Molecular markers tightly linked to low-phosphorus stress in maize and their application

Abstract

The present invention discloses a molecular marker tightly linked to low-phosphorus stress in corn and its application, belonging to the field of biotechnology. The technical problem solved by the present invention is how to detect the influence of low-phosphorus stress on corn so as to select corn that is less affected by low-phosphorus stress. The molecular marker tightly linked to low-phosphorus stress in the present invention is related to the number of kernels per row under different phosphorus contents. It is a molecular marker related to low-phosphorus stress. The homozygous corn with the molecular marker G is less sensitive to low-phosphorus stress than the homozygous corn with the molecular marker A. It can be used to screen corn genotypes with low-phosphorus tolerance or genotypes with a higher number of kernels per row under low-phosphorus conditions, greatly accelerating the corn breeding process.

Description

Technical Field

[0001] The invention belongs to the field of crop genetic breeding, and particularly relates to a molecular marker closely linked to corn low-phosphorus stress and an application thereof. Background Art

[0002] corn( Zea mays Phosphorus (L.) is one of the world's three major cereal crops, a major source of food, feed, and bioenergy, and plays a vital role in global food security. Phosphorus is one of the three essential nutrients for plant growth. It is not only a component of key cellular molecules such as ATP, nucleic acids, and phospholipids, but also a key regulator of many metabolic processes, such as energy transfer, protein activation, and carbon and amino acid metabolism. Phosphorus deficiency is a typical abiotic stress. Low phosphorus stress not only limits plant growth, development, and yield, but also affects crop quality and seed formation. Much of the cultivated land area exhibits some degree of phosphorus deficiency, but phosphorus fertilizer is expensive and comes from limited and non-renewable phosphate rocks. Furthermore, excessive application of phosphorus fertilizer can lead to large amounts of phosphorus deposited in rivers, causing numerous ecological and environmental problems. Therefore, improving crop phosphorus uptake and utilization is a promising approach to addressing these issues.

[0003] Genome-wide association studies (GWAS) are a method used to detect the association between genetic variation within the genome and phenotypes. Researchers use SNP (single nucleotide polymorphism) chips to perform whole-genome analysis and use statistical methods to identify SNP sites with significant differences between two groups of individuals, thereby locating genes associated with the phenotype. In 2008, the first GWAS was conducted in maize. The authors used 8590 loci in 553 elite inbred lines to identify SNPs that significantly affected the oleic acid content of the grain (BELÓ A, ZHENG P, LUCK S, et al. 2008. Whole genome scan detects an allelic variant of fad2 associated withincreased oleic acid levels in maize [J / OL]. Molecular genetics and genomics: MGG, 279(1): 1-10. https: / / doi.org / 10.1007 / s00438-007-0289-y.). With the release of the "B73" reference maize genome, GWAS has made significant progress and has become a common technique for revealing genotype-phenotype relationships in maize. Compared to QTL mapping, GWAS can achieve single-gene accuracy. These candidate genes identified through GWAS provide a valuable resource for maize gene cloning and functional characterization.

[0004] Competitive allele-specific PCR (KASP) is a highly efficient and accurate genotyping method for detecting single nucleotide polymorphisms (SNPs) in DNA sequences. It utilizes allele-specific PCR with two fluorescently labeled probes designed for the target SNP locus. Genotype determination is based on competitive binding and fluorescence signal intensity. KASP offers advantages such as high throughput, low cost, and ease of use, making it widely used in molecular breeding, medical research, population genetics, and food safety. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to detect the influence of low phosphorus stress on corn so as to breed corn with less influence of low phosphorus stress.

[0006] In order to solve the above technical problems, the present invention first provides an application of a substance for detecting a molecular marker of corn low-phosphorus stress in detecting or assisting in detecting corn low-phosphorus tolerance;

[0007] The maize low phosphorus stress molecular marker is a nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the maize genome, which is G or A.

[0008] In the above application, the substance for detecting the molecular marker of low phosphorus stress in maize may include primers named F1, F2 and R, wherein F1 is a single-stranded DNA containing positions 22-45 of SEQ ID No. 1;

[0009] The F2 is a single-stranded DNA containing positions 22-45 of SEQ ID No. 2;

[0010] The R is a single-stranded DNA shown in SEQ ID No.3.

[0011] Specifically, the F1 may be a single-stranded DNA shown in SEQ ID No. 1;

[0012] The F2 may be a single-stranded DNA shown in SEQ ID No. 2.

[0013] In the above application, the substance for detecting molecular markers of low phosphorus stress in corn also contains reagents other than KASP primers, such as FLU-ARMS for KASP 2× PCR Mix V4 (Guangzhou Good Biotechnology Co., Ltd.).

[0014] In the above application, the substance for detecting molecular markers of low phosphorus stress in corn can be composed of the F1, the F2 and the R, or can be composed of the F1, the F2, the R and the reagents except the KASP primer.

[0015] In the above application, the homozygous corn having a G at the nucleotide position of 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the genome has a lower tolerance to phosphorus than the homozygous corn having an A at the nucleotide position of 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

[0016] The present invention also provides a method for detecting or assisting in detecting corn low-phosphorus tolerance, the method comprising detecting the corn low-phosphorus stress molecular marker and determining the corn low-phosphorus tolerance according to the following method:

[0017] The homozygous corn with a G nucleotide at the 5241160 bp position on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) has a lower tolerance to phosphorus than the homozygous corn with an A nucleotide at the 5241160 bp position on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

[0018] In the above method, the detection of the molecular marker of low phosphorus stress in corn can be carried out using the substance for detecting the molecular marker of low phosphorus stress in corn.

[0019] In the above, the low-phosphorus tolerance of corn can be reflected in the yield of corn (such as the number of kernels per row) under low phosphorus conditions.

[0020] The substance for detecting molecular markers of corn low-phosphorus stress also falls within the protection scope of the present invention.

[0021] The present invention also provides any of the following applications:

[0022] X1) Application of the maize low phosphorus stress molecular marker in maize breeding;

[0023] X2) Use of the maize low-phosphorus stress molecular marker in detecting or assisting in detecting maize low-phosphorus tolerance;

[0024] X3) Application of the substance for detecting molecular markers of corn low-phosphorus stress in corn breeding;

[0025] X4) Use of the substance for detecting molecular markers of corn low-phosphorus stress in the preparation of corn breeding products;

[0026] X5) Use of the substance for detecting molecular markers of corn low-phosphorus stress in the preparation of products for detecting or assisting in detecting corn low-phosphorus tolerance;

[0027] X6) Application of the method for detecting or assisting in detecting low-phosphorus tolerance in maize in maize breeding;

[0028] X7) Detection of a substance in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated March 21, 2020) for use in breeding maize that is less susceptible to low phosphorus stress;

[0029] X8) Application of the detection of a substance in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated March 21, 2020) in the preparation of products for breeding maize that is less susceptible to low phosphorus stress.

[0030] The present invention also provides a corn breeding method, which includes: detecting a nucleotide at 5241160 bp on chromosome 3 of the corn Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the corn genome, and selecting homozygous corn whose nucleotide at 5241160 bp on chromosome 3 of the corn Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the corn genome is G as a parent for breeding.

[0031] In the present invention, the low phosphorus refers to the phosphorus content or available phosphorus content in the soil being lower than the phosphorus content or available phosphorus content required for normal growth of corn.

[0032] In the present invention, the corn can be any corn material in Table 2 or its progeny.

[0033] The corn low-phosphorus stress molecular marker of the present invention is a molecular marker related to low-phosphorus stress. The homozygous corn with the molecular marker G is less susceptible to low-phosphorus stress than the homozygous corn with the molecular marker A. The marker can be used to screen corn genotypes with low-phosphorus tolerance or genotypes with a higher number of kernels per row under low-phosphorus conditions, greatly accelerating the corn breeding process.

[0034] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the violin plot of KNPR_LPTI of two genotypes of maize materials. The phenotypic difference of kernel number per row between H001 and H002 is extremely significant (P-value<0.0001, ****).

[0036] Figure 2 This is the Manhattan plot of the genome-wide association analysis of maize KNPR_LPTI, where the horizontal axis represents the chromosome position of each SNP on chromosome 3; the vertical axis represents the negative logarithm of the P value of each SNP site under the MLM model with base 10. The area above the dotted line in the figure is -log 10 Points with P-value>5.

[0037] Figure 3 This is a QQ plot from the genome-wide association study of maize KNPR_LPTI. The horizontal axis represents the negative logarithm to base 10 of the expected observed P value, assuming a uniform [0, 1] distribution; the vertical axis represents the negative logarithm to base 10 of the actual observed P value. The QQ plot shows that the PCA analysis has eliminated the influence of interpopulation differences on the experimental results.

[0038] Figure 4 The following table shows the results of KASP genotyping of 18 maize accessions. The horizontal axis represents the FAM fluorescence signal intensity, and the vertical axis represents the HEX fluorescence signal intensity. "○" represents AA homozygotes that show FAM fluorescence, and "□" represents GG homozygotes that show HEX fluorescence. DETAILED DESCRIPTION

[0039] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in literature in the field or according to product specifications. The materials, reagents, and instruments used in the following examples are all commercially available unless otherwise noted. The quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged.

[0040] SPSS 11.5 statistical software was used to process the data in the following examples, and a One-way ANOVA test was performed. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated an extremely significant difference, P < 0.001 (***) indicated an extremely significant difference, and P < 0.0001 (****) indicated an extremely significant difference.

[0041] The 252 maize inbred lines used in the following examples were kindly provided by Professor Yang Xiaohong of China Agricultural University and are described in the literature (1. Yang N, Lu Y, Yang X, et al. Genome wide association studies using a new nonparametric model reveal the genetic architecture of 17 agronomic traits in an enlarged maize association panel). PLoS Genet. 2014;10(9):e1004573.Published 2014 Sep 11. doi:10.1371 / journal.pgen.1004573;2.Shete JM, Patel DB, Patel MP, et al. Study of heterosis in top cross derivatives of Maize(Zea mays L.)[J]. Agricultural Science Digest–A Research Journal, 2011, 31(1): 1-7;3.Xu G, Zhang X, Chen W, et al. Population genomics of Zea speciesidentifies selection signatures during maize domestication and adaptation[J].BMC plant biology, 2022, 22(1): 72.), which can be obtained from the applicant or from the China National GeneBank (https: / / db.cngb.org / brc / plant / ).

[0042] Example 1: Discovery and application of molecular markers for low phosphorus stress in maize

[0043] 1. Phenotypic determination

[0044] The experimental material included 252 maize inbred lines, primarily a subset of the 513 populations assembled by Professors Yan Jianbing and Yang Xiaohong. These inbred lines were planted at the Shangzhuang Experimental Station in Beijing in 2018 and 2021. The 2018 plots were low-phosphate (Olsen-P content (i.e., available soil phosphorus content) 2.10 mg / kg) and normal-phosphate (Olsen-P content 4.50 mg / kg); the 2021 plots were low-phosphate (Olsen-P content 2.72 mg / kg) and normal-phosphate (Olsen-P content 4.70 mg / kg). Plant height (PH) was measured at maturity in both 2018 and 2021 and averaged. The best linear unbiased prediction (BLUP) values ​​for these traits were used to construct a secondary indicator, the Low-phosphate Tolerance Index (LPTI):

[0045] KNPR_LPTI=number of grains per row under low phosphorus stress / number of grains per row under normal phosphorus stress.

[0046] 2. Genome-wide association analysis

[0047] 252 maize inbred line materials were sequenced, and the quality control of 980 K high-density SNP markers (MAF>5%; missing rate<20%) was performed using PLINK software. The number of independent markers, window size, step size, and r were calculated using PLINK. 2 The parameters were set to 50, 50, and 0.2, respectively, resulting in 128,197 independent markers. These markers were then combined with the constructed LPTI for GWAS analysis using TASSEL software. A mixed linear model (MLM) was selected, and principal component analysis (PCA) was performed first. The clustering parameter was set to 3, and PCA analysis was performed to control for population stratification. The results were displayed as a QQ plot ( Figure 3 ), and then calculate the kinship matrix to correct for the non-independence of the population. Then perform a genome-wide association analysis of all SNP markers and LPTI values ​​on chromosome 3, with a significance threshold set at -log 10 P-value=5, the results are displayed as Manhattan plot ( Figure 2 ), the Manhattan plot shows that there is a significant SNP at position 5241160 on chromosome 3 (the site is G or A), and the violin plot of the LPTI index of row grain count is drawn using the "ggplot2" package of R studio software (see the specific results for details). Figure 1 The results showed that the difference in kernel number per row under low-phosphorus conditions between haplotype H001 (i.e., homozygous for the AA genotype at this SNP locus) and haplotype H002 (i.e., homozygous for the GG genotype at this SNP locus) was extremely significant (****, P-value < 0.0001). This indicates that maize with the H002 haplotype had a higher kernel number per row under low-phosphorus conditions (Tables 1 and 2). This SNP at chromosome 3 position 5241160 was designated as a molecular marker for low-phosphorus stress in maize.

[0048] The maize low-phosphorus stress molecular marker is located at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

[0049] In Tables 1 and 2, KNPR_LPTI is the ratio of the average number of grains per row under low phosphorus stress to the average number of grains per row under normal phosphorus in 2018 and 2021.

[0050] Table 1. Two haplotypes and their numbers and phenotypes in the GWAS population

[0051]

[0052] Table 2. Genotypes and phenotypes of each material

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060] 3. Using molecular markers of low phosphorus stress in maize to detect the effect of low phosphorus conditions on kernel number per row

[0061] 1) Primer design

[0062] Based on the maize reference genome Zm-B73-REFERENCE-NAM-5.0, 100 bp of flanking sequences were extracted from the maize low-phosphorus stress molecular marker and three primers were designed. Two specific forward primers were linked to FAM and HEX fluorescent linker sequences at their 5' ends, respectively, and one universal reverse primer was used. The primer sequences are as follows (5'-3'):

[0063] Forward specific primer F1: GAAGGTGACCAAGTTCATGCT cacatgaagcaacatgggacctgA (SEQ IDNo.1);

[0064] Forward specific primer F2: GAAGGTCGGAGTCAACGGATT cacatgaagcaacatgggacctgG (SEQ IDNo.2);

[0065] Reverse universal primer R: GCTAACGCCCAGGCCCAGCAATCTCGGAT (SEQ ID No. 3).

[0066] The underlined parts of the forward specific primer F1 and the forward specific primer F2 are fluorescent tag sequences (i.e., FAM and HEX), and the non-underlined parts specifically identify the maize low-phosphorus stress molecular marker and its upstream sequence in the maize genome.

[0067] PCR was performed on corn genomic DNA using two specific forward primers and a reverse universal primer R. If only the fluorescent signal corresponding to the forward specific primer F1, i.e., FAM fluorescence, was detected in the PCR product of the corn to be tested, the detection site was A, and the number of kernels in a row of this corn material was greatly affected by low-phosphorus conditions; if only the fluorescent signal corresponding to the forward specific primer F2, i.e., the HEX signal, was detected, the detection site was G, and this corn material was less affected by low-phosphorus conditions.

[0068] 2) Detection of corn genotype and phenotype

[0069] Eighteen maize accessions were randomly selected from 252 maize inbred lines, and genomic DNA was extracted. The DNA template concentration was measured to be approximately 10 ng / µl, which was suitable for subsequent analysis.

[0070] The PCR reaction system for the KASP experiment was as follows: 4.5 μl of genomic DNA, 0.1 μl of forward-specific primer F1 (10 μM), 0.1 μl of forward-specific primer F2 (10 μM), 0.3 μl of reverse-specific primer R (10 μM), and 5 μl of FLU-ARMS for KASP 2×PCR Mix V4 (Guangzhou Good Biotechnology Co., Ltd.).

[0071] PCR reaction conditions are as follows:

[0072]

[0073] The KASP reaction products were read using a BIORAD CFX96 fluorescence quantitative PCR instrument, and the fluorescence scanning results were converted into graphics using EXCEL.

[0074] The results of marker typing are as follows Figure 4 The phenotypes and genotypes of each material in 2021 are shown in Table 3, where "○" represents AA homozygotes showing FAM fluorescence, and "□" represents GG homozygotes showing HEX fluorescence. The results showed that the average LPTI of the GG genotype was 0.8695, and the average LPTI of the AA genotype was 0.4919, which was significantly lower than that of the GG genotype. The GG genotype was less affected by low phosphorus stress, while the AA genotype was more affected by low phosphorus stress.

[0075] In Table 3, LPTI is the ratio of the number of grains per row under low phosphorus stress to the number of grains per row under normal phosphorus in 2021.

[0076] Table 3. Genotypes of 18 maize materials and their kernel number per row under low-phosphorus and normal-phosphorus conditions

[0077]

[0078]

[0079] These results demonstrate that the present invention's molecular marker for low-phosphorus stress in maize is associated with kernel number per row under low-phosphorus conditions, and can be used to detect the effect of low-phosphorus conditions on kernel number per row in maize. Testing SNP markers and selecting maize materials with the GG genotype for breeding can rapidly produce maize with a higher kernel number per row trait under low-phosphorus conditions.

[0080] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Application of substances that detect molecular markers of maize low-phosphorus stress in detecting or assisting in detecting maize low-phosphorus tolerance; The maize low phosphorus stress molecular marker is a nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the maize genome, which is G or A; The low-phosphorus tolerance of maize with a G at the nucleotide position 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the genome is greater than or has a potential to be greater than that of maize with an A at the nucleotide position 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

2. The use according to claim 1, characterized in that: The substances for detecting molecular markers of low phosphorus stress in corn include primers named F1, F2 and R, wherein F1 is a single-stranded DNA shown in SEQ ID No. 1; The F2 is a single-stranded DNA shown in SEQ ID No. 2; The R is a single-stranded DNA shown in SEQ ID No.

3.

3. A method for detecting or assisting in detecting low-phosphorus tolerance in maize, the method comprising detecting the maize low-phosphorus stress molecular marker of claim 1 and determining the low-phosphorus tolerance in maize according to the following method: The low-phosphorus tolerance of maize with a G at the nucleotide position 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the genome is greater than or has a potential to be greater than that of maize with an A at the nucleotide position 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

4. The method according to claim 3, wherein: The detection of the molecular marker of low phosphorus stress in corn described in claim 1 is carried out using the substance for detecting the molecular marker of low phosphorus stress in corn described in claim 1 or 2.

5. The use according to claim 1 or 2, or the method according to claim 3 or 4, characterized in that: The corn low-phosphorus tolerance is reflected in the yield of corn under low-phosphorus conditions.

6. Any of the following applications: X1) Use of the maize low-phosphorus stress molecular marker of claim 1 in detecting or assisting in detecting maize low-phosphorus tolerance; X2) Use of the substance for detecting molecular markers of corn low-phosphorus stress as claimed in claim 1 or 2 in the preparation of a product for detecting or assisting in detecting corn low-phosphorus tolerance; X3) Detection of a substance in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated March 21, 2020) for use in breeding maize strains less susceptible to low phosphorus stress; X4) Application of a substance in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated March 21, 2020) in the preparation of products for breeding maize that is less susceptible to low phosphorus stress.

7. Corn breeding methods, including: The nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) was detected in the maize genome, and maize lines with a G at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) were selected as parents for breeding; The low-phosphorus tolerance of maize with a G at the nucleotide position 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the genome is greater than or has a potential to be greater than that of maize with an A at the nucleotide position 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

Images