealing / extension time is 10-30s; and the denaturation and annealing / extension steps are performed for 38-42 cycles.

[0022] Preferably, the pre-denaturation temperature is 95°C, the pre-denaturation time is 30 s; the denaturation temperature is 95°C, the denaturation time is 5 s, the annealing / extension temperature is 58°C, the annealing / extension time is 20 s, and the cycle is repeated 40 times.

[0023] Specifically, after the reaction is completed, the result is judged based on the CT value of fluorescence quantification.

[0024] Specifically, if the Ct value is ≤35, the tested sample contains β-lactam antibiotic resistance genes; if the Ct value is >35, the tested sample does not contain β-lactam antibiotic resistance genes.

[0025] Specifically, the β-lactam antibiotic resistance genes include blaCMY, blaTEM, blaCTX-M and / or blaDHA.

[0026] In view of the fact that the primer composition and the kit of the present invention can detect β-lactam antibiotic resistance genes, and detect the resistance of bacteria to β-lactam antibiotics by detecting the resistance genes, the present invention also requests protection for the use of the primer composition or the kit in the preparation of a β-lactam antibiotic resistance gene detection product.

[0027] Specifically, the β-lactam antibiotic resistance genes include blaCMY, blaTEM, blaCTX-M and / or blaDHA.

[0028] The present invention also claims to protect the use of the primer composition or the kit in preparing a product for treating bacterial resistance to β-lactam antibiotics.

[0029] Specifically, the primer composition detects the drug resistance of bacteria to β-lactam antibiotics by detecting blaCMY, blaTEM, blaCTX-M and / or blaDHA resistance genes in the bacteria.

[0030] Specifically, if the detected bacterial sample contains a β-lactam antibiotic resistance gene, it indicates that the bacterial sample is resistant to β-lactam antibiotics. The present invention has the following beneficial effects:

[0031] The present invention targets the β-lactam antibiotic resistance genes blaCMY, blaTEM, blaCTX-M and blaDHA, and obtains fluorescent quantitative PCR primers that can accurately and sensitively detect the four resistance genes, which can be used for bacterial resistance detection to β-lactam antibiotics, and the detection sensitivity for DNA samples is 5ng / μL. In addition to being used alone, the fluorescent quantitative PCR primers of the four resistance genes can also be mixed for bacterial resistance detection to β-lactam antibiotics, and the mixed use does not affect the detection sensitivity of the primers. The mixed detection can simultaneously detect the four resistance genes through a single reaction, improve the detection efficiency of bacterial resistance to β-lactam antibiotics, and shorten the detection waiting time. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The amplification curves are obtained by using the six pairs of fluorescent quantitative PCR primers shown in Table 1 to detect bacteria resistant to carbapenem antibiotics.

[0033] Figure 2 The amplification curves of the aquaculture seawater samples were detected using the 6 pairs of fluorescence quantitative PCR primers shown in Table 1.

[0034] Figure 3 The amplification curves of the aquaculture sediment samples were detected using the 6 pairs of fluorescence quantitative PCR primers shown in Table 1. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0036] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0037] Example 1: Obtaining a fluorescent quantitative PCR primer combination and detecting drug resistance genes

[0038] 1. Obtaining the fluorescent quantitative PCR primer combination

[0039] The fluorescent quantitative PCR primer composition of the present invention is obtained by designing multiple pairs of fluorescent quantitative PCR primers for the beta-lactam antibiotic resistance genes blaCTX-M, blaTEM, blaCMY and blaDHA, respectively, and then screening and optimizing. The gene accession numbers of the resistance genes blaCTX-M, blaTEM, blaCMY and blaDHA are NZ_AP014630.1, NC_022885, NZ_JASUWQ010000001.1 and NC_016846.1, respectively.

[0040] The primer composition of the present invention contains primer pairs for detecting blaCTX-M, blaTEM, blaCMY and blaDHA resistance genes, respectively, and the nucleotide sequence of each primer pair is shown in Table 1. Among them, there are 3 primer pairs for detecting blaTEM resistance gene, which can be used one by one or mixed with other primer pairs.

[0041] Table 1 Primers for fluorescent quantitative PCR detection of drug resistance genes

[0042]

[0043] Note: Y is C or T / U, and R is A or G (the meaning of these characters is consistent with the electronic file standard ST.26 for nucleotide or amino acid sequence listings).

[0044] 2. Detection of drug resistance genes

[0045] Collect coastal aquaculture seawater and apply it to CHROMAGA mSuperCARBA colorimetric medium, culture at 37°C for 18 to 24 hours, pick colonies according to the instructions, and obtain bacteria resistant to carbapenem antibiotics. Carbapenem antibiotics are atypical β-lactam antibiotics with the broadest antibacterial spectrum and the strongest antibacterial activity. Carbapenem antibiotic-resistant bacteria also contain resistance genes blaCTX-M, blaTEM, blaCMY and / or blaDHA. Therefore, the present invention uses the obtained carbapenem-resistant bacteria as samples to detect the resistance genes blaCTX-M, blaTEM, blaCMY and blaDHA.

[0046] (1) Experimental methods

[0047] The DNA of bacteria resistant to carbapenem antibiotics was extracted according to the instructions of the DNA extraction kit (Shanghai Biotechnology, catalog number B518255-0100). With this as a template, fluorescent quantitative PCR amplification was performed using the primer pairs shown in Table 1, with nucleic acid-free water as a negative control and 16S rRNA as an internal reference gene (the primers used to detect the internal reference gene were: 16S rRNA F: TGCATCTGATACTGGCAAGC (SEQ ID NO. 13), 16S rRNA R: ACCTGAGCGTCAGTCTTCGT (SEQ ID NO. 14)).

[0048] The PCR amplification reaction system was as follows: template (concentration 30 ng / μL) or nuclease-free water 1 μL, 10 μM upstream primer and 10 μM downstream primer 0.4 μL each, qPCR premix (Acori Biotechnology, AG11701) 10 μL, nuclease-free water supplemented to 20 μL. A real-time fluorescence quantitative PCR instrument was used for amplification reaction, and the reaction procedure was as follows: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing / extension for 30 s, and 40 cycles.

[0049] (2) Experimental results

[0050] The amplification curves of the six pairs of fluorescent quantitative PCR primers shown in Table 1 for detecting carbapenem antibiotic-resistant bacteria are shown in FIG. Figure 1 As shown. Figure 1It can be seen that the corresponding drug resistance genes can be detected by using the 6 pairs of fluorescent quantitative PCR primers shown in Table 1, with good detection specificity and extremely high detection efficiency; among them, the Ct value of blaCMY F / R for detecting blaCMY is 31.5; the Ct value of blaTEM 1F / R for detecting blaTEM is 32.34; the Ct value of blaTEM 2F / R for detecting blaTEM is 32.42, and the Ct value of blaTEM 3F / R for detecting blaTEM is 32.82; the Ct value of blaCTX-M F / R for detecting blaCTX is 29.98; the Ct value of blaDHAF / R for detecting blaDHA is 29.69; the negative samples of nucleic acid-free water detected by the 6 pairs of primers have no CT value. At the same time, based on the test results, it can be seen that the obtained carbapenem antibiotic-resistant bacteria contain drug resistance genes blaCTX-M, blaTEM, blaCMY and blaDHA, and this sample will continue to be used for experiments such as reaction system optimization.

[0051] 3. Drug resistance gene detection kit

[0052] Based on the primer composition and the detection results described in this example, the present invention also provides a drug-resistant gene (blaCTX-M, blaTEM, blaCMY and / or blaDHA) detection kit and a method for using the kit, that is, a method for detecting the drug-resistant gene using the kit.

[0053] (1) Composition

[0054] Contains 6 pairs of fluorescence quantitative PCR primers shown in Table 1 and reagents required for fluorescence quantitative PCR reaction (such as qPCR premix).

[0055] (2) Usage

[0056] The following steps are involved:

[0057] S1. Extract bacterial DNA from the sample to be tested;

[0058] S2. Prepare a fluorescent quantitative PCR reaction system using the extracted bacterial DNA as a template, and perform detection using the primer pairs shown in Table 1;

[0059] S3. Judge the result based on the Ct value.

[0060] The judgment method for the result based on the Ct value is: if the Ct value is ≤35, the tested sample contains β-lactam antibiotic resistance genes; if the Ct value is >35, the tested sample does not contain β-lactam antibiotic resistance genes.

[0061] Example 2 Optimization of reaction system

[0062] The reaction system was optimized using the bacterial DNA extracted in Example 1 as a template, and nucleic acid-free water was used as a negative control; the reaction system and reaction procedure were the same as in Example 1, except that the primer concentration was 10 μM, 8 μM or 6 μM.

[0063] The optimization results of the reaction system are shown in Table 2. From the detection Ct values ​​of each primer at different concentrations shown in Table 2, it can be seen that the optimal concentration of the primer is 10 μM.

[0064] Table 2 Amplification results of different primer concentrations

[0065]

[0066] Example 3 Optimization of reaction procedure

[0067] 1. Optimization of annealing / extension time

[0068] The reaction system was optimized using the bacterial DNA extracted in Example 1 as a template, and nuclease-free water was used as a negative control; the reaction system and reaction procedure were similar to those in Example 1, except that the annealing / extension time in the reaction procedure was 10 s, 20 s, or 30 s.

[0069] The optimization results of annealing / extension time are shown in Table 3. From the detection Ct values ​​of each primer at different annealing / extension times shown in Table 3, it can be seen that the optimal annealing / extension time is 20s.

[0070] Table 3 Amplification results of different annealing / extension times

[0071]

[0072] 2. Optimization of annealing / extension temperature

[0073] The reaction system was optimized using the bacterial DNA extracted in Example 1 as a template, and nuclease-free water was used as a negative control; the reaction system and reaction procedure were similar to those in Example 1, except that the annealing / extension temperature in the reaction procedure was 56°C, 58°C, or 60°C.

[0074] The optimization results of the annealing / extension temperature are shown in Table 4. From the detection Ct values ​​of each primer at different annealing / extension temperatures shown in Table 4, it can be seen that the optimal temperature for annealing / extension is 58°C.

[0075] Table 4 Amplification results at different annealing / extension temperatures

[0076]

[0077] Example 4 Sensitivity Detection

[0078] The bacterial DNA extracted in Example 1 was diluted to concentrations of 20 ng / μL, 10 ng / μL and 5 ng / μL, respectively, and the diluted DNA was used as a template for sensitivity testing, and nucleic acid-free water was used as a negative control; the reaction system was referenced to Example 1, and the reaction procedure used the optimized reaction procedure.

[0079] The sensitivity test results are shown in Table 5. As shown in Table 5, when the DNA template concentration is as low as 5 ng / μL, the Ct values ​​of the six pairs of primers shown in Table 1 are still below 35, indicating that the primers and detection methods provided by the present invention have good sensitivity, and the detection sensitivity of the DNA sample is 5 ng / μL, which can efficiently amplify low concentration drug-resistant genes blaCMY, blaTEM, blaCTX-M, and blaDHA.

[0080] Table 5 Sensitivity test results

[0081]

[0082] Example 5 Detection of resistance of bacteria in environmental samples to β-lactam antibiotics

[0083] The environmental samples collected by the present invention include coastal aquaculture seawater, aquaculture tail water, sediment, medical wastewater, river water, industrial wastewater and sewage. The bacterial DNA in each environmental sample is extracted with reference to the instructions of a DNA extraction kit (Shanghai Shenggong, item number B518255-0100); the extracted sample bacterial DNA is used as a template, and the primers shown in Table 1 are used to detect it respectively, and the detection method is referred to Example 1; at the same time, nucleic acid-free water is used as a negative control, and 16S is used as an internal reference gene.

[0084] After testing, as long as the environmental sample contains bacteria resistant to β-lactam antibiotics and the bacteria contain resistance genes blaCMY, blaTEM, blaCTX-M and / or blaDHA, the primer combination of the present invention can detect them. In this embodiment, the test results of the collected aquaculture seawater (the extracted DNA concentration is 87.2 ng / μL) and aquaculture sediment samples (the extracted DNA concentration is 49.2 ng / μL) are used as examples for explanation.

[0085] The amplification curves of aquaculture seawater samples and aquaculture sediment samples are shown in Figure 2 and Figure 3 The corresponding Ct values ​​are shown in Table 6. Figure 2 , Figure 3 As shown in Table 6, the Ct values ​​of the six primer pairs shown in Table 1 were all between 15 and 35, indicating that the test results were positive.

[0086] Table 6 Test results of different environmental samples

[0087]

[0088] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A fluorescent quantitative PCR primer composition, characterized in that: Containing primer pairs 1 to 4; the nucleotide sequences of the primer pair 1 are shown as SEQ ID NOs. 1 to 2, respectively; the nucleotide sequences of the primer pair 2 are shown as SEQ ID NOs. 3 to 4, SEQ ID NOs. 5 to 6 or SEQ ID NOs. 7 to 8, respectively; the nucleotide sequences of the primer pair 3 are shown as SEQ ID NOs. 9 to 10, respectively; and the nucleotide sequences of the primer pair 4 are shown as SEQ ID NOs. 11 to 12, respectively.

2. The primer composition according to claim 1, characterized in that: Contains primers shown in SEQ ID NOs. 1-2 and SEQ ID NOs. 5-12.

3. The primer composition according to claim 1, characterized in that: Contains primers shown in SEQ ID NOs. 1 to 4 and SEQ ID NOs. 7 to 12.

4. The primer composition according to claim 1, characterized in that: Contains primers shown in SEQ ID NOs. 1 to 6 and SEQ ID NOs. 9 to 12.

5. The primer composition according to claim 1, characterized in that: Contains primers shown in SEQ ID NOs. 1 to 12.

6. A kit, characterized in that: The invention comprises the primer combination according to any one of claims 1 to 5 and reagents required for PCR fluorescence quantitative reaction.

7. The kit according to claim 6, characterized in that The reagents include reaction buffer and enzyme.

8. Use of the primer combination according to any one of claims 1 to 5 or the kit according to claim 6 or 7 in the preparation of a β-lactam antibiotic resistance gene detection product, characterized in that: The β-lactam antibiotic resistance genes include blaCMY, blaTEM, blaCTX-M and / or blaDHA.

9. Use of the primer composition according to any one of claims 1 to 5 or the kit according to claim 6 or 7 in the preparation of a product for treating bacterial resistance to β-lactam antibiotics.

10. The use according to claim 9, characterized in that: The primer combination detects the drug resistance of bacteria to beta-lactam antibiotics by detecting blaCMY, blaTEM, blaCTX-M and / or blaDHA drug resistance genes in the bacteria.

Images