KASP molecular marker related to aroma character caryophyllene of non-heading Chinese cabbage as well as primer and application of KASP molecular marker

Abstract

The invention discloses a molecular marker and method for detecting KASP closely related to caryophyllene of the aroma character of non-heading Chinese cabbage, the molecular marker is designed according to the content of caryophyllene and F2 genetic population, the SNP site is A06 chromosome A06-37805032 and is named as YN beta c, and the nucleotide sequence of the YN beta c is shown as SEQ ID NO.1. The invention further discloses a method for detecting the KASP closely related to the caryophyllene of the aroma character of the non-heading Chinese cabbage. The KASP labeled primer comprises two forward specific primers and one reverse universal primer. Genetic typing is carried out according to the KASP marker provided by the invention, enzyme digestion and electrophoresis are not needed after PCR amplification, a plurality of samples can be detected at high throughput, the distribution condition of the Bc betac allele in the segregation population of the non-heading Chinese cabbage can be rapidly detected, the result accuracy is good, and compared with a conventional molecular marker, the KASP marker has the advantages of quickness, simplicity, convenience, lower cost and the like. The molecular marker has important significance for molecular marker-assisted selective breeding of the non-heading Chinese cabbage caryophyllene.

Description

Technical Field

[0001] The invention relates to the technical field of non-heading cabbage breeding, and in particular to a KASP molecular marker tightly linked to caryophyllene, an aroma trait of the non-heading cabbage, and a primer and application thereof. Background Art

[0002] Non-heading cabbage is a common green leafy vegetable in my country. It has a long history of cultivation in China and has rich germplasm resources. It is widely cultivated in my country. With the continuous improvement of people's living standards, the requirements for the appearance and quality of vegetables are also constantly improving. Non-heading cabbage with special flavor has certain market value and nutritional value.

[0003] Aroma is one of the important traits in the current breeding of non-heading cabbage. Aroma is mainly affected by various volatiles. Caryophyllene is a special volatile sesquiterpenoid in the non-heading cabbage variety of Brassica rapa. Traditional breeding and variety identification methods are time-consuming and labor-intensive. With the development of sequencing technology and molecular biology technology, breeding technology based on molecular marker-assisted selection has gradually developed. Through the close linkage characteristics of the presence or absence of caryophyllene and molecular markers, it is possible to determine whether non-heading cabbage contains caryophyllene by detecting linked molecular markers during the seed period, thereby accelerating the breeding progress of caryophyllene traits in non-heading cabbage and shortening the breeding period. It can also be used as one of the methods for identifying aroma traits of different varieties of non-heading cabbage on the market. Summary of the invention

[0004] The invention provides a KASP molecular marker for detecting caryophyllene related to non-heading Chinese cabbage, a primer and an application thereof, and its main purpose is to provide a molecular marker, reduce the cost of molecular marker-assisted selection for the presence of caryophyllene in a large number of samples, and improve breeding efficiency.

[0005] The technical solution of the present invention is as follows:

[0006] The first object of the present invention is to provide a KASP molecular marker tightly linked to caryophyllene in non-heading cabbage, wherein the molecular marker is located on chromosome 6 of non-heading cabbage and is named YNβc. The nucleotide sequence of YNβc is shown in SEQ ID NO.1:

[0007] TCTCTGCCCCAAACATTTCTTGGTTCAAGTGTCGCCTCTCACCATTTCAGTTTTGTTTTCATTAAAAAATCATTTTTATTAGTTATAACAAACTGTTTATTTCCAATTTCCTTCCTATATGAGTGCTTCACGTATCTATAACAGAGAATTGAAGGCATTTTTTCTTTCCATAGTTTTTTATTTACAGAGATTGTTCAATAAAATTTTATATACTTTTCAGTTGGTTAATTATTTTTAGAGTATAATTAGTTTTTTTTAATTATTTCTCCATTACATTTGTGTGTTTACATTATTTTGGTTG, wherein a G→T mutation occurs at the 151 bp position, and base T is unique to non-heading cabbage materials that do not contain caryophyllene.

[0008] The second object of the present invention is to provide a primer pair for detecting the aforementioned KASP molecular marker tightly linked to caryophyllene in non-heading Chinese cabbage.

[0009] Further, the primer pair includes an upstream primer YNβc-F of a non-heading Chinese cabbage allele containing caryophyllene, an upstream primer YNβc-H of a non-heading Chinese cabbage allele not containing caryophyllene, and a common downstream primer YNβc-C.

[0010] In a specific embodiment, the non-heading cabbage variety containing caryophyllene is Brassica chinensis;

[0011] In a specific embodiment, the non-heading cabbage variety that does not contain caryophyllene is Suzhou Green;

[0012] The sequence of YNβc-F is shown in SEQ ID NO.2:

[0013] 5'-FAM- GAAGGTGACCAAGTTCAT GCTGCTTCACGTATCTATAACAGAGAATTG-3';

[0014] The sequence of YNβc-H is shown in SEQ ID NO.3:

[0015] 5'-HEX- GAAGGTCGGAGTCAACGGATT GCTTCACGTATCTATAACAGAGAATTT-3';

[0016] The YNβc-C sequence is shown in SEQ ID NO.4:

[0017] 5'-AAAACTATGGAAAGAAAAAATGCCT-3'.

[0018] The 5' end of the YNβc-F is a FAM fluorescent signal tag, and the FAM tag sequence is: 5'-FAM-GAAGGTGACCAAGTTCATGCT-3';

[0019] The 5' end of the YNβc-H is a HEX fluorescent signal tag, and the sequence of the HEX fluorescent signal tag is 5'-HEX-GAAGGTCGGAGTCAACGGATT-3'.

[0020] The third object of the present invention is to provide a kit comprising the aforementioned primer pair.

[0021] A fourth object of the present invention is to provide a method for identifying whether non-heading Chinese cabbage contains caryophyllene, the method comprising the following steps:

[0022] (1) extracting the total genomic DNA of the non-heading cabbage to be tested;

[0023] (2) using the above primers to perform PCR amplification on the total genomic DNA of the non-heading cabbage to be tested;

[0024] (3) Performing genotyping detection on the amplified product, and determining whether the sample material contains caryophyllene based on the genotyping result.

[0025] Furthermore, the reaction system of the PCR amplification in step (2) is: the total system of PCR amplification is 10 μl, including 2×KASP Master mix 5 μl, KASP Primer mix 0.14 μl, template DNA 1.0 μl, ddH2O 3.86 μl;

[0026] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 60 s, 10 cycles, with the temperature decreasing by 0.6°C each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 60 s, 26 cycles.

[0027] Furthermore, the genotyping method in step (3) is to determine the genotype of the molecular marker according to the type of the fluorescent signal, and then determine whether the sample material contains caryophyllene;

[0028] When the non-heading cabbage to be tested includes the allele type connected to the HEX fluorescent label sequence obtained based on the YNβc-H amplification, the non-heading cabbage to be tested does not contain caryophyllene;

[0029] When the non-heading cabbage to be tested includes the allele type connected to the FAM fluorescent label sequence obtained by amplification based on YNβc-F or is a heterozygous type, the non-heading cabbage to be tested contains caryophyllene.

[0030] Furthermore, the method of genotyping in step (3) is as follows: after the PCR amplification reaction is completed, the PCR product is detected by an enzyme reader, and the data is imported into the KlusterCaller data processing software for analysis, and cluster analysis is performed. The genotype of the samples clustered close to the X-axis is the allele type of the FAM fluorescent label sequence connected based on the amplification of YNβc-F, and the genotype of the samples clustered close to the Y-axis is the allele type of the HEX fluorescent label sequence connected based on the amplification of YNβc-H, and the genotype of the intermediate sample is a heterozygous type.

[0031] The fifth object of the present invention is to provide the use of the aforementioned KASP molecular marker tightly linked to caryophyllene in non-heading cabbage, or the aforementioned primer pair, or the aforementioned kit in identifying whether non-heading cabbage contains caryophyllene.

[0032] The sixth object of the present invention is to provide the use of the aforementioned KASP molecular marker tightly linked to caryophyllene in non-heading cabbage, or the aforementioned primer pair, or the aforementioned kit in molecular marker-assisted breeding of non-heading cabbage.

[0033] The beneficial effects of the present invention are:

[0034] The invention provides a KASP molecular marker that can accurately identify the presence or absence of caryophyllene in non-heading cabbage, which can be used for flavor-related molecular breeding and germplasm resource analysis of non-heading cabbage. The molecular marker developed by the invention is used to detect the presence or absence of caryophyllene in non-heading cabbage. Genotyping is performed according to the Bcβc-KASP marker provided by the invention. After PCR amplification, no enzyme cutting and electrophoresis are required, and multiple samples can be detected with high throughput, which greatly improves the detection efficiency. It can be used to predict the presence or absence of caryophyllene in a large number of non-heading cabbage varieties at the seed stage. Compared with conventional breeding, the shorter the breeding time, the more accurate the identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The results of Bcβc genotyping of 21 individuals in the F2 population using the Bcβc-KASP marker. Each dot in the figure represents a sample; red triangles indicate that the gene carries a HEX tag sequence (a total of 9); blue triangles indicate that the gene carries a FAM tag sequence (a total of 4); green triangles indicate heterozygous sequences (a total of 11); and black squares are blank controls (NTC). DETAILED DESCRIPTION

[0036] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0037] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0038] The primers were prepared by Jisi Huiyuan Co., Ltd. The non-heading cabbage varieties used in the following examples were all from the Cabbage Systems Biology Laboratory of the College of Horticulture, Nanjing Agricultural University.

[0039] Example 1

[0040] 1. Non-heading cabbage materials

[0041] The materials used in this example are a caryophyllene-containing variety of fragrant green 'XQC' and a caryophyllene-free variety of Suzhou green 'SZQ'. They are derived from an F2 population constructed with 'XQC' and 'SZQ' as parents. The test materials were planted at the Baima Base of Nanjing Agricultural University.

[0042] 2. DNA Extraction from Non-heading Cabbage Leaves

[0043] The leaves of non-heading cabbage were collected at 2 months old, 100 mg of leaves were added to liquid nitrogen and fully ground, and the ground powder was used for DNA extraction using the plant genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. The DNA concentration was measured using the Nanodrop 2000 spectrophotometer of Thermo Fisher Scientific, and the DNA concentration was adjusted to 40 ng / μL.

[0044] 3. KASP molecular marker design

[0045] A KASP molecular marker YNβc was designed based on a SNP site with good polymorphism. The molecular marker was located on chromosome 6 of non-heading Chinese cabbage. The nucleotide sequence of YNβc was shown in SEQ ID NO.1, wherein a G→T mutation occurred at the 151 bp position, and the base T was specific to non-heading Chinese cabbage materials that did not contain caryophyllene.

[0046] According to the upstream and downstream sequences of the SNP site, a reverse universal primer, reverse primer YNβc-C, and two allele-specific primers, forward primer YNβc-F: and forward primer YNβc-H:, were designed. The primer sequences are as follows.

[0047] The sequence of YNβc-F is shown in SEQ ID NO.2:

[0048] 5'-FAM- GAAGGTGACCAAGTTCAT GCTGCTTCACGTATCTATAACAGAGAATTG-3';

[0049] The sequence of YNβc-H is shown in SEQ ID NO.3:

[0050] 5'-HEX- GAAGGTCGGAGTCAACGGATT GCTTCACGTATCTATAACAGAGAATTT-3';

[0051] The YNβc-C sequence is shown in SEQ ID NO.4:

[0052] 5'-AAAACTATGGAAAGAAAAAATGCCT-3'.

[0053] The underlined sequences in the forward primer YNβc-F and the forward primer YNβc-H correspond to the FAM and HEX fluorescent label sequences, respectively.

[0054] PCR amplification reaction and KASP genotyping were performed by Jisi Huiyuan Biotechnology Co., Ltd.

[0055] 4. Implementation of KASP Molecular Marker YNβc

[0056] (1) PCR amplification reaction

[0057] The extracted DNA was added into full-skirt 96-well plates respectively, and the reaction system was prepared for PCR amplification reaction.

[0058] PCR reaction system: The total volume of the reaction system is 10 μL, including 2×KASP Master mix 5 μL, KASP Primer mix 0.14 μL, template DNA 1 μL, and ddH2O 3.86 μL.

[0059] PCR reaction program: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 60 s, 10 cycles (0.6°C reduction per cycle); denaturation at 95°C for 20 s; annealing and extension at 55°C for 60 s, 26 cycles.

[0060] (2) Genotyping of KASP molecular marker YNβc

[0061] After the reaction, the PCR products were detected using a BIO-RAD microplate reader, and the data were then imported into KlusterCaller software for cluster analysis.

[0062] like Figure 1 As shown in the figure, according to the color classification of the two fluorescent signals detected, the KASP molecular marker YNβc was used to perform Ynβc genotyping on 22 individual plants of the parents XQC, SZQ and F1, as well as 3 blank controls of the F2 population, a total of 28 samples. Each point in the figure represents a sample.

[0063] The yellow dots clustered close to the X-axis indicate that the gene carries a FAM tag sequence (4 in total), and the corresponding non-heading cabbage to be tested contains caryophyllene;

[0064] The blue squares clustered close to the Y axis indicate that the gene carries a HEX tag sequence (10 in total), and the corresponding non-heading Chinese cabbage to be tested does not contain caryophyllene;

[0065] Green triangles indicate heterozygous sequences (11 in total), corresponding to the non-heading cabbage to be tested containing caryophyllene;

[0066] The black squares (3 in total) are blank controls (NTC).

[0067] Table 1 shows the genotype sequencing analysis and phenotypic analysis of the non-heading cabbage samples. The results show that the genotype of the SNP site with a single peak and a G base is consistent with the genotype of the donor parent 'XQC', the genotype of the SNP site with a single peak and a T base is consistent with the genotype of the donor parent 'SZQ', and the genotype with a double peak and a G / T base is a heterozygote. The results of the genotype sequencing analysis and phenotypic analysis correspond to the above cluster analysis results.

[0068] Table 1

[0069]

[0070]

[0071] In the table, S represents: the allele type of the HEX fluorescent tag sequence connected based on the amplification of YNβc-H; H represents: the heterozygous sequence; X represents: the allele type of the FAM fluorescent tag sequence connected based on the amplification of YNβc-F; 0 represents: contains caryophyllene; 1 represents: contains caryophyllene.

[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A KASP molecular marker tightly linked to the aroma trait caryophyllene in non-heading Chinese cabbage, characterized in that: The molecular marker is located on chromosome 6 of non-heading Chinese cabbage and is named YNβc. The nucleotide sequence of YNβc is shown in SEQ ID NO.1: TCTCTGCCCCAAACATTTCTTGGTTCAAGTGTCGCCTCTCACCATTTCAGTTTTGTTT TCATTAAAAAATCATTTTTATTAGTTATAACAAACTGTTTATTTCCAATTTCCTTCCTATATGAGTGCTTCACGTATCTATAACAGAGAATTGAAGGCATTTTTTCTTTCCATAGTTT TTTATTTACAGAGATTGTTCAATAAAATTTTATATACTTTTCAGTTGGTTAATTATTTTTAGAGTATAATTAGTTTTTTTTAATTATTTCTCCATTACATTTGTGTGTTTACATTATTTTGGTTG, wherein a G→T mutation occurs at the 151st bp position, and base T is unique to non-heading cabbage materials that do not contain caryophyllene.

2. A primer pair for detecting the KASP molecular marker tightly linked to the aroma trait caryophyllene in non-heading cabbage as claimed in claim 1.

3. The primer pair according to claim 2, characterized in that: The primer pair includes an upstream primer YNβc-F of a non-heading Chinese cabbage allele containing caryophyllene, an upstream primer YNβc-H of a non-heading Chinese cabbage allele not containing caryophyllene, and a common downstream primer YNβc-C. The sequence of YNβc-F is shown in SEQ ID NO.2: 5'-FAM-GAAGGTGACCAAGTTCATGCTGCTTCACGTATCTATAACAGAGAATTG-3'; The sequence of YNβc-H is shown in SEQ ID NO.3: 5'-HEX-GAAGGTCGGAGTCAACGGATTGCTTCACGTATCTATAACAGAGAATTT-3'; The sequence of YNβc-C is shown in SEQ ID NO.4: 5'-AAAACTATGGAAAGAAAAAATGCCT-3'.

4. A kit comprising the primer pair according to claim 2 or 3.

5. A method for identifying whether non-heading cabbage contains caryophyllene, characterized in that: The method comprises the following steps: (1) extracting the total genomic DNA of the non-heading cabbage to be tested; (2) using the primers described in claim 2 or 3 to perform PCR amplification on the total genomic DNA of the non-heading cabbage to be tested; (3) Performing genotyping detection on the amplified product, and determining whether the sample material contains caryophyllene based on the genotyping result.

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification in step (2) is as follows: the total system of PCR amplification is 10 μl, including 2×KASP Master mix 5 μl, KASP Primer mix 0.14 μl, template DNA 1.0 μl, and ddH2O 3.86 μl; The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 60 s, 10 cycles, with the temperature decreasing by 0.6°C each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 60 s, 26 cycles.

7. The method according to claim 5, characterized in that The genotyping method in step (3) is to determine the genotype of the molecular marker according to the type of the fluorescent signal, and then determine whether the sample material contains caryophyllene; When the non-heading cabbage to be tested includes the allele type connected to the HEX fluorescent tag sequence obtained by amplification based on YNβc-H, The non-heading cabbage to be tested does not contain caryophyllene; When the non-heading cabbage to be tested includes the allele type connected to the FAM fluorescent label sequence obtained by amplification based on YNβc-F or is a heterozygous type, the non-heading cabbage to be tested contains caryophyllene.

8. The method according to claim 7, characterized in that The method of genotyping in step (3) is as follows: after the PCR amplification reaction is completed, the PCR product is detected by an enzyme reader, and the data is imported into the KlusterCaller data processing software for analysis, and cluster analysis is performed. The genotype of the samples clustered close to the X-axis is the allele type of the FAM fluorescent label sequence connected based on the amplification of YNβc-F, and the genotype of the samples clustered close to the Y-axis is the allele type of the HEX fluorescent label sequence connected based on the amplification of YNβc-H, and the genotype of the intermediate sample is a heterozygous type.

9. Use of the KASP molecular marker tightly linked to caryophyllene in non-heading cabbage according to claim 1, the primer pair according to claim 2, the kit according to claim 4, or the method according to any one of claims 5 to 8 in identifying whether non-heading cabbage contains caryophyllene.

10. Use of the KASP molecular marker tightly linked to caryophyllene in non-heading cabbage according to claim 1, or the primer pair according to claim 2, or the kit according to claim 4, or the method according to any one of claims 5 to 8 in molecular marker-assisted breeding of non-heading cabbage.

Images