Whole-cell biosensor based on transcription factor, construction and detection method and application

Abstract

The invention belongs to the technical field of bioengineering, and discloses a whole-cell biosensor based on a transcription factor, the biosensor contains a promoter T7, a transcription factor RpiR1 combined with an effector, a downstream promoter with an RpiR1 protein binding motif and a reporter protein located at the downstream of the promoter; the transcription factor RpiR1 generates conformational change in the presence of an effector and is combined with RpiR motif in a downstream promoter to enhance transcription of the promoter to a downstream reporter gene. The biosensor disclosed by the invention can respectively respond to lactic acid and acetic acid, shows good dose dependence, and has the advantages of simplicity in operation, low detection cost, high flux, high speed, high visualization degree and the like; good application prospects are shown in the fields of medicine and health, safety and quality detection of fermented food, screening of high-yield strains, dynamic control of intracellular metabolic pathways and the like.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering technology, and in particular to a whole-cell biosensor based on transcription factors, a construction and detection method and an application thereof. Background Art

[0002] Lactic acid is a metabolite produced by anaerobic glycolysis. It has two chiral isomers, L-type and D-type. It is a multifunctional organic acid with a wide range of uses in the food and beverage industry. In addition, the concentration of lactic acid can be used as an important indicator of cell metabolic activity, health status and changes in physiological functions, which helps to understand the metabolic process and pathological mechanisms in organisms. Acetic acid is not only an important chemical raw material and pharmaceutical raw material. It can also be used as one of the important markers of microbial metabolic activity and fermentation product safety and quality standards, and has important application significance in the fields of fermentation engineering and food science.

[0003] At present, the main detection methods for acidic substances are enzymatic method, electrochemical method, high performance liquid chromatography (HPLC) and ion chromatography (IC). Among them, the enzymatic method and electrochemical method involve the preparation, immobilization and use of electrodes of pure enzymes, so the production and maintenance costs are high. In addition, the reliability of the method is limited because the enzymatic reaction is inhibited by high concentrations of substrates and environmental factors such as temperature and pH. Although the chromatography method has the advantages of high sensitivity and accuracy, it has the problems of expensive equipment, cumbersome steps and low detection throughput.

[0004] Biosensors are mainly composed of two important elements: recognition elements and response elements. When the analyte enters the cell through certain permeation or flow effects, it specifically binds to the recognition element through molecular recognition, and the generated physicochemical or biological signals can be converted into fluorescence and electrical signals through the response element, thereby analyzing and detecting the analyte. According to different response mechanisms, biosensors mainly include fluorescence resonance energy transfer (FRET) sensors, riboswitch sensors, and transcription factor (TF) sensors. Whole-cell biosensors based on transcription factors are one of the most widely studied and applied biosensors. The main principle is that transcription factors become active through specific binding with effectors, and further bind or break away from the downstream promoter region regulated by them, thereby regulating the expression level of reporter proteins to achieve response characteristics and convert the concentration signal of the target metabolite into fluorescence and other signal outputs. Therefore, it has the advantages of simple operation, low detection cost, high throughput, fast speed and high visualization, and shows great application potential in the fields of medicine and health, fermentation food safety and quality detection, screening of high-yield strains, and dynamic control of intracellular metabolic pathways. At present, biosensors that can detect different acidic substances such as lactic acid or acetic acid are rarely reported. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and to provide a whole-cell biosensor based on transcription factors, a construction and detection method and an application thereof.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A whole-cell biosensor based on transcription factors, characterized in that: the biosensor contains a promoter T7, a transcription factor RpiR1 bound to an effector, a downstream promoter having an RpiR1 binding motif RpiR motif, and a reporter protein located downstream of the promoter; the transcription factor RpiR1 undergoes a conformational change in the presence of the effector and binds to the RpiRmotif, thereby enhancing the promoter's transcription of the downstream reporter gene.

[0008] Furthermore, the sequence of the gene BTW26_00630 encoding the transcription factor RpiR1 has at least 70% homology with the DNA sequence defined by SEQ ID NO.1 and encodes a DNA sequence with the same functional protein; that is, the protein encoded by the sequence undergoes a conformational change in the presence of an effector and enhances the transcription of the downstream reporter gene after binding to the RpiR motif in the downstream promoter.

[0009] Furthermore, the transcription factor RpiR1 has at least 70% homology with the amino acid sequence defined by SEQ ID NO.2 and is a derivative protein having the same function as SEQ ID NO.2; that is, the derivative protein undergoes conformational changes in the presence of an effector and enhances the transcription of a downstream reporter gene after binding to the RpiR motif in a downstream promoter.

[0010] Furthermore, the transcription factor RpiR1 is obtained by electrophoresis and recovery after PCR or encoding gene synthesis.

[0011] Furthermore, the downstream promoter needs to contain the transcription factor RpiR1 binding motif RpiR motif and have the same function, that is, the transcription activity of the downstream promoter containing the RpiR motif is enhanced after binding to the transcription factor RpiR1 that undergoes conformational changes in the presence of the effector; wherein the -35 region sequence of the RpiR motif is TGAA or GGAA, and the -10 region sequence is TTCA or TTCC.

[0012] Furthermore, the reporter protein is capable of emitting and detecting a fluorescent signal;

[0013] The method for constructing the biosensor as described above comprises the following steps:

[0014] The T7 promoter, transcription factor RpiR1 gene BTW26_00630, downstream promoter with RpiR motif and reporter protein gene sequence located downstream of the promoter were cloned into the plasmid vector pET28a to form an expression vector. The T7 promoter controlling the expression of the transcription factor and the downstream promoter controlling the expression of the reporter protein mCherry were in opposite directions. The expression vector verified by sequencing was then transformed into the host cell to construct a whole-cell biosensor.

[0015] The biosensor host cell as described above is E. coli.

[0016] A method for detecting acidic substances using the above-mentioned biosensor comprises the following steps:

[0017] (1) incubating samples containing acidic substances of different concentrations with the biosensor, and detecting the intensity of the fluorescence signal of the reporter protein after the incubation is completed;

[0018] (2) Establishing a relationship curve between the reporter gene and the target concentration;

[0019] (3) Replace the sample with the sample to be tested and repeat (1), then substitute it into the relationship curve in (2) to calculate the target substance content.

[0020] Furthermore, the detectable acidic substances include L-lactic acid, D-lactic acid, and acetic acid.

[0021] The advantages and positive effects achieved by the present invention are:

[0022] 1. The present invention provides a whole-cell biosensor based on transcription factors. Compared with existing detection methods, it has the advantages of simple operation, low detection cost, high throughput, fast speed and high visualization.

[0023] 2. The whole-cell biosensor based on transcription factors provided by the present invention can respond to different acidic substances such as lactic acid and acetic acid, and shows good dose dependence. The sensor has good application prospects in the fields of medicine and health, fermentation food safety and quality assessment, screening of high-yield strains, and dynamic control of intracellular metabolic pathways.

[0024] 3. The whole-cell biosensor based on transcription factors provided by the present invention can produce similar responses to mixtures of different configurations of lactic acid (D-lactic acid and L-lactic acid) in different proportions, indicating that it exhibits good broad spectrum in lactic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : The binding of transcription factor RpiR1 to the downstream promoter; wherein the gene name represents that the DNA probe is the promoter region of the gene;

[0026] Figure 2 : Working principle of the whole-cell biosensor based on the transcription factor RpiR1; the solid arrows represent the protein encoded by the gene, and the dotted arrows represent the binding and activation process of the protein in the cell;

[0027] Figure 3 : Schematic diagram of the structure of the recombinant plasmid of the whole-cell biosensor based on the transcription factor RpiR1;

[0028] Figure 4 :Response of whole-cell biosensor based on transcription factor RpiR1 to lactate at different detection times;

[0029] Figure 5 : Response of whole-cell biosensor based on transcription factor RpiR1 to L-lactate, D-lactate and acetic acid;

[0030] Figure 6 : Response of a whole-cell biosensor based on the transcription factor RpiR1 to a mixture of L-lactate and D-lactate. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0032] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0033] A whole-cell biosensor based on transcription factors, characterized in that: the biosensor contains a promoter T7, a transcription factor RpiR1 bound to an effector, a downstream promoter having an RpiR1 binding motif RpiR motif, and a reporter protein located downstream of the promoter; the transcription factor RpiR1 undergoes a conformational change in the presence of the effector and binds to the RpiRmotif, thereby enhancing the promoter's transcription of the downstream reporter gene. Preferably, the sequence of the transcription factor RpiR1 encoding gene BTW26_00630 has at least 70% homology with the DNA sequence defined by SEQ ID NO.1 and encodes a DNA sequence with the same functional protein; that is, the protein encoded by the sequence undergoes a conformational change in the presence of the effector and binds to the RpiR motif in the downstream promoter to enhance the transcription of the downstream reporter gene.

[0034] Preferably, the transcription factor RpiR1 has at least 70% homology with the amino acid sequence defined by SEQ ID NO.2 and is a derivative protein having the same function as SEQ ID NO.2; that is, the derivative protein undergoes conformational changes in the presence of an effector and enhances the transcription of a downstream reporter gene after binding to the RpiR motif in a downstream promoter.

[0035] Furthermore, the transcription factor RpiR1 is obtained by electrophoresis and recovery after PCR or encoding gene synthesis.

[0036] Preferably, the downstream promoter needs to contain the transcription factor RpiR1 binding motif RpiR motif and have the same function, that is, the transcription activity of the downstream promoter containing the RpiR motif is enhanced after binding to the transcription factor RpiR1 that undergoes conformational changes in the presence of the effector; wherein the -35 region sequence of the RpiR motif is TGAA or GGAA, and the -10 region sequence is TTCA or TTCC.

[0037] Preferably, the reporter protein is capable of emitting and detecting a fluorescent signal;

[0038] The method for constructing the biosensor as described above comprises the following steps:

[0039] The T7 promoter, the transcription factor RpiR1 gene BTW26_00630, the downstream promoter with the RpiR motif, and the reporter protein gene sequence located downstream of the promoter were cloned into the plasmid vector pET28a to form an expression vector. The T7 promoter controlling the expression of the transcription factor and the downstream promoter controlling the expression of the reporter protein mCherry were in opposite directions. Then, the expression vector verified by sequencing was transformed into the host cell to construct a whole-cell biosensor.

[0040] Preferably, the host cell is Escherichia coli.

[0041] A method for detecting acidic substances using the above-mentioned biosensor comprises the following steps:

[0042] (1) incubating samples containing acidic substances of different concentrations with the biosensor, and detecting the intensity of the fluorescence signal of the reporter protein after the incubation is completed;

[0043] (2) Establishing a relationship curve between the reporter gene and the target concentration;

[0044] (3) Replace the sample with the sample to be tested and repeat (1), then substitute it into the relationship curve in (2) to calculate the target substance content.

[0045] Preferably, the detectable acidic substances include L-lactic acid, D-lactic acid, and acetic acid.

[0046] Specifically, the relevant preparation and detection are as follows:

[0047] The scheme involved in the present invention is as follows:

[0048] The difficulty in constructing biosensors by using transcription factors is the mining and identification of transcription factors. The present invention identified the acid-responsive transcription factor RpiR1 in Pediococcus acidilactici CGMCC 17856, and preferably the promoter P regulated by it. glnA , followed by the design of the biosensor, and finally the dose response curve of the biosensor is obtained by exogenously adding concentration gradient analytes.

[0049] Example 1 Identification of downstream promoters of transcription factor RpiR1

[0050] The downstream promoter regulated by the transcription factor RpiR1 of the present invention is derived from Pediococcus acidilactici CGMCC 17856. Based on the binding motifs (RpiR motifs) of RpiR family transcription factors reported in the literature, downstream promoters P that may be directly regulated by RpiR1 were searched. glnA (The sequence is SEQ ID NO.3); the binding effect of transcription factor RpiR1 and potential downstream promoter region was analyzed by protein in vitro purification and electrophoretic mobility shift assay (EMSA).

[0051] Based on the binding motifs of RpiR family transcription factors reported in the literature, the downstream promoter regions that may be directly regulated by RpiR1 were searched; under the action of high-fidelity enzyme, the genome of Pediococcus acidilactici CGMCC 17856 was used as a template, PCR amplification was performed with primers F-0 / R-0 and the product was recovered to obtain a biotin-labeled DNA probe; the transcription factor RpiR1 was purified by nickel column affinity chromatography.

[0052] The binding of the probe to the transcription factor RpiR1 was analyzed using a chemiluminescent EMSA kit (Biotime, China). The specific method is as follows:

[0053] 1. Add Nuclease-Free Water, EMSA / Gel-Shift Binding Buffer (5X) and purified transcription factor RpiR1, mix well and incubate at room temperature for 10 minutes.

[0054] 2. Add the probe and different concentrations of lactic acid (final concentration 130 μM and 390 μM), mix well and incubate at room temperature for 20 min.

[0055] 3. Add EMSA / Gel-Shift loading buffer, mix well and add to the loading well of EMSA gel, and perform electrophoresis at 100V for 2h.

[0056] 4. After electrophoresis, transfer the membrane using the conventional wet transfer method at 380 mA for 60 minutes.

[0057] 5. After the transfer is completed, use ultraviolet light in the clean bench to irradiate for 15 minutes for cross-linking.

[0058] 6. Block and wash the membrane according to the instructions and take photos using a chemiluminescence imager.

[0059] The experimental results showed that RpiR1 did not have a specific binding effect on promoter DNA without the addition of lactic acid. However, when an appropriate amount of lactic acid was added to the EMSA system and co-incubated with transcription factor RpiR1 and promoter DNA, transcription factor RpiR1 and P glnA Specific binding was produced, and the binding effect was enhanced with the increase of lactic acid addition (130-390μM) ( Figure 1 ). Thus, the downstream promoter P directly regulated by the transcription factor RpiR1 was identified. glnA .

[0060] Primer sequence (5'-3'):

[0061] F-0: Biotin-AAATTGGTTCGACATTATTCAAAAC

[0062] R-0: AACCGTAACCGGTAGCCCCGT

[0063] Example 2 Biosensor Design and Construction

[0064] Based on the results obtained in Example 1, a whole-cell biosensor based on the transcription factor RpiR1 was designed. The specific principle is as follows Figure 2 shown.

[0065] Under the action of high-fidelity enzyme, pET-28a(+) plasmid was used as a template and primers F-1 / R-1 were used for reverse amplification to obtain linearized pET-28a(+) plasmid; the genome of Pediococcus acidilactici CGMCC 17856 was used as a template and the transcription factor RpiR1 was amplified with primers F-2 / R-2, and the downstream promoter P was amplified with primers F-3 / R-3. glnA; Using the mCherry protein gene as a template, the mCherry protein gene was amplified using primers F-4 / R-4; finally, the fragments were assembled using the one-step cloning kit ClonExpress Ultra OneStep Cloning Kit (Vazyme, China) and introduced into E. coli BL21 competent cells according to the conventional E. coli heat shock transformation method, in which the promoter T7 controlled the expression of the RpiR1 encoding gene, and the downstream promoter P glnA Control the expression of mChenrry encoding gene, promoter T7 and downstream promoter P glnA Opposite direction ( Figure 3 ), and after preliminary screening and verification, the company sequenced and confirmed that the positive transformant was the biosensor BS1.

[0066] Primer sequence (5'-3'):

[0067] F-1:CTGAAAGGAGGAACTATATCCGGA

[0068] R-1:ATTTCGCGGGATCGAGATCT

[0069] F-2:AGATCTCGATCCCGCGAAATTTAGAAATTGCTTTTTAATAATCCTGCG

[0070] R-2:GAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAAAAGTGTTGTATTTAC

[0071] F-3:GAATTGTTATCCGCTCACAATTCCCCTATAGTGAGTCGTATTACGTACCACTAGTTCTAGAAATTGGTTCGACATTATTC

[0072] R-3:CCCTTGCTCACCATGGTACCGCCTCCTTAACCGTAAC

[0073] F-4:TAAGGAGGCGGTACCATGGTGAGCAAGGGC

[0074] R-4:TAGTTCCTCCTTTCAGTCACTTGTACAGCTC

[0075] Example 3

[0076] Detection of the biosensor's response to lactic acid:

[0077] The response of the biosensor BS1 obtained in Example 2 to lactic acid was detected. The specific method is as follows: the biosensor BS1 bacterial solution stored in the glycerol tube was inoculated with 1% inoculum into 5 ml of LB liquid culture medium containing 50 μg / ml kanamycin, and cultured at 37°C, 200 rpm for 12 hours. At this time, the OD 600 The above culture solution was transferred to a fresh 250ml Erlenmeyer flask containing 50ml LB liquid medium at a 1% inoculum volume, and IPTG was added at a final concentration of 0.1mM. The culture was shaken at 37°C and 220rpm for 4 hours. At this time, the OD 600 Transfer 150 μL of culture solution to a 96-well plate (127×85×40 mm), mix thoroughly with fresh LB liquid medium containing different concentrations of lactic acid at a volume ratio of 1:1, culture at 37°C and 220 rpm, and pipette 150 μL to a 96-well plate (127×85×16 mm) at 1, 2, 3, and 4 h, respectively, and measure the bacterial OD using a multifunctional microplate reader. 600 And fluorescence intensity (excitation wavelength 585nm, emission wavelength 615nm), the relative fluorescence intensity was calculated.

[0078] Depend on Figure 4 It can be seen that the relative fluorescence intensity of the biosensor BS1 will not change significantly when lactic acid is not added. When different concentrations of lactic acid (0.5-2.0 g / L) are added and the culture time is 1 h and 2 h, the relative fluorescence intensity shows a gradient upward trend with the increase of lactic acid concentration, and the linear relationship between the relative fluorescence intensity and the lactic acid concentration is the best when the culture time is 2 h. If the culture time is further extended, the relative fluorescence intensity no longer has a linear relationship with the lactic acid concentration ( Figure 4 ).

[0079] Example 4

[0080] Detection of the response effect of biosensor to L-lactic acid, D-lactic acid and acetic acid:

[0081] According to the method established in Example 3, the response of the biosensor BS1 obtained in Example 2 to 0.0-2.0 g / L L-lactic acid, D-lactic acid and acetic acid was tested. The specific method is: the biosensor BS1 bacterial solution stored in the glycerol tube was inoculated with 1% inoculum into 5 ml of LB liquid culture medium containing 50 μg / ml kanamycin, and cultured at 37°C, 200 rpm for 12 hours. At this time, the OD 600 The above culture solution was transferred to a fresh 250ml Erlenmeyer flask containing 50ml LB liquid medium at a 1% inoculum volume, and IPTG was added at a final concentration of 0.1mM. The culture was shaken at 37°C and 220rpm for 4 hours. At this time, the OD 600Transfer 150 μL of culture solution to a 96-well plate (127×85×40 mm), mix thoroughly with fresh LB liquid medium containing different concentrations of L-lactic acid, D-lactic acid and acetic acid at a volume ratio of 1:1, culture at 37°C, 220 rpm for 2 h, pipette 150 μL to a 96-well plate (127×85×16 mm), and measure the bacterial OD using a multifunctional microplate reader. 600 And fluorescence intensity (excitation wavelength 585nm, emission wavelength 615nm), the relative fluorescence intensity was calculated.

[0082] Depend on Figure 5 It can be seen that the biosensor BS1 has a certain response to L-lactic acid, D-lactic acid and acetic acid, and the concentration of acidic substances in the range of 0.5-2.0g / L is positively correlated with the relative fluorescence intensity.

[0083] Example 5

[0084] Detection of the biosensor's response to L-lactic acid and D-lactic acid mixed in different proportions:

[0085] Further, according to the detection method established in Example 3, the response of the biosensor BS1 obtained in Example 2 to L-lactic acid and D-lactic acid (total concentration of 2.0 g / L) mixed in different volume ratios was evaluated. The specific method is: the biosensor BS1 bacterial solution stored in the glycerol tube was inoculated with 1% inoculum into 5 ml of LB liquid culture medium containing 50 μg / ml kanamycin, and cultured at 37°C, 200 rpm for 12 hours. At this time, the OD 600 The above culture solution was transferred to a fresh 250ml Erlenmeyer flask containing 50ml LB liquid medium at a 1% inoculum volume, and IPTG was added at a final concentration of 0.1mM. The culture was shaken at 37°C and 220rpm for 4 hours. At this time, the OD 600 Transfer 150 μL of the culture solution to a 96-well plate (127×85×40 mm), mix thoroughly with fresh LB liquid medium containing L-lactic acid and D-lactic acid (total concentration of 2.0 g / L) mixed in different volume ratios at a volume ratio of 1:1, culture at 37°C, 220 rpm, and shake for 2 h. Pipette 150 μL to a 96-well plate (127×85×16 mm), and measure the bacterial OD using a multifunctional microplate reader. 600 And fluorescence intensity (excitation wavelength 585nm, emission wavelength 615nm), the relative fluorescence intensity was calculated.

[0086] Depend on Figure 6 It can be seen that the response of biosensor BS1 is not affected by the ratio between L-lactic acid and D-lactic acid, indicating that it has a broad-spectrum detection capability.

[0087] The above examples show that based on the transcription factor RpiR1, the promoter T7, the downstream promoter P glnA The biosensor with mCherry as the basic element can couple the concentration of lactic acid or acetic acid with the fluorescent signal, making the concentration of the analyte visible. It can be used in the fields of medicine and health, fermentation food safety and quality testing, screening of high-yield strains, dynamic control of intracellular metabolic pathways and other research or application fields.

[0088] The sequence of the present invention is as follows:

[0089] SEQ ID NO.1 (DNA sequence of gene BTW26_00630 encoding transcription factor RpiR1)

[0090] ATGAAAAGTG TTGTATTTAC CTTGAAAAAT CAGTTGGGTG ATTTTACCAA

[0091] AAAGGAAAAG CAGGTTGCCC GCTTTATCAT TAAGTATCCG CAAGCGGTAA

[0092] TTGATTCCAA TGCCAAACAG GTTGCTGATC AAGTGGGAAC GAGCGCTGCA

[0093] ACGGTAATTC GCTTAGCCAA ACGAGTTTGT AAAAACGGGT TACCCGAGCT

[0094] GAAAGAACGC CTGAAAAACG AAACGATGGT TAACGACAAG TTCTTTGAAG

[0095] AAATCGATCC GGCAGATACG CTCGAAGTGA TGAAACAAAA GATGGAATAC

[0096] CGGATTAACC ACACCATCGA GCAAACCAAT CGAACGGTTA AGGGCGGCGC

[0097] AGTCCGGAAT GCAGCCAAAC TGGTGGATCA AGCCGACGTG GTTTACACTT

[0098] TTGGGATGGG TGCGTCCCAT TTAGTAGCGG ATGATTTGCA ACAGAAGTTC

[0099] GTGCGGCTGG GGAAACCAGT CGCCCAAACC CAAGACGTAC ACCTGTTGGC

[0100] AGCGGGGATG TCCAAAGGCC GTGGGGTGGT CGTGCTGATC TCTAACTCGG

[0101] GAGAAACTAA AGAGACATTA CAATTACTAA GTGCAGCCCG GGCGTTAGATT

[0102] TGCCCGTAGT GGCGATTACC CGGGTATTGA GCAGTCCCCT GGCCCGACAA

[0103] AGCACGGTGG TCCTTGCCCA TAGTGATAGC GGGGAAGGTA ACCAACTGCG

[0104] AAGCGCGGCG ACGACCTCGC TAATGGCCCA ACTGTACGTG GTTGATCTAC

[0105] TCTACTACTC CTTTTTAAAA TTACATTTTG AAGATAACGT AGATCAGTTG

[0106] ACGAAGTCTC GCAGGATTTAAAAGCAAT TTCTAASEQ ID NO.2

[0107] Met Lys Ser Val Val Phe Thr Leu Lys Asn Gln Leu Gly Asp Phe Thr LysLys Glu Lys Gln Val Ala

[0108] Arg Phe Ile Ile Lys Tyr Pro Gln Ala Val Ile Asp Ser Asn Ala Lys GlnVal AlaAsp Gln Val Gly Thr

[0109] Ser Ala Ala Thr Val Ile Arg Leu Ala Lys Arg Val Cys Lys Asn Gly LeuPro Glu Leu Lys Glu Arg

[0110] Leu Lys Asn Glu Thr Met Val Asn Asp Lys Phe Phe Glu Glu Ile Asp ProAla Asp Thr Leu Glu Val

[0111] Met Lys Gln Lys Met Glu Tyr Arg Ile Asn His Thr Ile Glu Gln Thr AsnArg Thr Val Lys Gly Gly

[0112] Ala Val Arg Asn Ala Ala Lys Leu Val Asp Gln Ala Asp Val Val Tyr ThrPhe Gly Met Gly Ala Ser

[0113] His Leu Val AlaAsp Asp Leu Gln Gln Lys Phe Val Arg Leu Gly Lys ProVal Ala Gln Thr Gln Asp

[0114] Val His Leu LeuAlaAla Gly Met Ser Lys GlyArg Gly Val Val Val Leu IleSerAsn Ser Gly Glu Thr

[0115] Lys Glu Thr Leu Gln Leu Leu Ser Ala Ala Arg Ala Leu Asp Leu Pro ValVal Ala Ile Thr Arg Val

[0116] Leu Ser Ser Pro Leu Ala Arg Gln Ser Thr Val Val Leu Ala His Ser AspSer Gly Glu Gly Asn Gln

[0117] Leu Arg Ser Ala Ala Thr Thr Ser Leu Met Ala Gln Leu Tyr Val Val AspLeu Leu Tyr Tyr Ser PheLeu Lys Leu His Phe GluAspAsn ValAsp Gln Leu Thr LysSerArgArg Ile Ile Lys SerAsn Phe*SEQ ID NO.3 (downstream promoter P glnA DNA sequence)

[0118] AAATTGGTTC GACATTATTCAAAACCCAAATGAAAAACAAATAATTAATC

[0119] AAGAAATTGAGGAGTGGTTAGTAAAATGAAGAGTTGGAAAGACCAATATA

[0120] AACCGGAAGTACAAAAATTAATTACCGAAG TTGAACAACAAATTCAGCCT

[0121] AAATTAAATGAAATTGATGATCAAGTGACT TACAATCAGCAAAAAGTTTT

[0122] GAACGCTTTT CAAAAAGAAC GGGTTGCTGAGGAGAATTTAAACGGGGCTA

[0123] CCGGTTACGG TTAAGGAGG

[0124] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A whole-cell biosensor based on transcription factors, characterized in that: The biosensor contains promoter T7, transcription factor RpiR1 bound to effector, downstream promoter with RpiR1 binding motif RpiR motif and reporter protein located downstream of the promoter; the transcription factor RpiR1 undergoes conformational changes in the presence of effector and binds to RpiRmotif, thereby enhancing the transcription of downstream reporter gene by the promoter.

2. The biosensor according to claim 1, characterized in that: The sequence of the gene BTW26_00630 encoding the transcription factor RpiR1 has at least 70% homology with the DNA sequence defined by SEQ ID NO.1 and encodes a DNA sequence with the same functional protein; that is, the protein encoded by the sequence undergoes conformational changes in the presence of an effector and enhances the transcription of a downstream reporter gene after binding to the RpiR motif in the downstream promoter.

3. The biosensor according to claim 1, characterized in that: The transcription factor RpiR1 has at least 70% homology with the amino acid sequence defined by SEQ ID NO.2 and is a derivative protein with the same function as SEQ ID NO.2; that is, the derivative protein undergoes conformational changes in the presence of an effector and enhances the transcription of a downstream reporter gene after binding to the RpiRmotif in a downstream promoter.

4. The biosensor according to claim 1, characterized in that: The transcription factor RpiR1 is obtained by electrophoresis and recovery after PCR or by encoding gene synthesis.

5. The biosensor according to claim 1, characterized in that: The downstream promoter needs to contain the transcription factor RpiR1 binding motif RpiR motif and have the same function, that is, the transcription activity of the downstream promoter containing the RpiR motif is enhanced after binding to the transcription factor RpiR1 that undergoes conformational changes in the presence of the effector; wherein the -35 region sequence of the RpiR motif is TGAA or GGAA, and the -10 region sequence is TTCA or TTCC.

6. The biosensor according to any one of claims 1 to 5, characterized in that: The reporter protein is capable of emitting and detecting a fluorescent signal.

7. The method for constructing a biosensor according to any one of claims 1 to 5, characterized in that: The steps include: The T7 promoter, transcription factor RpiR1 gene BTW26_00630, downstream promoter with RpiR motif and reporter protein gene sequence located downstream of the promoter were cloned into the plasmid vector pET28a to construct an expression vector. The T7 promoter controlling the expression of the transcription factor and the downstream promoter controlling the expression of the reporter protein mCherry were in opposite directions. The expression vector verified by sequencing was then transformed into the host cell to construct a whole-cell biosensor.

8. The method according to claim 7, characterized in that: The host cell is Escherichia coli.

9. A method for detecting acidic substances using the biosensor according to any one of claims 1 to 8, characterized in that: The steps include: (1) incubating samples containing acidic substances of different concentrations with the biosensor, and detecting the intensity of the fluorescence signal of the reporter protein after the incubation is completed; (2) Establishing a relationship curve between the reporter gene and the target concentration; (3) Replace the sample with the sample to be tested and repeat (1), then substitute it into the relationship curve in (2) to calculate the target substance content.

10. The method according to claim 9, characterized in that: The detectable acidic substances include L-lactic acid, D-lactic acid and acetic acid.

Images