Application of soybean nuclear stem cell factor-like gene GmNSN1

Abstract

The application discloses application of a soybean nuclear stem cell factor coding gene GmNSN1. The application of the soybean nuclear stem cell factor coding gene GmNSN1 shown in SEQ ID NO. 1 in genetic engineering modification of soybean resistance to Spodoptera litura is disclosed. Mutating the gene can significantly improve the resistance of soybean to Spodoptera litura. The soybean nuclear stem cell factor coding gene GmNSN1 can be transformed into soybean by constructing a gene editing vector and genetically engineering, the GmNSN1 gene is directionally mutated, and the resistance of soybean to Spodoptera litura is regulated.

Description

TECHNICAL FIELD

[0001] The application relates to application of nucleostemin-like 1 (GmNSN1) gene, and belongs to the field of genetic engineering. BACKGROUND

[0002] Soybean (Glycine max (L.) Merr.) is an important oil crop, which provides high-quality plant protein and oil for human beings, and is a raw material for processing a large number of traditional foods. In soybean production, insect pests are one of the main factors leading to yield reduction. In some soybean production areas, Spodoptera litura is the main leaf-eating pest, which can cause damage to leaves, flowers, pods and young stems of soybean, and can cause absolute loss of soybean in severe cases. Chemical control is the main measure for preventing and controlling Spodoptera litura at present, but the persistent pollution caused by chemical pesticides is immeasurable to human health. Cultivation and utilization of soybean pest-resistant varieties can effectively reduce the use of pesticides, realize green prevention and control of pests, and ensure stable and increased yield of soybean.

[0003] In previous studies, an insect-resistant locus was located on chromosome 10 of soybean, and bioinformatics prediction found that only the nucleostemin-like 1 (NSN1) gene GmNSN1 encoding gene in the locus was highly expressed in various tissues. Nucleostemin (NS) is a nucleolar GTP-binding protein, which is first found in the nucleolus of mouse neural stem cells, and mainly participates in stem cell proliferation, cell cycle maintenance, ribosome and embryogenesis. Nucleostemin-like 1 (NSN1) with the same domain as mammalian nucleostemin is identified in Arabidopsis thaliana, and plant NSN1 regulates embryonic development and seedling growth, and is highly expressed in developing embryos, flowers, stem tip meristems and organ primordia. No functional research on GmNSN1 gene in soybean has been carried out, and no insect-resistant related report has been found. SUMMARY

[0004] The purpose of the present application is to disclose the application of the nucleostemin-like 1 (GmNSN1) gene in insect-resistant genetic engineering of soybean.

[0005] The purpose of the present application can be achieved by the following technical solutions.

[0006] The nucleostemin-like 1 (GmNSN1) gene in genetic engineering can change the resistance of soybean to Spodoptera litura. The coding region sequence of the nucleostemin-like 1 (GmNSN1) gene is shown as SEQ ID NO. 1.

[0007] As a preferred embodiment of the present application, knocking out the nucleostemin-like 1 (GmNSN1) gene can improve the resistance of soybean to Spodoptera litura.

[0008] The application of the gene editing vector of the soybean nuclear stem cell factor gene GmNSN1 in improving the resistance of soybean to Spodoptera litura.

[0009] The application of the gene editing vector of the soybean nuclear stem cell factor gene GmNSN1 in constructing soybean varieties with resistance to Spodoptera litura.

[0010] Beneficial effects:

[0011] GmNSN1 is a soybean nuclear stem cell factor gene that regulates the resistance of soybean to Spodoptera litura. Tissue expression analysis proves that GmNSN1 is expressed in all tissues of soybean, and the expression amount is the highest in the leaves of resistant materials. Through gene editing technology and genetic transformation, it is found that the transgenic soybean with GmNSN1 gene knockout has significantly enhanced resistance to Spodoptera litura. Therefore, GmNSN1 can be used as a target for regulating the resistance of soybean to Spodoptera litura, and for the improvement of the resistance of soybean to pests. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 Agarose gel electrophoresis map of GmNSN1 cloning. The full-length target fragment is 1719 bp. KF1: Kefeng No. 1; M: DL2000 molecular marker.

[0013] Figure 2 Tissue expression pattern of GmNSN1. N=3.

[0014] Figure 3 Editing type of GmNSN1 gene in homozygous knockout lines. WT: receptor Jack, KO#2, 3, 4, 4-2: four gmnsn1 mutant lines.

[0015] Figure 4 Identification of T2 generation gmnsn1 mutant lines for resistance to Spodoptera litura. (A) Spodoptera litura larvae after 2 days of feeding. (B) Relative growth rate of Spodoptera litura larvae after 2 days of feeding; (C) Jack, gmnsn1 mutant leaves after 2 days of feeding Spodoptera litura larvae. Scale bar: 5 cm. *: P<0.05; **: P<0.01; ****: P<0.0001. DETAILED DESCRIPTION

[0016] The application will be further described below in conjunction with the drawings and examples.

[0017] The methods used in the following examples are conventional methods unless otherwise specified.

[0018] Example 1 Expression pattern of soybean GmNSN1 gene

[0019] 1) Cloning of soybean GmNSN1 gene

[0020] Total RNA was extracted from the leaves of soybean variety KeFeng No.1 by using a total RNA extraction kit (Total RNA Kit, Tiangen), and cDNA first strand was obtained by reverse transcription according to the instructions of the reverse transcription kit (HiScript III 1st Strand cDNA Synthesis Kit, Vazyme, Nanjing, R123-01) using total RNA as the template. According to the mRNA sequence of GmNSN1 on the soybean genome in the Phytozome v13 database (Glyma.10G122200), specific primers were designed, and the primer sequence for amplifying the gene was F: TCCTTCCCCTTTTCGAGACGA; R: TATGGCAAGTCCATTTCCCCC. The above-mentioned cDNA obtained from the leaves of KeFeng No.1 was used as the template for PCR amplification, and the PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 1 minute and 45 seconds, a total of 35 cycles, and finally 72℃ for 5 minutes. After the PCR product was sequenced, the CDS sequence of the GmNSN1 gene with a complete coding region was obtained, wherein the coding region sequence is SEQ ID NO. 1, the length is 1719 bp( Figure 1 ), and the amino acid sequence is SEQ ID NO. 2.

[0021] KeFeng No.1 is a soybean material resistant to Helicoverpa armigera. KeFeng No.1 material was planted in the field and managed routinely. The roots, stems, and leaves of KeFeng No.1 at V4 stage, the flowers at R2 stage, the pods 15 days after flowering, and the seeds 45 days after flowering were quickly frozen in liquid nitrogen and stored at -80℃ for standby. The total RNA of each tissue was extracted and reverse transcribed into cDNA. Real-time fluorescent quantitative PCR reaction was used to analyze the relative expression amount of GmNSN1 in different tissues of two materials, and two-tailed t test was used for the significance of the relative expression amount of genes between tissues. The primer sequences for GmNSN1 fluorescent quantitative analysis were F: ttttgctgtccgttggaggt and R: tgtttgccgcgttggatatt, and soybean gene Tubulin (Glyma.03g124400) was used as an internal reference, and the primer sequences were F: ggagttcacagaggcagaga and R: cacttacgcatcacatagca. The results showed that GmNSN1 was expressed in different tissues of KeFeng No.1( Figure 2 ), and the expression amount in the leaves was the highest.

[0022] Example 2 Genetic engineering application of gene GmNSN1

[0023] 1) Creation of GmNSN1 gene soybean mutant

[0024] Three sgRNA target sites of GmNSN1 gene were designed online by CRISPR-P2.0 website (http: / / CRISPR.hzau.edu.cn / CRISPR / ) and inserted into CRISPR / Cas9 vector PSC-M for soybean gene editing (Du et al. 2016). The recombinant vector was introduced into Agrobacterium tumefaciens strain EHA105 and transformed into soybean cultivar Jack through cotyledon node. The three sgRNA sequences were: sgRNA1: ACAAAAGAAAGCCGAACGCA, sgRNA2: GCAGGAACTCAAGGCCCTCG, sgRNA3: GCGAAGGGCGAAGGCAATTG. Specific primers were designed near the target site, the primers of sgRNA1 were U3sgRNA1-F2: ACAAAAGAAAGCCGAACGCAGTTTTAGAGCTAGAAATAGCAAG, U3sgRNA1-R2: TGCGTTCGGCTTTCTTTTGTTGACCAGACATGTCACGCTTAGT, linked with intermediate vector U3 (Du et al. 2016), and the primers of sgRNA2 and sgRNA3 were U6sgRNA2-F1: GCAGGAACTCAAGGCCCTCGGTTTTAGAGCTAGAAATAGCAAG, U6sgRNA2-R1: CGAGGGCCTTGAGTTCCTGCAATCCATATGTTTTCCTGGGAC, U6SgRNA3-F3: GCGAAGGGCGAAGGCAATTGGTTTTAGAGCTAGAAATAGCAAG, U6SgRNA3-R3: CAATTGCCTTCGCCCTTCGCAATCCATATGTTTTCCTGGGAC, linked with intermediate vector U6 (Du et al. 2016). The editing site was amplified by PCR reaction, and the GmNSN1 gene editing of transgenic soybean was detected by PCR product sequencing. The primer sequences were: sgRNA-F: CCTAAGTATATCTTTCGCCT, sgRNA-R: ACATCGAGTACCCAATGGAT. Three GmNSN1 gene edited single plants (KO#2, 3, 4) were obtained in T0 generation, and 12 homozygous gmnsn1 mutants were obtained through breeding and PCR product sequencing detection, with four editing types, KO#2, 3, 4, 4-2( Figure 3 ), of which KO#4 and 4-2 were different editing types from a T0 single plant.

[0025] 2) GmNSN1 gene knockout improves soybean resistance to Spodoptera litura

[0026] The insect resistance of soybean mutant gmnsn1 was further evaluated by forced feeding Spodoptera litura larvae test. Four homozygous mutant T2 lines of gmnsn1 and Jack were used for insect resistance identification. Four well-grown and uniform second instar larvae of S. litura were placed on the fourth pair of trifoliate leaves of the recipient and knockout lines (V4), and white mesh bags were used to cover the leaves to prevent the larvae from escaping. The weight of the larvae before feeding (W0) and after feeding for 2 days (W1) was measured, and the relative growth rate (RGR) of the larvae per day was calculated. The insect resistance of gmnsn1 mutant was evaluated by the relative growth rate, and the calculation formula was: RGR = (W1-W0) / (2*W0)*100%. The results showed that the relative growth rate of larvae feeding on four types of gmnsn1 mutants was significantly lower than that of the control group feeding on Jack, and the degree of leaf area loss was also lower than that of the control group. Figure 4 ) These results showed that knocking out GmNSN1 gene in soybean significantly improved the resistance of plants to S. litura.

[0027] References:

[0028] Du H, Zeng X, Zhao M, et al. Efficient targeted mutagenesis in soybean by TALENs and CRISPR / Cas9, Journal of Biotechnology, 2016, 217: 90-97.

Claims

1. Knocking out a Glycine max nuclear stem cell factor-like encoding gene GmNSN1 In use in improving the resistance of Glycine max to Spodoptera litura, the Glycine max nuclear stem cell factor-like encoding gene GmNSN1 The coding region sequence is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, knocking out the nuclearembryonic factor-like encoding gene of soybean as claimed in claim 1 by gene editing means GmNSN1 increasing the resistance of soybean to Spodoptera litura 3. The gene encoding the soybean nuclear stem cell factor-like of claim 1 GmNSN1 Use of the gene knockout vector of claim 1 in improving soybean resistance to Helicoverpa armigera.

4. The soybean nuclear factor-like gene encoding gene as set forth in claim 1 GmNSN1 application of the gene knockout vector in constructing soybean varieties with resistance to Heliothis zea.

Images