Wheat drought tolerance gene TaWAK5, protein encoded by the gene and application

By regulating the expression and activity of the wheat TaWAK5 gene, the problem of insufficient drought resistance in wheat was solved, and its survival rate and thousand-grain weight under drought conditions were improved or reduced.

CN119955844BActive Publication Date: 2026-05-01INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510339992.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2026-05-01
Estimated Expiration
2045-03-21

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the drought resistance of wheat, thus affecting the sustainable development of grain production.

Method used

Drought resistance in wheat plants can be improved or reduced by overexpressing or knocking out the TaWAK5 gene to regulate its protein expression and activity.

Benefits of technology

It can significantly improve or reduce the survival rate and thousand-grain weight of wheat under drought conditions, and enhance or weaken its drought resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005322879620000011
    Figure HDA0005322879620000011
  • Figure HDA0005322879620000012
    Figure HDA0005322879620000012
  • Figure HDA0005322879620000013
    Figure HDA0005322879620000013
Patent Text Reader

Abstract

The application discloses a wheat drought-tolerant gene TaWAK5, a coding protein thereof and application thereof. The application provides application of the protein TaWAK5 or a related biological material thereof in A1) or A2) as follows: A1) improving drought resistance of plants; and A2) cultivating drought-resistant plants. Experiments of the application show that overexpression of the TaWAK5 gene in plants can significantly improve the drought resistance of the plants, and knockout of the TaWAK5 gene can significantly reduce the drought resistance of the plants. This fully shows that the TaWAK5 protein and the coding gene thereof can regulate the drought resistance of the plants, and have great production and application potential.
Need to check novelty before this filing date? Find Prior Art

Description

wheat drought-resistant gene TaWAK5 and its encoded protein and applications Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and relates to the wheat drought-resistant gene TaWAK5, its encoded protein, and its applications. Background Technology

[0002] Drought is one of the key limiting factors restricting global food production. Studies show that drought-induced food yield reductions account for about half of the world's total food yield reductions. Wheat, as one of the three major staple crops for humankind and a major food crop in arid and semi-arid regions, is severely affected by drought (Gale 2002, Interim Science Council Secret Agriculture Food and Agriculture Organization of the United Nations, pp. 1-27). Therefore, discovering and utilizing drought-resistant genes in wheat and breeding new drought-resistant varieties are crucial for addressing climate change, ensuring food and water security, and are also effective ways to ensure the sustainable development of wheat production. Summary of the Invention

[0003] The technical problem solved by this invention is to provide the application of the TaWAK5 gene in improving wheat drought resistance and breeding.

[0004] To solve the above-mentioned technical problems, the first aspect of the present invention relates to the application of protein TaWAK5 or related biological materials in the following A1) or A2):

[0005] A1) Improve plant drought resistance;

[0006] A2) Cultivate drought-resistant plants;

[0007] The protein TaWAK5 is derived from wheat (Triticum aestivum L.) and is classified as either B1, B2, B3, or B4.

[0008] B1) The amino acid sequence is that of the protein shown in SEQ ID No. 2;

[0009] B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2;

[0010] B3) Proteins with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2.

[0011] B4) is a protein that has 80% or more identity with the amino acid sequence defined by SEQ ID No. 2, is derived from a plant, and has the same biological function.

[0012] In the above text, identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI website. Specifically, in Advanced BLAST 2.1, the program is set to blastp, the Expect value is set to 10, all filters are set to OFF, BLOSUM62 is selected as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio are set to 11, 1, and 0.85 (default values), respectively. This allows for the search and calculation of the identity of a pair of amino acid sequences, resulting in an identity value (%). Here, 75% and above identity encompasses 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0013] In the above text, a tag is a polypeptide or protein fused with the target protein using in vitro DNA recombination technology. Its function is to facilitate the expression, detection, tracking, and / or purification of the target protein. Common tags include Poly-Arg, Poly-His, FLAG, Strep-tagII, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0014] The improvement of plant drought resistance mentioned above can be reflected in increased survival rate under drought conditions and / or increased thousand-grain weight under drought conditions.

[0015] In the above-described applications, the TaWAK5-related biomaterial is any one of C1) to C7):

[0016] C1) The nucleic acid molecule encoding the protein TaWAK5;

[0017] C2) contains an expression cassette containing the nucleic acid molecule described in C1);

[0018] C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2);

[0019] C4) Recombinant microorganisms containing the nucleic acid molecules described in C1), or recombinant microorganisms containing the expression cassette described in C2), or recombinant microorganisms containing the recombinant vector described in C3);

[0020] C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2);

[0021] C6) Transgenic plant tissue containing the nucleic acid molecules described in C1), or transgenic plant tissue containing the expression cassette described in C2);

[0022] C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2).

[0023] In the above text, nucleic acid molecules can be DNA, such as cDNA, genomic DNA, or recombinant DNA; or they can be RNA, such as mRNA or hnRNA.

[0024] Those skilled in the art can easily mutate the nucleotide sequence encoding the TaWAK5 protein of this invention using known methods, such as directed evolution and point mutation. Any nucleotide that, after artificial modification, possesses 75% or higher identity with the nucleotide sequence encoding the TaWAK5 protein of this invention and has its function is considered a nucleotide sequence derived from this invention and is equivalent to the sequence of this invention.

[0025] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" encompasses nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the protein encoding the amino acid sequence shown in SEQ ID No. 2 of this invention. Identity can be determined visually or assessed using computer software. When using computer software, the identity between two or more sequences is expressed as a percentage (%) to measure the identity between related sequences.

[0026] In the above applications, the stringent conditions are as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS.

[0027] The aforementioned 75% or higher degree of identity can specifically be 80%, 85%, 90%, or 95% or higher degree of identity.

[0028] The expression cassette, as described above, refers to DNA that can express the TaWAK5 protein in host cells. This DNA contains not only a promoter to initiate TaWAK5 gene transcription but also a terminator to terminate it. Furthermore, the expression cassette may also contain enhancer sequences.

[0029] The vector mentioned above can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid can be the pWMB110 vector. More specifically, the recombinant vector can be pWMB110-TaWAK5, which is a wheat vector overexpressing TaWAK5 obtained by inserting the DNA molecule represented by nucleotides 1-2145 from the 5' end of SEQ ID No. 1 into the binary vector pWMB110, while keeping the other nucleotides of the binary vector pWMB110 unchanged.

[0030] In the application described above, the nucleic acid molecule encoding the protein TaWAK5 is either D1), D2), D3), or D4):

[0031] D1) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 1;

[0032] D2) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 3;

[0033] D3) has 90% or more identity with the nucleotide sequence defined by D1) or D2) and is derived from a plant DNA molecule that encodes the protein TaWAK5.

[0034] D4) hybridizes under stringent conditions with a nucleotide sequence defined by D1) or D2) and encodes the DNA molecule that contains the protein TaWAK5.

[0035] In a second aspect, the present invention provides the use of a substance that inhibits the activity of the protein TaWAK5 described in the first aspect or inhibits the expression of a nucleic acid molecule encoding the protein TaWAK5 described in the first aspect in the following E1) or E2):

[0036] E1) Reduces plant drought resistance;

[0037] E2) Cultivate plants with low drought resistance.

[0038] The reduction in plant drought resistance mentioned above can be reflected in a decrease in survival rate and / or a reduction in thousand-grain weight under drought conditions.

[0039] In the above-described application, the substance is a CRISPR system that inhibits the expression of nucleic acid molecules encoding the protein TaWAK5;

[0040] The CRISPR system includes sgRNA that targets a nucleic acid molecule encoding the protein TaWAK5.

[0041] The target sites of the sgRNA are target site 1 and target site 2;

[0042] The nucleotide sequence of target 1 is positions 557-576 of SEQ ID No. 3;

[0043] The nucleotide sequence of target 2 is positions 740-759 of SEQ ID No. 3.

[0044] The CRISPR system described above includes a vector for expressing sgRNA. The backbone of this vector can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid vector backbone can be pCBC-MT1T2 or pBUE414. The vector for expressing sgRNA can be the TaWAK5 gene-editing wheat vector from Example 1.

[0045] In the above applications, the microorganism can be yeast, bacteria, algae, or fungi. Among them, bacteria can be Agrobacterium, such as Agrobacterium EHA105.

[0046] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not contain propagation material.

[0047] Thirdly, the present invention provides a method for improving plant drought resistance, as follows: F1) or F2):

[0048] The method described in F1) includes the following steps: increasing the content and / or activity of protein TaWAK5 in the target plant to improve the plant's drought resistance;

[0049] The method described in F2) includes the following steps: increasing the expression of nucleic acid molecules encoding the protein TaWAK5 in the target plant to improve the plant's drought resistance;

[0050] The target plant contains a nucleic acid molecule encoding the protein TaWAK5;

[0051] The protein TaWAK5 is B1, B2, B3, or B4.

[0052] B1) The amino acid sequence is that of the protein shown in SEQ ID No. 2;

[0053] B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2;

[0054] B3) Proteins with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2.

[0055] B4) is a protein that has 80% or more identity with the amino acid sequence defined by SEQ ID No. 2, is derived from a plant, and has the same biological function.

[0056] The improvement of plant drought resistance mentioned above can be reflected in increased survival rate under drought conditions and / or increased thousand-grain weight under drought conditions.

[0057] Fourthly, the present invention provides a method for cultivating highly drought-resistant plants, comprising the following steps: increasing the content and / or activity of the protein TaWAK5 described in the first aspect in the starting plant to obtain a transgenic plant, which is the target plant;

[0058] The genetically modified plant exhibits higher drought resistance than the original plant.

[0059] Fifthly, the present invention provides a method for cultivating highly drought-resistant plants, comprising the following steps: increasing the expression of the nucleic acid molecule encoding the protein TaWAK5 in the first aspect in the starting plant to obtain a transgenic plant, which is the target plant;

[0060] The genetically modified plant exhibits higher drought resistance than the original plant.

[0061] In the above text, the plant referred to is either N1), N2), or N3):

[0062] N1) Monocotyledonous or dicotyledonous plants;

[0063] N2) Gramineae plants;

[0064] N3) Wheat.

[0065] The drought resistance of the transgenic plant mentioned above is higher than that of the originating plant, which can be reflected in the fact that the survival rate of the transgenic plant is higher than that of the originating plant under drought conditions, and / or the thousand-grain weight of the transgenic plant is higher than that of the originating plant under drought conditions.

[0066] The recombinant vectors mentioned above can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0067] The target plants mentioned above include not only first-generation plants in which the gene encoding the TaWAK5 protein has been altered, but also their progeny. For target plants, the gene can be propagated within the species or transferred to other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The target plants include seeds, callus tissue, intact plants, and cells.

[0068] The experiments of this invention show that overexpression of the TaWAK5 gene in plants significantly improves their drought resistance, while knockout of the TaWAK5 gene significantly reduces their drought resistance. This fully demonstrates that the TaWAK5 protein and its encoding gene can regulate plant drought resistance and have great potential for production applications.

[0069] The present invention will now be described in more detail with reference to specific embodiments. The given embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. The embodiments provided below can be used as a reference for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0070] Figure 1 shows the detection results of transgenic lines overexpressing the TaWAK5 gene.

[0071] Figure 2 shows the sequence changes of the gene-edited strains.

[0072] Figure 3 shows the results of drought resistance testing under repeated droughts.

[0073] Figure 4 shows the results of the thousand-grain weight test. Detailed Implementation

[0074] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0075] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0076] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0077] Fielder wheat: A gift from the laboratory of Xin Mingming, China Agricultural University. Hexaploid common wheat, bred in the United States in 1974, is commonly used for Agrobacterium-mediated transformation and gene editing receptors. Reference: Sato K, Abe F, Mascher M, Haberer G, Gundlach H, Spannagl M, Shirasawa K, Isobe S. Chromosome-scale genome assembly of the transformation-amenable common wheat cultivar 'Fielder'. DNARes. 2021 Jun 25;28(3):dsab008.doi:10.1093 / dnares / dsab008.PMID:34254113;PMCID:PMC8320877.

[0078] Agrobacterium tumefaciens EHA105: Reference: Torisky RS, Kovacs L, Avdiushko S, Newman JD, Hunt AG, Collins GB. Development of a binary vector system for plant transformation based on the supervirulent Agrobacterium tumefaciens strain Chry5. Plant Cell Reports, (1997) 17: 102-108.; It can be obtained from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0079] Information regarding the pWMB110 vector is documented in the following literature: Liu H, Wang K, Jia Z, Gong Q, Lin Z, Du L, Pei X, Ye X. Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium-mediated CRISPR system. J Exp Bot. 2020 Feb 19; 71(4):1337-1349. doi:10.1093 / jxb / erz529.PMID:31760434; PMCID:PMC7031065. In this literature, it is referred to as The plasmid pWMB110 or pWMB110.

[0080] Plasmids pCBC-MT1T2 and pBUE414 are recorded in the following documents: Plant Biotechnol J.2021Dec24;20(5):862-875.doi:10.1111 / pbi.13765; TaMOR is essential for root initiation and improvement of root system architecture in wheat; Chaonan Li, Jingyi Wang, Long Li, Jialu Li, Mengjia Zhuang,Bo Li,Qiaoru Li,Junfang Huang,Yan Du,JinpingWang,Zipei Fan,Xinguo Mao,Ruilian Jing.

[0081] Example 1: TaWAK5 gene

[0082] The nucleotide sequence of the genomic DNA of the TaWAK5 gene is SEQ ID No. 3; the nucleotide sequence of the cDNA of the TaWAK5 gene is SEQ ID No. 1; the protein encoded by the TaWAK5 gene is TaWAK5, and its amino acid sequence is SEQ ID No. 2.

[0083] Example 2: Functional study of the TaWAK5 gene

[0084] I. Construction of transgenic wheat overexpressing TaWAK5

[0085] 1. Construction of recombinant overexpression vector

[0086] In this experiment, the pWMB110 vector was selected as the original vector.

[0087] Total RNA was extracted from mixed tissue samples of wheat variety Hanxuan 10, and cDNA was successfully obtained through reverse transcription. Using this cDNA as a template, PCR amplification was performed using primer pair F (5′-ATGTCGCCGATGGCATGGATG-3′) and primer R (5′-TCGAGGGTAGCTCGCGGACAA-3′), yielding the PCR product.

[0088] Sequencing confirmed that the PCR product was the DNA molecule represented by nucleotides 1-2145 from the 5' end of SEQ ID No. 1. The PCR product was then purified and recovered, and ligated into the intermediate T vector to obtain the recombinant intermediate plasmid. The recombinant intermediate plasmid was extracted, and after sequence confirmation, it was used for further processing.

[0089] Using the recombinant intermediate plasmid as a template, the primer F1(5′-CGACTCTAGA) was used. GGAT CC ATGTCGCCGATGGCATGGATG-3′) and primer R1(5′-CGGTACCCGG GGATCC PCR amplification was performed using a primer pair consisting of TCGAGGGTAGCTCGCGGACAA-3′. A high-fidelity Pfu amplification system was used, ultimately yielding PCR products containing homologous arms.

[0090] In the F1 and R1 primers, the underlined part is the Bam HⅠ restriction site; the sequence in front of the underline (on the 5′ side) is the homologous arm, which is the same fragment as the sequence near the insertion site of the vector pWMB110.

[0091] The vector pWMB110 was digested with the restriction endonuclease BamHI, and then approximately 10 kb of the vector backbone was recovered.

[0092] The PCR product containing the homologous arm was ligated with the recovered 10kb vector backbone using a homologous recombination method. Specifically, a seamless ligase (TaKaRa product, catalog number: 638947) was mixed with the two components and incubated at 37°C for 30 min. After routine transformation, the recombinant vector pWMB110-TaWAK5 was successfully obtained.

[0093] Sequencing of pWMB110-TaWAK5 revealed that the vector was obtained by inserting the DNA molecule represented by nucleotides 1-2145 from the 5′ end of SEQ ID No. 1 between the BamHI restriction sites of the pWMB110 vector, while keeping the other nucleotide sequences of the binary vector pWMB110 unchanged, thus obtaining a wheat vector overexpressing TaWAK5.

[0094] 2. Construction of transgenic wheat overexpressing the TaWAK5 gene

[0095] The recombinant vector pWMB110-TaWAK5 was introduced into Agrobacterium tumefaciens EHA105 to obtain the recombinant strain. Then, it was transformed into the wheat variety Fielder (hereinafter also referred to as wild-type wheat) through Agrobacterium-mediated genetic transformation to obtain the T0 generation TaWAK5 wheat. After self-pollination, the homozygous T3 generation TaWAK5 wheat was obtained, which is the transgenic wheat overexpressing the TaWAK5 gene.

[0096] RNA was extracted from leaves of TaWAK5 wheat OE3 and OE6 from the T3 generation of homozygous lines, and cDNA was obtained by reverse transcription. qRT-PCR amplification was performed using primers F3 and R3 to detect the relative expression level of the TaWAK5 gene in each test line. Tubulin gene was used as an internal reference gene, and primers F2 and R2 were used for amplification of the internal reference gene.

[0097] The primer sequences above are as follows:

[0098] Primer F2 (5′-CGTGCTGTCTTTGTAGATCTCG-3′);

[0099] Primer R2(5′-GACCAGTGCAGTTGTCTGAAAG-3′);

[0100] Primer F3 (5′-GAGACTGCCCATCTGAAGAGGAAACC-3′);

[0101] Primer R3 (5′-GTTACCTCTGTGCATCCATCGATAAGGTATG-3′).

[0102] As shown in Figure 1, compared with the recipient material Fielder (WT), the expression level of TaWAK5 gene in the homozygous T3 generation TaWAK5 transgenic wheat OE3 and OE6 was significantly increased, indicating that OE3 and OE6 are transgenic wheat that overexpress the TaWAK5 gene.

[0103] II. Construction of transgenic wheat with TaWAK5 gene knockout

[0104] 1. Construction of recombinant gene editing vectors

[0105] To edit the TaWAK5 gene and obtain gene-edited transgenic wheat, the following series of experiments were conducted:

[0106] 1. Edit site prediction

[0107] The editing site of the TaWAK5 gene was predicted using an online website (http: / / www.e-crisp.org / E-CRISP / ), providing accurate target locations for subsequent gene editing work.

[0108] 2. Primer design

[0109] Based on the sequence characteristics of the TaWAK5 genome, target sites for the TaWAK5 gene were carefully designed (T1 target: positions 557-576 of SEQ ID No. 3, T2 target: positions 740-759 of SEQ ID No. 3). Subsequently, four primers were designed according to the vector usage instructions.

[0110] The specific primer sequences are as follows: upstream primers F (5'-aataatggtctcTGGCgCTGCCACGTCAACATCTCG-3'), F0 (5'-gCTGCCACGTCAACATCTCGgttttagagctagaaatagc-3'); downstream primers R (5'-GTCCAGCCAAAGCGGCATGTGCTTCTTGGTGCCGC-3'), R0 (5'-ATTATTGGTCTCTAAACGTCCAGCCAAAGCGGCATG-3'). The design of these primers is a crucial foundation for the subsequent construction of gene editing vectors.

[0111] 3. Construction of recombinant carriers

[0112] Using plasmid pCBC-MT1T2 as a template, PCR amplification was performed using the four primers F, F0, R0 and R mentioned above, yielding a product of approximately 900 bp.

[0113] The PCR product was then ligated into the pBUE414 vector via homologous recombination to obtain the TaWAK5 gene-editing wheat vector, which contains T1 and T2 target sites.

[0114] 4. Genetic transformation and identification

[0115] The constructed TaWAK5 gene-editing wheat vector was introduced into Agrobacterium tumefaciens EHA105, and then transformed into wheat Fielder (hereinafter referred to as wild-type wheat) using Agrobacterium-mediated genetic transformation. This yielded T0 generation CRISPR knockout transgenic wheat.

[0116] Genomic DNA was extracted from leaves of T0 generation CRISPR knockout transgenic wheat and used as a template. PCR identification was performed using genome-specific primers F4 (5′GATGTCACCTTCAAGGGCCACAC 3′), R4 (5′-GACCATCATGGCTTTTCCATAGCTACTCC-3′), F5 (5′-CTGACATTCAACAAGTGGCGCGTTTAC-3′), and R5 (5′-CAAGCGTATTCTCGCGTCTTGACC-3′). The PCR products were sequenced, and a sense mutation was found compared to the TaWAK5 gene (SEQ ID No. 3) sequence in wild-type wheat Fielder. This was recorded as a positive T0 generation CRISPR knockout transgenic wheat.

[0117] Positive T0 generation CRISPR knockout transgenic wheat was cultured until T3 generation CRISPR knockout transgenic wheat homozygous plants were obtained.

[0118] Genomic DNA was extracted from leaves of T3 generation CRISPR knockout transgenic wheat homozygous plants and used as templates. PCR identification was performed using genome-specific primers F4 (5′-GATGTCACCTTCAAGGGCCACAC-3′), R4 (5′-GACCATCATGGCTTTTCCATAGCTACTCC-3′), F5 (5′-CTGACATTCAACAAGTGGCGCGTTTAC-3′), and R5 (5′-CAAGCGTATTCTCGCGTCTTGACC-3′). The products were then sent for sequencing.

[0119] The sequencing results are shown in Figure 2.

[0120] Compared with the TaWAK5 gene (SEQ ID No. 3) sequence in wild-type wheat Fielder, the following changes were found in the regions corresponding to the TaWAK5 gene on two homologous chromosomes in the T3 generation CRISPR knockout transgenic wheat homozygous plant tawak5-1: a 2bp deletion at target site 1 (SEQ ID No. 3, 573-574) and a 1bp insertion (g) at target site 2 (SEQ ID No. 3, 755-756), resulting in a frameshift mutation and premature termination of translation;

[0121] Compared with the TaWAK5 gene (SEQ ID No. 3) sequence in wild-type wheat Fielder, the following changes were found in the regions corresponding to the TaWAK5 gene on two homologous chromosomes in the T3 generation CRISPR knockout transgenic wheat homozygous plant tawak5-2: a 2bp deletion at target site 1 (SEQ ID No. 3, 573-574), resulting in a frameshift mutation and premature termination of translation.

[0122] The above results indicate that tawak5-1 and tawak5-2 are positive CRISPR knockout transgenic wheat, named CRISPR knockout TaWAK5 transgenic wheat.

[0123] III. Drought Resistance Identification of Genetically Modified Wheat

[0124] In this experiment, the wheat to be tested was used as the research object, including the transgenic recipient wheat variety Fielder (referred to as wild-type wheat, as negative control), T3 generation transgenic wheat OE3 and OE6 that overexpress the TaWAK5 gene, and T3 generation CRISPR knockout TaWAK5 transgenic wheat tawak5-1 and tawak5-2.

[0125] 1. Identification of drought resistance in repeated droughts

[0126] 1) Seed pretreatment: The wheat seeds to be tested were treated with 1% hydrogen peroxide for 1 day to break seed dormancy and prepare for subsequent germination.

[0127] 2) Seedling planting: Select seedlings with consistent germination and growth, and plant them in plastic boxes measuring 56cm×38cm×11cm. Sow 30 seeds for each seedling, then bury the plastic boxes in outdoor soil, ensuring the height of the plastic boxes is level with the ground to simulate a natural growing environment.

[0128] 3) Drought Treatment and Data Statistics: When the seedlings reached the three-leaf stage, the drought treatment group was subjected to drought treatment, i.e., watering was stopped. Twenty-five days after the drought treatment (at which point the phenotypes of wild-type and transgenic wheat plants showed significant differences), all plants were rehydrated. Survival rates were recorded five days after rehydration. Three independent biological replicates were set up to ensure the reliability of the experimental results.

[0129] The formula for calculating seedling survival rate is: Survival rate (%) = Number of surviving plants / Number of planted plants (30) × 100%.

[0130] The experimental results are shown in Figure 3. After rehydration, the survival rate of wild-type wheat was significantly higher than that of CRISPR-knockout TaWAK5 transgenic wheat (tawak5-1 and tawak5-2), but lower than that of transgenic wheat overexpressing the TaWAK5 gene (OE3 and OE6).

[0131] This result indicates that the TaWAK5 gene can regulate drought resistance in wheat seedlings, specifically by: TaWAK5 gene enhancing wheat drought resistance; and knocking out or reducing TaWAK5 gene expression reducing wheat drought resistance.

[0132] 2. Thousand-grain weight test

[0133] The experiment was conducted in a dry greenhouse at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, with two treatments: dryland (DS) and well-watered (WW). The dryland plants were grown in the greenhouse without irrigation throughout their growth period; the well-watered plants were irrigated (750m²) before winter, during the heading stage, and during the flowering stage. 3 ha -1 Each wheat line was sown in 4 rows, with a row length of 2m, a row spacing of 30cm, and 40 seeds per row, under standard field management. After harvest, the thousand-grain weight of each line was measured.

[0134] The experimental results are shown in Figure 4. Under drought stress (DS) conditions, the thousand-grain weight of wild-type wheat was significantly higher than that of CRISPR-knockout TaWAK5 transgenic wheat (tawak5-1 and tawak5-2), but lower than that of transgenic wheat overexpressing the TaWAK5 gene (OE3 and OE6).

[0135] This result indicates that the TaWAK5 gene can regulate the thousand-grain weight of wheat under drought conditions, specifically by: TaWAK5 gene increasing the thousand-grain weight of wheat under drought conditions; and knocking out or reducing the expression of the TaWAK5 gene decreasing the thousand-grain weight of wheat under drought conditions.

[0136] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of increasing the content of protein TaWAK5 in the following A1) or A2): A1) improving plant drought resistance; A2) cultivating drought-resistant plants; wherein the protein TaWAK5 is B1) or B2): B1) the amino acid sequence is the protein shown in SEQ ID No. 2; B2) a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; wherein the plant is wheat.

2. Application of biomaterials related to protein TaWAK5 in the following A1) or A2): A1) Improving plant drought resistance; A2) Cultivating drought-resistant plants; wherein the protein TaWAK5 is B1) or B2): B1) The amino acid sequence is the protein shown in SEQ ID No. 2; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; the relevant biological material of the protein TaWAK5 is any one of C1) to C7): C1) a nucleic acid molecule encoding the protein TaWAK5; C2) contains an expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) A recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2); C6) A transgenic plant tissue containing the nucleic acid molecule described in C1), or a transgenic plant tissue containing the expression cassette described in C2); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2; the plant is wheat.

3. The application according to claim 2, characterized in that: The nucleic acid molecule encoding the protein TaWAK5 is a DNA molecule with the nucleotide sequence shown in SEQ ID No.

1.

4. A method for improving plant drought resistance, the method comprising the following steps: increasing the expression of a nucleic acid molecule encoding the protein TaWAK5 in a target plant to improve plant drought resistance; the target plant contains a nucleic acid molecule encoding the protein TaWAK5; the protein TaWAK5 is B1) or B2): B1) the amino acid sequence is the protein shown in SEQ ID No. 2; B2) a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; the plant is wheat.

5. A method for cultivating highly drought-resistant plants, comprising the following steps: increasing the expression of nucleic acid molecules encoding the protein TaWAK5 of claim 1 in a starting plant to obtain a transgenic plant, which is the target plant; the transgenic plant has higher drought resistance than the starting plant; the plant is wheat.

Citation Information

Patent Citations

  • Application of BnWAK1 gene in regulation and control of sclerotinia rot resistance of brassica napus

    CN116064467A

  • Plant drought tolerance related protein TaHIN1-6A as well as coding gene and application thereof

    CN118546985A