Recombinant rabies virus attenuated strain as well as construction method and application thereof

Abstract

The invention relates to the technical field of gene recombination, in particular to a recombinant rabies virus attenuated strain as well as a construction method and application thereof. The method comprises the following steps: deleting a pseudo gene psi of an SRV9 virus G gene, inserting exogenous genes EgM123 and eGFP into the position of the deleted pseudo gene, and then transfecting and rescuing to obtain an echinococcus granulosus EgM123 recombinant rabies virus attenuated strain; and the nucleotide sequence of the pseudo gene psi is as shown in SEQ ID NO. 19. The recombinant rabies virus attenuated strain is successfully saved and obtained, the attenuated strain has an encapsulation structure and is in an elastic form, and the average particle size of the attenuated strain is 148.47 nm.

Description

Technical Field

[0001] The present invention relates to the technical field of recombinant rabies virus construction, and in particular to a recombinant rabies virus attenuated strain and a construction method and application thereof. Background Art

[0002] Rabies, also known as hydrophobia, is an acute, fatal, neurotropic zoonotic infectious disease caused by infection with the rabies virus (RV) of the Lyssaviridae family and the genus Rabiesvirus. RV is mainly found in the salivary glands and saliva of sick animals. When a rabid animal bites a human or other animal, the virus can enter the body of the bitten person through the saliva, causing infection. The rabies virus SRV9 strain is used to study oral attenuated vaccine strains. It is cloned from the parent strain SAD B19. Mutations at specific sites in its genome lead to reduced virulence, making it suitable for the study of attenuated oral vaccines.

[0003] Hydatid disease (HD), also known as Echinococcosis granulosa (Eg), is a zoonotic parasitic disease caused by the middle tapeworm larvae of Echinococcus granulosa that infects humans and animals. The disease is distributed worldwide. The transmission process of hepatic cystic echinococcosis (CE) is mainly dogs as the final host, and mammals such as humans, cattle, and sheep as intermediate hosts. They are infected by contacting and ingesting food and water contaminated with echinococcosis eggs. The proteins of the EgM family of Echinococcus granulosa include EgM9, EgM123, and EgM4, which are expressed in the adult stage and participate in the maturation of adults and the development of eggs. Some researchers have used EgM9 and EgM123 specific proteins to immunize dogs, which has produced a good protective effect. Dogs were orally infected with more than 20,000 Eg eggs. The test results in the serum of immunized dogs 45 days after infection showed that immune EgM9 and EgM123 proteins can induce a high level of protection in the final host dogs, which can effectively inhibit the hatching of eggs and the formation of worm bodies, and the effect of EgM123 protein on adult development and maturation is much greater than that of EgM9 protein. At present, my country has taken preventive measures to regularly deworm dogs and prevent eggs from contaminating the environment to block the spread of Eg, but long-term use of anthelmintics may cause parasites to develop resistance. Therefore, immunization and prevention of dogs is an important way to control the spread of echinococcosis.

[0004] Canids are common hosts, pathogen carriers and pathogen transmitters for the transmission of rabies and echinococcosis from animals to humans, and play a crucial role as an intermediate link in the transmission of rabies and echinococcosis. Immunization of canids is a key link in controlling the spread of these two diseases. At present, subunit vaccines constructed with Eg95 recombinant protein as antigen are mainly used to prevent and control the infection of Echinococcus granulosus to intermediate hosts (sheep), and have achieved ideal results, but there is still a lack of vaccine development for the final host dog.

[0005] Patent application numbered "202310051173.5" discloses a method for constructing a recombinant rabies virus SRV9 strain with the EgM123 gene of Echinococcus granulosus, but the recombinant rabies virus SRV9 strain obtained by the construction is too toxic and difficult to meet the application standards. Therefore, it is urgent to provide a recombinant rabies virus attenuated strain. Summary of the invention

[0006] To reduce the toxicity of the Echinococcus granulosus EgM123 gene recombinant rabies virus SRV9 strain. The present invention provides a recombinant rabies virus attenuated strain and its construction method and application. The recombinant rabies virus attenuated strain provided by the present invention removes pseudogenes, reduces toxicity, and has good genetic stability.

[0007] The present invention provides a recombinant rabies virus attenuated strain, which is obtained by deleting the pseudogene ψ of the G gene of SRV9 virus, inserting the exogenous gene EgM123 and eGFP into the deleted pseudogene position, and then rescuing the Echinococcus granulosus EgM123 recombinant rabies virus attenuated strain through transfection;

[0008] The nucleotide sequence of the pseudogene ψ is shown in SEQ ID NO.19.

[0009] The present invention uses a viral reverse genetics method to construct a pcDNA4-NPM+G carrying the Echinococcus granulosus EgM123 gene and the eGFP fluorescent reporter gene. ΔCD +EgM123+eGFP+L full-length plasmid, and four auxiliary transfection plasmids of rabies SRV9 virus pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA-L were co-transfected into BSR cells by electrofection. EgM123 gene recombinant rabies virus was rescued. Experiments on suckling mice found that the virus dilution multiple was 10 -2 The mortality rate was 33.33% and the toxicity was low.

[0010] The present invention also provides a method for constructing the recombinant rabies virus attenuated strain, comprising the following steps:

[0011] The N, P, G and L genes of SRV9 virus were synthesized and inserted into the pcDNA4 / myc-HisB eukaryotic expression vector to construct auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNA4-L;

[0012] The NPM gene fragment shown in SEQ ID NO.24 was synthesized and recombined into the pcDNA4 / myc-HisB vector by T4 ligase to obtain the pcDNA4-NPM recombinant plasmid;

[0013] The synthetic sequence is shown in SEQ ID NO.25 as the rabies virus SRV9 fusion gene G △CD +EgM123+eGFP, then G △CD +EgM123+eGFP gene fragment was recombined into pcDNA4 / myc-HisB vector by T4 ligase to obtain pcDNA4-G △CD +EgM123+eGFP recombinant plasmid;

[0014] pcDNA4-NPM was linearized by double digestion with Not I and EcoR V restriction endonucleases. △CD +EgM123+eGFP was double-digested with Not I and EcoR V restriction endonucleases to obtain G △CD +EgM123+eGFP gene fragment, using T4 ligase to G △CD +EgM123+eGFP gene fragment was constructed into pcDNA4-NPM vector to obtain the recombinant vector pcDNA4-NPM+G △CD +EgM123+eGFP, collect NPM+G △CD +EgM123+eGFP gene fragment;

[0015] pcDNA4-L was linearized by EcoR V and PmeⅠ restriction endonucleases to obtain pcDNA4-L vector; NPM+G △CD +EgM123+eGFP gene fragment was recombined with pcDNA4-L linearized vector using Gibson homologous recombination method, and the obtained ligation product was transformed into Stbl3 competent cells to extract pcDNA4-NPM+G △CD +EgM123+eGFP+L recombinant plasmid, i.e., obtaining the full-length cDNA of the Echinococcus granulosus EgM123 gene recombinant rabies virus;

[0016] pcDNA4-NPM+G ΔCD+EgM123+eGFP+L recombinant plasmid and auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNAg-L were co-transfected into BSR cells to rescue the Echinococcus granulosus EgM123 recombinant rabies virus attenuated strain.

[0017] The present invention also provides an application of the recombinant rabies virus attenuated strain in the preparation of an oral rabies vaccine.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention synthesizes the N, P, G, and L genes of the SRV9 virus, deletes the SRV9 virus G gene pseudogene, inserts the exogenous genes EgM123 and eGFP into the deleted pseudogene, and successfully rescues the Echinococcus granulosus EgM123 recombinant rabies virus to obtain a recombinant rabies virus attenuated strain. The virulence assay results show that the supernatants of the 9th, 10th, 11th, 12th, and 13th generation viruses were used for fluorescent quantitative PCR virus identification, and the expression of the 11th, 12th, and 13th generation viruses was significantly increased compared with the 9th and 10th generation viruses (P < 0.05). There was no significant increase in the amount of virus expression between the 9th and 10th generations (P > 0.05). The death of suckling mice was observed for 21 days, and the virus dilution multiple was 10 -2 At that time, the mortality rate P was 33.33%.

[0020] It can be seen from the present invention that the pseudogene ψ of the G gene of the SRV9 virus is deleted, and the exogenous genes EgM123 and eGFP are inserted into the deleted pseudogene. Inserting exogenous genes at the pseudogene in the CD region of the G gene will not affect the replication of the virus itself. The recombinant virus is initially identified by directly observing the fluorescence of the cells after transfection to determine whether it is successfully rescued. The recombinant virus MOI of 0.1 is then inoculated into BSR cells. After infection for 5 generations, each gene fragment can still be detected by RT-PCR, indicating that the recombinant virus has good genetic stability. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1: The PCR identification results of pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNA4-L auxiliary plasmids; in the figure, A is the PCR identification result of pcDNA4-N auxiliary plasmid, M: 2,000DNA Marker; 1-2: PCR amplification of pcDNA4-N; 3: pcDNA4-N negative control; B is the PCR identification result of pcDNA4-P auxiliary plasmid, M: 2,000DNA Marker; 1-2: PCR amplification of pcDNA4 / myc-P; CK: pcDNA4-P negative control; C is the PCR identification result of pcDNA4-G auxiliary plasmid, M2,000DNA Marker; 1-2pcDNA4-G PCR amplification; CK pcDNA4-G negative control; D is the PCR identification result of pcDNA4-L auxiliary plasmid, M: 12,000DNA Marker; 1-2: PCR amplification of pcDNA4-L; CK: pcDNA4-L recombinant plasmid negative control.

[0023] Figure 2 The double enzyme digestion identification results of recombinant plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNA4-L; in the figure, A is the double enzyme digestion identification result of recombinant plasmid pcDNA4-N, M: 12,000 DNA Marker; 1: cDNA4-N plasmid digestion; B is the double enzyme digestion identification result of recombinant plasmid pcDNA4-P, M: 12,000 DNA Marker; 1: pcDNA4 / myc-P digestion; C is the double enzyme digestion identification result of recombinant plasmid pcDNA4-G, M: 15,000bp; 1-2: pcDNA4-G digestion; D is the double enzyme digestion identification result of recombinant plasmid pcDNA4-L, M: 15,000 DNA Marker; 1-2: pcDNA4-L digestion.

[0024] Figure 3 pcDNA4-N+P+M and pcDNA4-G ΔCD +EgM123+eGFP recombinant plasmid identification; In the figure, A is the identification of rabies virus pcDNA4-N+P+M bacterial solution, M: 15,000 DNA Marker; 1-2: PCR amplification of pcDNA4-N+P+M; CK: pcDNA4-N+P+M negative control; B is the restriction enzyme digestion identification of pcDNA4-NPM gene recombinant plasmid, M: 15,000 DNA Marker; 1-2: pcDNA4-N+P+M restriction enzyme digestion; C is pcDNA4-G ΔCD +EgM123+eGFP recombinant bacterial solution PCR identification, M: 15,000DNAMarker; 1-2: pcDNA4-GΔCD +EgM123+eGFP PCR amplification; CK: pcDNA4-G ΔCD +EgM123+eGFP negative control; D is rabies virus pcDNA4-G ΔCD +EgM123+eGFP recombinant plasmid enzyme digestion identification, M: 15,000DNAMarker; 1-2: pcDNA4-G ΔCD +EgM123+eGFP plasmid restriction enzyme digestion results.

[0025] Figure 4 The recombinant plasmid pcDNA4-NPM+G ΔCD +EgM123+eGFP was identified by single enzyme digestion; in the figure, A is canine disease virus pcDNA4-NPM+G ΔCD +EgM123+eGFP recombinant plasmid enzyme digestion identification, M: 15,000DNAMarker; 1-2: pcDNA4-NPM+G ΔCD +EgM123+eGFP plasmid digestion result; B is rabies virus pcDNA4-NPM+G ΔCD +EgM123+eGFP+L recombinant plasmid enzyme digestion identification, M: 15,000DNAMarker; 1: pcDNA4-NPM+G ΔCD +EgM123+eGFP+L plasmid restriction enzyme digestion results.

[0026] Figure 5 pcDNA4-NPM+G ΔCD +EgM123+eGFP+L plasmid map.

[0027] Figure 6 Direct observation of fluorescence detection results for recombinant virus rescue; in the figure, A is normal BSR cells; B is transfection of full-length cDNA; C is virus rescue; D is normal BSR cells observed under a fluorescence microscope; E is transfection of cDNA cells observed under a fluorescence microscope; F is virus rescue cells observed under a fluorescence microscope.

[0028] Figure 7 The results of RT-PCR virus identification, M: DL2000bp marker; 1, 2: N segment virus identification; 3, 4: P segment virus identification; 5, 6: G ΔCD Fragment virus identification; 7, 8: EgM123 fragment virus identification; 9, 10: eGFP fragment virus identification; PC: corresponding positive plasmid control; NC: corresponding uninfected virus negative control.

[0029] Figure 8This is the electron microscopic identification of the recombinant virus; in the figure, A and B are two repeats, both of which are electron microscopic images of the recombinant virus aggregated in the cytoplasm.

[0030] Fig. 9 The results of virus identification by fluorescent quantitative PCR.

[0031] Fig.10 This is the detection of antibodies produced by the recombinant virus. In the figure, A is the detection of IgG antibodies produced by the recombinant virus; B is the detection of IgA antibodies produced by the recombinant virus. DETAILED DESCRIPTION

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0033] Example 1: Construction of the full-length cDNA of the recombinant rabies virus of the Echinococcus granulosus EgM123 gene and auxiliary plasmid.

[0034] Referring to the complete genome sequence of rabies virus SRV9 released by NCBI, the N, P, G, and L genes of SRV9 virus were synthesized respectively, and inserted into the pcDNA4 / myc-HisB eukaryotic expression vector in sequence using T4 ligase to construct an auxiliary plasmid, which was identified using bacterial liquid PCR, plasmid double enzyme digestion, and gene sequence sequencing.

[0035] The invention utilizes the rabies virus reverse genetics technology to construct the full-length cDNA of rabies virus recombined with the EgM123 gene of Echinococcus granulosus. The invention divides the full-length cDNA of rabies virus recombined with the EgM123 gene of Echinococcus granulosus into NPM, G △CD +EgM123+eGFP and L 3 fragments. By deleting the pseudogene ψ (134 bp) of the SRV9 virus G gene as shown in SEQ ID NO.19, inserting the Echinococcus granulosus Eg M123 gene (594 bp) and enhanced green fluorescent protein eGFP (798 bp), N+P+M, G △CD+EgM123+eGFP, L gene, use T4 ligase and Gibson homologous recombination technology to connect each gene fragment to the pcDNA4 / myc-HisB vector, construct a recombinant SRV9 full-length cDNA carrying the EgM123 exogenous gene, introduce a HamRz sequence at the 5' end of the full-length cDNA, and introduce a HdvRz sequence at the 3' end. These sequences are located downstream of the CMV promoter to facilitate in vivo transcription. The present invention obtains the EgM123 gene recombinant rabies virus full-length cDNA and pcDNA4-N, pcDNA4-P, pcDN A4-G, and pcDNA4-L auxiliary plasmids, laying the foundation for the next step of reverse genetic operation.

[0036] SEQ ID NO.19:

[0037] GAAGAGTCAATCGATCAGAACCTACGCAACACAATCTCAGAGGGACAGGGAGGGAGGTGTCA GTCACTCCCCAAAGCGGGAAGATCATATCTTCATGGGAATCACACAAGAGTGGGGGTGAGACCAGA CTGTAA.

[0038] The specific methods and results are as follows.

[0039] 1. Experimental Methods

[0040] 1. Related primers

[0041] Table 1 All primers used in the present invention

[0042] Primer name Nucleotide sequence (5′-3′) serial number NF) <![CDATA[ GGTACC CTACAATGGATGCCGACAAG]]> SEQ ID NO.1 N(R) <![CDATA[ GATATC TCAACTTCTTATGAGTCACTCG]]> SEQ ID NO.2 P(F) <![CDATA[ GGTACC CATGAGCAGATCTTTGTCAAT]]> SEQ ID NO.3 P(R) <![CDATA[ GATATC TCGGTTAGCAAGATGTATAGCGATT]]> SEQ ID NO.4 G(F) <![CDATA[ GGTACC AGGAAAGATGGTTCCTCAGGCTCTC]]> SEQ ID NO.5 G(R) <![CDATA[ GATATC TTACAGTCTGGTCTCACCCCAC]]> SEQ ID NO.6 L(F) <![CDATA[ GCGGCCGC ATGCTCGATC]]> SEQ ID NO.7 L(R) <![CDATA[ GTGAGC CTACCGATAAGCTT]]> SEQ ID NO.8 NPM(F) <![CDATA[ GGTACC TGTTAAGCGTCTGATG]]> SEQ ID NO.9 NPM(R) <![CDATA[ GATATC TTATTCTAGAAGCAG]]> SEQ ID NO.10 G123(F) <![CDATA[ GATATC ATGGTTCCTCAGGCTCTC]]> SEQ ID NO.11 G123(R) <![CDATA[ GATCTAGA TAAGCGCCGC]]> SEQ ID NO.12 JD-NPM-vector-F TTTCCAAGTCTCCACCCCA SEQ ID NO.13 JD-NPM-vector-R TGTCAGAGCCCAATTCCCT SEQ ID NO.14 JD-LF CCGACCACTACCAGCAGAACA SEQ ID NO.15 JD-LR CCTCTCAAGGCAACTTAACACTCC SEQ ID NO.16 EGM123((F) GTGAATTTTGCCTGCCCGTT SEQ ID NO.17 EGM123((R) AGCACAACCTCAGTCATGGG SEQ ID NO.18

[0043] Note: Underline indicates restriction site.

[0044] 2. Construction of rabies virus pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA4-L auxiliary plasmids

[0045] Referring to the complete genome sequence of rabies virus SRV9 strain (GenBank accession number: AF499686), N, P, G, and L genes were synthesized by gene synthesis technology. When synthesizing N, P, and G genes, restriction endonucleases KnpⅠ / EcoR V were introduced at both ends of the genes, and restriction endonucleases Not1 / Bstb 1 were introduced at both ends of L. The fragment sizes were 1,353 bp, 894 bp, 1,575 bp, and 6,384 bp, respectively. The synthesized target genes were constructed into pcDNA4 / myc-His vectors by T4 ligase and named pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA4-L, respectively. The ligation products were transformed into DH5α, and the pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA4-L plasmids were extracted and identified by PCR, plasmid double enzyme digestion, and sequencing.

[0046] The N gene sequence is shown in SEQ ID NO.20, the P gene sequence is shown in SEQ ID NO.21, the G gene sequence is shown in SEQ ID NO.22, and the L gene sequence is shown in SEQ ID NO.23.

[0047] 2. Rabies SRV9 virus NPM+G ΔCD Construction of full-length cDNA of +EgM123+eGFP+L

[0048] (1) Construction of eukaryotic expression vector of rabies SRV9 virus NPM gene

[0049] When synthesizing the long NPM gene fragment, a KpnⅠ restriction site was introduced at the 5′ end of the N gene, and a 57bp hammerhead ribozyme HamRz sequence was introduced, and an EcoR V restriction site was introduced at the 3′ end of the M gene. The protein Linker-(GGGGS)2 was used to replace the spacer sequence between the genes to ensure the normal expression of each structural gene. The synthesized NPM gene sequence is shown in SEQ ID NO.24, and the fragment size is 2,967bp. The synthesized NPM gene fragment was recombined into the pcDNA4 / myc-HisB vector by T4 ligase and named pcDNA4-NPM. The ligation product was transformed into DH5α competent cells, and the plasmid was extracted using an endotoxin-free mini-preparation kit. It was identified by PCR, plasmid double enzyme digestion and sequencing.

[0050] The process of ligation product transformation and PCR identification is as follows:

[0051] a. Experimental process of transforming the ligation product into DH5α competent cells: slowly add 10μL of the ligation product to the melted competent cells, mix gently, do not blow up and down with the pipette tip, place on ice for 30 minutes, then put the competent cells into a 37℃ water bath, heat shock for 90 seconds, quickly put them into ice, and let them stand for 3 minutes (do not shake the sample during the ice standing process, otherwise it will degrade the transformation efficiency). Add 700μL of LB medium that has been autoclaved and does not contain any antibiotics to the tube, set the constant temperature shaker to 37℃, 5,000rpm, wait for 45 minutes, centrifuge, discard 600μL of supernatant, keep 100μL, spread it on LB solid medium with ampicillin, place the plate in a 37℃ constant temperature incubator, and culture overnight.

[0052] b. Bacterial liquid activation: Use a non-enzyme pipette to gently pick up a single colony on the LB medium and add it to 5 mL of LB liquid medium containing ampicillin. Incubate at 37°C, 12,000 rpm overnight.

[0053] c. PCR identification: Pipette 20 μL of the overnight cultured LB liquid medium into a sterile 1.5 mL centrifuge tube for bacterial liquid PCR identification. The bacterial liquid PCR system is as follows, with a cycle program of 94°C for 2 min, 98°C for 10 s, Tm for 30 s, 68°C for 1 min / kb, for a total of 35 cycles. The PCR reaction system is shown in Table 2.

[0054] Table 2 PCR reaction system

[0055] Element volume 2×PCR Buffer 12.5μL 2mM dNTPs 5μL KOD FX enzyme 0.5μL Upstream primer 0.5μL Downstream primer 0.5μL template 1ng <![CDATA[ddH2O]]> Make up to 25 μL

[0056] The plasmid double enzyme digestion system is shown in Table 3, and the enzyme digestion conditions are shown in Table 4.

[0057] Table 3 Plasmid restriction enzyme system

[0058] Element volume rCutSmart 7.5μL BSA 2.5μL Restriction endonuclease 1 2.5μL Restriction endonuclease 2 2.5μL Plasmids 2μg <![CDATA[ddH2O]]> Make up to 50 μL

[0059] Note: Due to the different restriction sites carried by the plasmid itself, the selected restriction sites are also different (N gene, P gene, G gene: KnpⅠ / EcoR V; L gene: Not 1 / Bstb 1; NPM gene: KnpⅠ / EcoR V; G △CD +EgM123+eGFP gene: EcoR V / Not1; NPM+G △CD +EgM123+eGFP+L gene: Pme I; recombinant virus full-length cDNA: Not 1.

[0060] Table 4 Enzyme digestion conditions

[0061] temperature time 37℃ 60min 80℃ 30min

[0062] (2) Rabies virus SRV9 fusion gene G △CD Construction of +EgM123+eGFP

[0063] In the synthesis of long fragment G △CD When +EgM123+eGFP, the pseudogene ψ in the CD region of the SRV9 virus G gene shown in SEQ ID NO.19 was deleted, and the Echinococcus granulosus EgM123 gene (594 bp) was inserted, the green fluorescent protein eGFP gene (798 bp) was added, an EcoR V restriction site was introduced at the 5′ end, a Not I restriction site was introduced at the 3′ end, and a protein Linker-(GGGGS)2 was introduced between the gene sequences to synthesize the rabies virus SRV9 fusion gene G sequence shown in SEQ ID NO.25 △CD +EgM123+eGFP, fragment size 2,892bp; the synthesized G △CD +EgM123+eGFP gene fragment was recombined into pcDNA4 / myc-HisB vector by T4 ligase and named pcDNA4-G △CD +EgM123+eGFP, transform the ligation product into DH5α competent cells, extract the plasmid, transform the ligation product into DH5α competent cells, extract the plasmid, and identify it by PCR, plasmid double enzyme digestion and sequencing.

[0064] (3) Rabies virus SRV9 fusion gene NPM+G ΔCD Construction of +EgM123+eGFP

[0065] pcDNA4-NPM was linearized by double digestion with Not I and EcoR V restriction endonucleases. △CD +EgM123+eGFP was double-digested with Not I and EcoR V restriction endonucleases to obtain G △CD +EgM123+eGFP gene fragment, using T4 ligase to G △CD +EgM123+eGFP gene fragment was constructed into pcDNA4-NPM vector and named pcDNA4-NPM+G △CD +EgM123+eGFP, connected by T4 ligase at 22°C for 30 minutes, the ligation product was transformed into DH5α competent cells, the plasmid was extracted, and identified by PCR, plasmid double enzyme digestion and sequencing.

[0066] (4) Rabies virus SRV9 fusion gene NPM+G ΔCD Construction of full-length cDNA of +EgM123+eGFP+L

[0067] pcDNA4-L was linearized by EcoR V and PmeⅠ restriction endonucleases to obtain pcDNA4-L vector. △CD +EgM123+eGFP gene fragment and pcDNA4-L linearized vector were connected by Gibson homologous recombination method at 50℃ for 60min. 10μL of the connection product was transformed into St bl3 competent cells. △CD +EgM123+eGFP+L recombinant plasmid was identified by PCR, plasmid double restriction digestion and sequencing.

[0068] The ligation system of T4 ligase in the above steps is shown in Table 5.

[0069] Table 5T4 connection system

[0070]

[0071]

[0072] The Gibson homologous recombination system is shown in Table 6.

[0073] Table 6 Gibson homologous recombination ligation system

[0074] Element volume Linearized vector 1μL Insert About 1.8 μg Enzymes 10μL <![CDATA[ddH2O]]> Make up to 20 μL

[0075] 2. Experimental Results

[0076] 1. PCR identification of pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA4-L auxiliary plasmids

[0077] The constructed pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNA4-L auxiliary plasmids were identified by PCR. Figure 1 As shown, the target bands of pcDNA4-N (1,353 bp), pcDNA4-P (894 bp), pcDNA4-G (1,575 bp), and pcDNA4-L (6,384 bp) were amplified respectively.

[0078] The extracted recombinant plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA4-L were double-digested with restriction endonucleases for identification. The identification results were as follows: Figure 2As shown, the extracted recombinant plasmids pcDNA4-N, P, and G were double-digested with Knp I and EcoR V restriction endonucleases, and the vector digested fragment size was 5,036 bp, the N gene digested fragment size was 1,353 bp, the P gene fragment size was 894 bp, and the G gene digested fragment size was 1,575 bp; the pcDNA4-L recombinant plasmid was double-digested with NotⅠ / BstⅠ restriction endonucleases, and the vector digested fragment size was 5,036 bp, and the L gene digested fragment size was 6,384 bp.

[0079] 2. Identification of pcDNA4-NPM recombinant plasmid and pcDNA4-GΔCD+EgM123+eGFP recombinant plasmid

[0080] The results are as follows Figure 3 As shown, the constructed pcDNA4-NPM was identified by PCR, and a 2,979 bp target band was amplified ( Figure 3 A); Kpn 1 and EcoR v restriction endonucleases were used to double-digest the extracted recombinant plasmid pcDNA4-NPM to obtain an approximately 2,967 bp NPM fragment and a 5036 bp vector fragment ( Figure 3 B), the sequencing results were consistent with 100%.

[0081] The pcDNA4-G ΔCD +EgM123+eGFP was identified and the target band of 2,906 bp was amplified ( Figure 3 The recombinant plasmid pcDNA4-G was extracted by using EcoR v and Not 1 restriction endonucleases. ΔCD +EgM123+eGFP were double-digested to obtain a G ΔCD +EgM123+eGFP fragment and 5,064 bp vector fragment ( Figure 3 D), the sequencing results were consistent with 100%.

[0082] 3. Construction of the large fragment vector of rabies SRV9 virus NPM+GΔCD+EgM123+eGFP

[0083] The results are as follows Figure 4 As shown, the extracted recombinant plasmid pcDNA4-NPM+GΔCD+EgM123+eGFP was digested with NotⅠ restriction enzyme to identify a band of about 10,868 bp in size, and the sequencing result of the pcDNA4-NPM+GΔCD+EgM123+eGFP recombinant plasmid had a 100% consistency rate.

[0084] 4. Construction of pcDNA4-NPM+GΔCD+EgM123+eGFP+L full-length cDNA

[0085] The extracted recombinant plasmid full-length cDNA was digested with NotⅠ restriction endonuclease and a band of about 17,767 bp was identified ( Figure 4 B), the consistency rate of the recombinant plasmid full-length cDNA sequencing results was 100%. Figure 5 pcDNA4-NPM+G ΔCD +EgM123+eGFP+L plasmid map.

[0086] In summary, the present invention deletes the pseudogene of the CD region of the SRV9 virus G gene and adds the Echinococcus granulosus EgM123 gene and the enhanced green fluorescent protein gene eGFP. ΔCD +EgM123+eGFP+L full-length cDNA.

[0087] Example 2: Rescue and identification of recombinant rabies virus expressing the Echinococcus granulosus EgM123 gene.

[0088] The present invention utilizes reverse genetics technology to construct full-length cDNA and auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA4-L of the Echinococcus granulosus EgM123 gene recombinant rabies virus, utilizes electroporation technology to co-transfect the full-length cDNA and auxiliary plasmids into BSR cells, successfully rescues the Echinococcus granulosus EgM123 recombinant rabies virus, and analyzes and identifies the new virus through direct fluorescence observation, RT-PCR, electron microscopy, fluorescence quantitative PCR and other methods, thereby providing a vaccine strain for the development of a "rabies-echinococcosis gene recombinant oral vaccine."

[0089] 1. Experimental Methods

[0090] 1. Experimental materials: pcDNA4-N, pcDNA4-P, pcDNA4-G, pcDNA4-L, pcDNA4-NPM, pcDNA4-GΔCD+EgM123+eGFP, pcDNA4-NPM+GΔCD+EgM123+eGFP and pcDNA4-NPM+GΔCD+EgM123+eGFP+L full-length cDNAs obtained in Example 1.

[0091] BSR-T7 / 5 golden hamster kidney cells.

[0092] Sources of test reagents: DMEM high-glucose medium was provided by Wuhan Pronocell Life Science Co., Ltd., electroporation solution was provided by Bio-Rad Biomedical Products (Shanghai) Co., Ltd., Stable competent cells were provided by Beijing Zhuangmeng International Biogene Technology Co., Ltd., and TaKaRa RNA PCR Kit was provided by Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0093] TRIZOL was sourced from Thermo Fisher Scientific, BI fetal bovine serum and pancreatic enzymes were provided by Shanghai Xiaopeng Biotechnology. Green qPCR SuperMix was provided by Beijing Quanshijin Biotechnology, and FITC-labeled goat anti-mouse and goat anti-rabbit were provided by Beijing Biosun Company.

[0094] 2. Recovery of BSR cells

[0095] The BSR cells frozen in the laboratory were taken out of the liquid nitrogen tank and quickly placed in a 37°C water bath. After thawing, centrifuge at 1,000rpm for 5 minutes, discard the supernatant, resuspend with DMEM culture medium containing 10% serum, and centrifuge again to remove the remaining freezing solution. The cell pellet was resuspended with DMEM culture medium containing 10% serum, placed in a 25T cell bottle, and continued to be cultured in a 37°C, 5% CO2 incubator.

[0096] 3. Electroporation of BSR cells

[0097] The operation of electroporating BSR cells was based on the method of Wei Yuyuan in our laboratory (Wei Yuyuan. Research on the construction and rescue of the Ψ region deletion strain of rabies virus SRV9 [D]. Xinjiang Agricultural University, 2016.).

[0098] (1) Preparation for electroporation:

[0099] Clean the electroporation cup, soak it in 75% alcohol for 2 hours, then irradiate it with ultraviolet light until the electroporation cup is dry; transfer the constructed auxiliary plasmid and full-length plasmid into the stable competent state respectively, extract the plasmid for enzyme digestion and sequencing identification, and prepare for electroporation; subculture the BSR cells the day before, and the cell fusion degree is 70%-80%, wash them twice with D-hanks, digest them with trypsin, resuspend the cells in serum-free DMEM culture medium, centrifuge at 1,000rpm for 5min, completely discard the supernatant, count them with a cell counting plate (suspended cells 2), and add 500μL electroporation buffer to resuspend the cells.

[0100] (2) Rescue of recombinant rabies virus expressing Echinococcus granulosus EgM123 gene

[0101] Add the full-length plasmid and the auxiliary plasmid to the resuspended cells according to the concentration in Table 7, mix the cells, electrotransformation buffer, and each plasmid and add slowly along the 0.4 cm wall of the electrotransfer cup to avoid bubbles. Set the full-length cDNA and negative cells as the control group, quickly put the prepared electrotransfer cup into the electrotransfer instrument and set the instrument (130v, 25ms, 2 times, 0.4mm). Put the electrotransfer cup into the incubator and let it stand for 10 minutes. Use a long pipette to slowly add the liquid in the electrotransfer cup to the six-well plate, and culture it with serum-free DMEM culture medium for 6 hours. After 6 hours, replace the DMEM culture medium containing 10% serum, and observe the state of fluorescence after 48 hours.

[0102] Table 7 Plasmid dosage for electroporation

[0103]

[0104] 4. Identification of recombinant rabies virus with Echinococcus granulosus EgM123 gene by RT-PCR

[0105] (1) Extraction of recombinant viral RNA

[0106] The infected cells cultured for 72 hours were repeatedly frozen and thawed three times at -80℃, centrifuged at 4℃, 12,000rpm for 10min, 400μL of supernatant was taken, 600μL of Trizol was added, and the mixture was ice-bathed for 10min. During the RNA extraction, the enzyme-free state was maintained throughout the process; 200μL of chloroform was added to the mixture, mixed using a vortex oscillator, and oscillated for 15s; ice-bathed for 10min, centrifuged at 4℃ for 15min; 500μL of supernatant was taken into a new enzyme-free centrifuge tube, and the precipitate below was not sucked; an equal volume of isopropanol was added, and the mixture was centrifuged at 4℃, 12,000rpm for 10min; the supernatant was discarded, and the cell precipitate was found as much as possible. If it could not be found, some liquid was left at the bottom of the centrifuge tube, and 1mL of 75% alcohol was added. The mixture was ice-bathed for 10min, 7,500rpm, centrifuged for 5min, and the supernatant was discarded, and the liquid inside was absorbed with absorbent paper. Repeat the above steps, discard the supernatant, lyophilize for 5 minutes, add 20 μL of enzyme-free water, mix well, use for reverse transcription, and store in a -80°C refrigerator.

[0107] (2) Reverse transcription of cDNA

[0108] RNA was reverse transcribed using SRV9-N(F) specific primers, and reverse transcription was performed using the Takara reverse transcription kit. The reverse transcription system is shown in Table 8, and the reaction conditions are: 42°C, 30 min; 95°C, 5 min; 5°C, 5 min; and stored at 4°C.

[0109] Table 8 Reverse transcription system

[0110] Reagents Dosage dNTPs 1μL Mgcl2 2μL 10×RT-buffer 1μL AMV 0.5μL <![CDATA[SRV9-N(F)]]> 0.5μL RNase Znhibitor 0.25μL RNA template ≤500ng Enzyme-free water Up to 10 μL

[0111] (3) PCR detection

[0112] Reverse transcribed cDNA was used as template, and primers N(F / R); P(F / R); M(F / R); G(F / R); EgM23(F / R); EGFP(F / R) were used for identification. The RCR reaction system is shown in Table 9, and the reaction conditions are: 95℃, 5min; 94℃, 30s; 58℃, 30s; 72℃, 1min / kb; 72℃, 10min; 4℃ insulation. The full-length plasmid was used as a positive control, and cDNA extracted from untreated cells was used as a negative control; the target band was detected by nucleic acid gel electrophoresis.

[0113] Table 9 PCR reaction system

[0114] Reagents Dosage 5×PCR Buffer 2.5μL EX Taq 0.25μL Upstream primer 0.25μL Downstream primer 0.25μL cDNA 2μL <![CDATA[ddH2O]]> 7.5μL

[0115] (4) Identification of recombinant viruses by electron microscopy

[0116] BSR cells infected with recombinant virus were scraped and centrifuged, fixed with 2.5% glutaraldehyde and 1% osmium acid, and dehydrated with 30%, 50%, 70%, 80%, 90%, and 100% ethanol series gradient. The ethanol in the cells was then replaced with acetone. The tissue samples were immersed in 812 embedding agent, and the samples were polymerized at 37°C for 24h, 45°C for 24h, and 60°C for 24h. The tissues were trimmed and ultrathinly sliced ​​to 70nm. The ultrathin slices were double-stained with lead citrate and uranyl acetate, and the morphology of the virus in the cells was observed under a transmission electron microscope.

[0117] (5) Fluorescence quantitative PCR virus identification

[0118] The virus supernatant collected from the 9th, 10th, 11th, 12th and 13th generations was frozen and thawed three times at -80℃, and the supernatant was taken after centrifugation at 4℃ and 12,000rpm for 10min. The total RNA of the recombinant virus was extracted according to the Trizol method, and the viral RNA was reverse transcribed using the SRV9-N (F) gene-specific primers according to the Takara reverse transcription kit; the sample primers and internal reference primers EgM123 (F\R); GAPDH (F\R) were designed for fluorescence quantitative PCR detection. The configuration of the fluorescence quantitative PCR reaction system is shown in Table 10. Three replicate experiments were set up for each group. The reaction conditions were 94℃, 30s; 94℃, 5s; 60℃, 15s (collecting signals), a total of 40 cycles, and the exported data were sorted using SPSS.

[0119] Table 10 Fluorescence quantitative PCR reaction system

[0120]

[0121] (6) Determination of the median lethal dose (LD50) of the recombinant virus

[0122] The concentrated 12th generation virus solution was diluted at a ratio of 100 to 10-2 and then diluted to 10 for 3-day-old suckling mice. 0 ~10 -2 The dilution gradient was used, and 0.03 mL of virus solution was drawn by a microsyringe for intracerebral injection. At the same time, physiological saline was inoculated as a negative control. The experiment was repeated in three groups. The mice were observed for 21 consecutive days, and the mortality of each group of mice was counted. The virulence of the recombinant virus was calculated according to the Spearman-Karber method.

[0123] (7) ELISA detection of antibodies

[0124] Quantitative detection of mouse anti-rabies virus IgG antibody indirect ELISA: set up standard wells, sample wells (determined optimal dilution multiples) and blank wells, add 50μL of different concentrations of standard wells, add 50μL of diluted sample to be tested to sample wells, and do not add to blank wells. Cover the reaction plate with a sealing film and incubate at 37℃ for 30min. Remove the sealing film, discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 20s, shake off the washing solution, and pat dry on absorbent paper. Repeat the plate washing 4 times. In addition to the blank wells, add 100μL of HRP-labeled antibody to the standard wells and sample wells, cover the reaction plate with a sealing film, and incubate at 37℃ for 30min. Wash the plate 5 times, mix substrate A and B in a 1:1 volume, and add 100μL of substrate mixture to all wells. Cover the reaction plate with a sealing film and incubate at 37℃ for 15min. Add 50 μL of stop solution to all wells, and read the absorbance (OD value) of each well at a wavelength of 450 nm on a microplate reader.

[0125] Quantitative detection of mouse anti-rabies virus IgA antibody indirect ELISA: set up standard wells, sample wells and blank wells, add 50μL of standard of different concentrations to each standard well, add 50μL of the sample to be tested to the sample well, and do not add to the blank well. Cover the reaction plate with a sealing film and incubate at 37℃ for 30min. Remove the sealing film, discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 20s, shake off the washing solution, pat dry on absorbent paper, and wash the plate 5 times. Except for the blank well, add 100μL of HRP-labeled antibody to the standard wells and sample wells, cover the reaction plate with a sealing film, and incubate at 37℃ for 30min. Repeat the plate wash 5 times. Mix substrate A and B thoroughly at a volume of 1:1, and add 100μL of substrate mixture to all wells. Cover the reaction plate with a sealing film and incubate at 37℃ for 15min. Add 50 μL of stop solution to all wells, and read the absorbance (OD value) of each well at a wavelength of 450 nm on a microplate reader.

[0126] 2. Experimental Results

[0127] 1. Fluorescence detection

[0128] The full-length cDNA of recombinant SRV9 expressing the exogenous gene EgM123 gene and the auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G, and pcDNA4-L were constructed and identified to be completely correct and transfected into BSR cells by electroporation. After 48 hours of electroporation, both the group transfected with the full-length plasmid cDNA and the virus rescue group showed green fluorescence ( Figure 5 ), the normal BSR control group had no fluorescence, which preliminarily proved that the full-length plasmid was transferred into BSR cells.

[0129] 2. Gene stability test results

[0130] The results are as follows Figure 7 As shown, N(F / F); P(F / R); G(F / R); EgM23(F\R); EG FP(F / R) multiple primers were used to identify the virus rescued by blind propagation for 6 generations, and the virus was repeatedly frozen and thawed at -80℃ for 3 times, and RNA was extracted and reverse transcribed into cDNA. Plasmid was used as a positive control and uninfected cells were used as a negative control. The target bands of 1,350bp, 891bp, 1,443bp, 591bp, and 798bp were amplified respectively. The gene sequence comparison result coincided with 100%, indicating that the gene structure of the recombinant virus was complete, the virus was successfully rescued, and the exogenous gene was genetically stable.

[0131] 3. Recombinant virus electron microscopy

[0132] The cells infected at the tenth generation were prepared for electron microscopy. The results were as follows: Figure 8 As shown, electron microscopy can be used to observe that the virus particles aggregated in the cell cytoplasm are in a bullet-like shape, with a length of 349.27 nm and a diameter of 148.47 nm, indicating that the recombinant virus has the shape and structure of the rabies virus, indicating that the Echinococcus granulosus EgM123 gene recombinant SRV9 rabies virus was successfully rescued.

[0133] 4. Fluorescence quantitative PCR virus identification

[0134] Take the supernatant of the 9th, 10th, 11th, 12th and 13th generation viruses for fluorescence quantitative PCR virus identification. The results are as follows: Fig. 9 As shown, the viral expression of the 11th, 12th, and 13th generations increased significantly compared with the 9th and 10th generations (P < 0.05). There was no significant increase in viral expression between the 9th and 10th generations (P > 0.05).

[0135] 5. Results of LD50 toxicity test of recombinant virus

[0136] The mortality of suckling mice was observed for 21 days, as shown in Table 11, and the LD50 titer of the recombinant virus was calculated according to the Spearman-Karber method.

[0137] Table 11 Recombinant virus LD50 Toxicity assay results

[0138]

[0139] 6. Antibody testing

[0140] The results are as follows Fig.10 As shown, 14 days after immunization, the secretory IgG content of the virus + adjuvant group was higher than that of the PBS (control group) and the virus group, and the secretory IgA content of the virus + adjuvant group was significantly higher than that of the PBS (control group) and the virus group.

[0141] In summary, the present invention deletes the pseudogene ψ of the G gene of the SRV9 virus, inserts the exogenous genes EgM123 and eGFP into the deleted pseudogene, and inserts the exogenous gene at the pseudogene in the CD region of the G gene, which will not affect the replication of the virus itself. The recombinant virus was initially identified by directly observing the fluorescence of the cells after transfection to determine whether it was successfully rescued. The recombinant virus was then inoculated into BSR cells with an MOI of 0.1. After infection for 5 generations, each gene fragment could still be detected by RT-PCR, indicating that the recombinant virus had good genetic stability.

[0142] The present invention successfully rescued the EgM123 gene recombinant rabies virus strain, laying a foundation for subsequent research on EgM123 and new rabies vaccines.

[0143] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0144] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A recombinant rabies virus attenuated strain, characterized in that: By deleting the pseudogene ψ of the SRV9 virus G gene, the exogenous gene EgM123 and eGFP were inserted into the deleted pseudogene position, and then the Echinococcus granulosus EgM123 recombinant rabies virus attenuated strain was rescued through transfection; The nucleotide sequence of the pseudogene ψ is shown in SEQ ID NO.

19.

2. A method for constructing a recombinant rabies virus attenuated strain according to claim 1, characterized in that: The steps include: The N, P, G and L genes of SRV9 virus were synthesized and inserted into the pcDNA4 / myc-HisB eukaryotic expression vector to construct auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNA4-L; The NPM gene fragment shown in SEQ ID NO.24 was synthesized and recombined into the pcDNA4 / myc-HisB vector by T4 ligase to obtain the pcDNA4-NPM recombinant plasmid; The synthetic sequence is shown in SEQ ID NO.25 as the rabies virus SRV9 fusion gene G △CD +EgM123+eGFP, then G △CD +EgM123+eGFP gene fragment was recombined into pcDNA4 / myc-HisB vector by T4 ligase to obtain pcDNA4-G △CD +EgM123+eGFP recombinant plasmid; pcDNA4-NPM was linearized by double digestion with Not I and EcoR V restriction endonucleases. △CD +EgM123+eGFP was double-digested with Not I and EcoR V restriction endonucleases to obtain G △CD +EgM123+eGFP gene fragment, using T4 ligase to G △CD +EgM123+eGFP gene fragment was constructed into pcDNA4-NPM vector to obtain the recombinant vector pcDNA4-NPM+G △CD +EgM123+eGFP, collect NPM+G △CD +EgM123+eGFP gene fragment; pcDNA4-L was linearized by EcoR V and PmeⅠ restriction endonucleases to obtain pcDNA4-L vector; NPM+G △CD +EgM123+eGFP gene fragment was recombined with pcDNA4-L linearized vector using Gibson homologous recombination method, and the obtained ligation product was transformed into Stbl3 competent cells to extract pcDNA4-NPM+G △CD +EgM123+eGFP+L recombinant plasmid, i.e., obtaining the full-length cDNA of the Echinococcus granulosus EgM123 gene recombinant rabies virus; pcDNA4-NPM+G ΔCD +EgM123+eGFP+L recombinant plasmid and auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNAg-L were co-transfected into BSR cells to rescue the Echinococcus granulosus EgM123 recombinant rabies virus attenuated strain.

3. The method for constructing a recombinant rabies virus attenuated strain according to claim 2, characterized in that: The NPM gene fragment is synthesized by ′ The KpnⅠ restriction site was introduced at the end of the M gene, and a 57 bp hammerhead ribozyme HamRz sequence was introduced. ′ An EcoR V restriction site was introduced into the end, and the spacer sequence between genes was replaced by protein Linker to obtain the NPM gene fragment shown in SEQ ID NO.

24.

4. The method for constructing a recombinant rabies virus attenuated strain according to claim 2, characterized in that: The rabies virus SRV9 fusion gene G △CD The construction process of +EgM123+eGFP was as follows: the gene ψ in the CD region of the G gene was deleted, the Echinococcus granulosus EgM123 gene was inserted, and the green fluorescent protein eGFP gene was added. ′ The EcoR V restriction site was introduced at the 3 ′ A NotI restriction site was introduced at the end, and a protein linker was introduced between the gene sequences to synthesize the rabies virus SRV9 fusion gene G shown in SEQ ID NO.

25. △CD +EgM123+eGFP.

5. The method for constructing a recombinant attenuated rabies virus strain according to claim 2, characterized in that: The rescue process is as follows: the full-length plasmid pcDNA4-NPM+G ΔCD +EgM123+eGFP+L and auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNAg-L were added to the resuspension of BSR cells, and the full-length cDNA and auxiliary plasmids were co-transfected into BSR cells using electroporation technology to rescue the recombinant rabies virus attenuated strain.

6. The method for constructing a recombinant attenuated rabies virus strain according to claim 5, characterized in that: Full-length plasmid pcDNA4-NPM+G ΔCD The usage ratio of +EgM123+eGFP+L and auxiliary plasmids pcDNA4-N, pcDNA4-P, pcDNA4-G and pcDNAg-L is 4.12μL~4.32μL:1.0μL~1.2μL:0.6μL~0.8μL:0.80μL~0.84μL; The full-length plasmid pcDNA4-NPM+G ΔCD The concentration of +EgM123+eGFP+L is 0.9ng / μL~1.0ng / μL; the concentration of the auxiliary plasmid pcDNA4-N is 1.40ng / μL~1.43ng / μL; the concentration of the auxiliary plasmid pcDNA4-P is 1.40ng / μL~1.43ng / μL; the concentration of the auxiliary plasmid pcDNA4-G is 1.39ng / μL~1.40ng / μL; the concentration of the auxiliary plasmid pcDNAg-L is 1.21ng / μL~1.22ng / μL.

7. The method for constructing a recombinant attenuated rabies virus strain according to claim 5, characterized in that: The electroporation parameters are: 125v-130v, 24ms-25ms, 2-3 times, 0.4mm-0.5mm.

8. Use of the recombinant attenuated rabies virus strain according to claim 1 in the preparation of oral rabies vaccine.

Images