A molecular marker, SNP primer for identifying common round-headed cabbage and their applications

Abstract

The present invention belongs to the field of agricultural biotechnology. In particular, the present invention relates to a molecular marker for identifying common cabbages, SNP primers and their applications. Through bioinformatics analysis and screening of the information on SNP sites of cabbages in the vegetable SNP database, the present invention obtained two discriminatory SNP sites, designed specific primer pairs for amplification and verification for these two sites, and through verification and comparison of known materials, it was determined that the SNP sites discovered by the present invention have 100% consistency in identifying common cabbages. The primer pairs of the two SNP sites of the present invention can be used alone or in combination in the identification of common cabbage seeds or cabbage varieties.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology. In particular, the present invention relates to a molecular marker for identifying common headed cabbage, an SNP primer set, and their applications. Background Art

[0002] Cabbage vegetables belong to the Cruciferae family and the Brassica genus, including headed cabbage, Brussels sprouts, kale, cauliflower, broccoli, and Chinese kale, etc. They all have thick, green, waxy-coated leaves with obvious leaf veins and belong to low-temperature long-day crops and green-plant vernalization types. Headed cabbage includes round-headed cabbage, flat-headed cabbage, curly-leaf cabbage, purple cabbage, etc. Headed cabbage is rich in vitamin C, vitamin K, dietary fiber, and various minerals (such as calcium, iron, potassium), and can be eaten fresh, pickled, or cooked, and is widely used in various dishes.

[0003] The commercial uses of headed cabbage, cauliflower, and broccoli are very different, but the seeds of the three look very similar. It is not possible to simply identify headed cabbage by seeds and cotyledons, and it can only be distinguished after the plant variety grows true leaves. This method is time-consuming and laborious and cannot meet the need for rapid variety identification. DNA molecular markers refer to genetic markers based on the variation of nucleotide sequences in the genetic material among individuals and are a direct reflection of genetic variation at the DNA level. Most molecular markers are co-dominant, which is very convenient for the selection of recessive agronomic traits; the genomic variation is extremely rich, and the number of molecular markers is almost infinite: at different stages of biological development, DNA from different tissues can be used for marker analysis; molecular markers reveal variations from DNA: they are neutral, do not affect the expression of target traits, and are not linked to adverse traits; the detection means are simple and rapid. However, there is less research on molecular markers for cabbage. CN202311143372.5 discloses some KASP molecular markers for headed cabbage, but its marker molecules include dozens of SNP sites, and the operation and application are complex. Therefore, it is particularly important to establish a simple and rapid method for identifying common headed cabbage varieties to provide technical support for the identification of cabbage variety populations. Summary of the Invention

[0004] The present invention provides a molecular marker for identifying common headed cabbage, SNP primers, and their applications through extensive research, effectively solving the technical problems of rapid and accurate identification of common headed cabbage.

[0005] Specifically, the technical solutions of the present invention are as follows:

[0006] In one aspect of the present invention, a molecular marker for identifying common round-headed cabbage is provided. The molecular marker is an SNP locus at position 13766456 on chromosome 2 of the cabbage reference genome (version number Brassica oleracea var. oleracea cultivar TO1000v2.1). The nucleotide base at this locus is G or A, that is, A02_13766456G / A. Among them, the A:A homozygous type is the genotype of common round-headed cabbage, and the G:G homozygous type is the genotype of non-common round-headed cabbage; alternatively, the molecular marker is at position 13796934 on chromosome 2, and the nucleotide base at this locus is C or G, that is, A02_13796934C / G. Among them, the C:C homozygous type is the genotype of common round-headed cabbage, and the G:G homozygous type is the genotype of non-common round-headed cabbage.

[0007] In one aspect of the present invention, SNP primers for identifying common round-headed cabbage are provided. The primers are KASP primer pairs for the SNPs of the present invention, and each primer pair includes a first forward primer, a second forward primer, and a universal reverse primer. Among them, in the primer pair for the A02_13766456G / A locus, the base sequence of the first forward primer is as shown in SEQ ID NO.1; the base sequence of the second forward primer is shown in SEQ ID NO.2; the base sequence of the universal reverse primer is shown in SEQ ID NO.3; in the primer pair for the A02_13796934C / G locus, the base sequence of the first forward primer is as shown in SEQ ID NO.4; the base sequence of the second forward primer is as shown in SEQ ID NO.5; the base sequence of the universal reverse primer is as shown in SEQ ID NO.6.

[0008] In the present invention, the primer pair for the A02_13766456G / A locus can be used alone, or the primer pair for the A02_13796934C / G locus can be used alone for identification, or the two primer pairs can be used in combination, that is, a primer group is formed.

[0009] In one aspect of the present invention, a kit for identifying common round-headed cabbage is disclosed. The kit includes the primer pairs provided by the present invention.

[0010] In the above SNP primers for identifying common round-headed cabbage, as a preferred embodiment, different fluorescent adapters are respectively connected to the 5' ends of the first forward primer and the second forward primer in each KASP primer pair. Preferably, FAM (carboxyfluorescein) and HEX (hexachlorofluorescein) fluorescence are used. Other fluorescences, such as FITC (fluorescein isothiocyanate), TET (tetrachlorofluorescein), JOE (2',7'-dimethoxy-4',5'-dichloro-5(6)-carboxyfluorescein, etc.) can also be selected.

[0011] In one aspect of the present invention, the present invention provides the application of the molecular markers and SNP primers of the present invention in assisting the breeding of common heading cabbage varieties or identifying whether a cabbage variety is common heading cabbage.

[0012] In one aspect of the present invention, the present invention provides a method for identifying common heading cabbage, comprising the following steps:

[0013] (1) Extraction of genomic DNA from the cabbage sample to be tested;

[0014] (2) Using the genomic DNA of the cabbage sample to be tested as a template, performing PCR amplification with each primer pair in the SNP primers of the present invention respectively;

[0015] (3) Performing fluorescence detection and analysis on the amplification products to obtain the genotypes of the corresponding SNP sites of the cabbage sample to be tested, thereby determining whether the cabbage variety to be tested is common heading cabbage; when the genotype of the A02_13766456G / A site is the A:A homozygous type, the sample to be tested is common heading cabbage, and when it is the G:G homozygous type, the sample to be tested is non-common heading cabbage; or / and, when the genotype of the A02_13796934C / G site is G:G homozygous, the sample to be tested is non-common heading cabbage, and when it is the C:C homozygous type, the sample to be tested is common heading cabbage.

[0016] In the above method for identifying common heading cabbage, as a preferred embodiment, the conditions of the PCR amplification are successively: pre-denaturation at 94°C for 15 minutes, denaturation at 94°C for 20 s; annealing at 61°C - 55°C for 1 min, for a total of 10 cycles, with 61°C being the annealing temperature of the first cycle, and the annealing temperature decreasing by 0.6°C for each subsequent cycle; denaturation at 94°C for 20 s, renaturation / extension at 55°C for 1 min, for a total of 26 cycles.

[0017] In the above method for identifying common heading cabbage, as a preferred embodiment, in the primer set, the concentration ratio of the first forward primer, the second forward primer, and the universal reverse primer of each primer pair in the PCR system is 2:2:5.

[0018] In the above method for identifying common heading cabbage, as a preferred embodiment, the concentration of the genomic DNA of the sample to be tested is 10 - 30 ng / μL.

[0019] The template of the PCR of the present invention: the genomic DNA of the sample to be tested, the agarose electrophoresis band thereof should be single and without obvious diffusion, its concentration meets 10 - 30 ng / μL, and the ratio of A260 / A280 in the ultraviolet spectrophotometry detection is greater than 1.8.

[0020] Beneficial effects

[0021] (1)Based on the vegetable SNP database (http: / / 8.130.55.37 / ) (VegSNPDB website), SNP loci of Brassica oleracea varieties were screened, and two markers with very obvious population specificity were found: A02_13766456G / A and A02_13796934C / G.

[0022] (2)The present invention relates to specific KASP primer pairs for A02_13766456G / A and A02_13796934C / G, which were used to identify whether 35 tested Brassica oleracea vegetables are common round-headed cabbages. The detected homozygous genotypes are completely consistent with the phenotypes, providing strong technical support for identifying whether Brassica oleracea vegetables are common round-headed cabbages.

[0023] (3)The specific amplification primers developed using the SNP loci of the present invention can efficiently and accurately identify common round-headed cabbages, and can significantly improve the identification efficiency of Brassica oleracea variety seeds. Description of the Drawings

[0024] Figure 1 It is a result diagram (genotyping diagram) of genotyping or KASP amplification of 35 tested Brassica oleracea varieties in Example 2 using the KASP primer pair of SNP21 locus of the present invention. Among them, the genotype is common round-headed cabbage (A:A genotype, red dots); the genotype is non-common round-headed cabbage (G:G genotype, blue dots).

[0025] Figure 2 It is a result diagram (genotyping diagram) of genotyping or KASP amplification of 35 tested Brassica oleracea varieties in Example 2 using the KASP primer pair of SNP22 locus of the present invention. Among them, the genotype is common round-headed cabbage (C:C genotype, red dots); the genotype is non-common round-headed cabbage (G:G genotype, blue dots).

[0026] Figure 3 It is a result diagram (genotyping diagram) of genotyping or KASP amplification of the seeds of 60 tested Brassica oleracea varieties in Example 3 using the KASP primer pair of SNP21 locus of the present invention. Among them, the genotype is common round-headed cabbage (A:A genotype, red dots); the genotype is non-common round-headed cabbage (G:G genotype, blue dots); samples with uncertain genotyping (× dots).

[0027] Figure 4The figure shows the results of genotyping or KASP amplification (genotyping map) of the seeds of 60 tested Brassica oleracea varieties in Example 3 using the KASP primer pair at the SNP22 locus of the present invention. Among them, the genotype is common round-headed cabbage (C:C genotype, red dots); the genotype is non-common round-headed cabbage (G:G genotype, blue dots); the genotype of the heterozygous sample is (A:C genotype, green dots). Detailed implementation mode

[0028] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. The equipment and reagents used in each embodiment and test example can be obtained from commercial channels without special instructions. Unless otherwise specified, the reagents used in the present invention are all analytical grade reagents. The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] Example 1: Obtaining an SNP primer combination for identifying varieties belonging to common round-headed cabbage

[0030] 1.1 Discovery of 2 SNP loci

[0031] Based on the SNP loci of Brassica oleracea varieties on the Vegetable SNP Database (VegSNPDB) (http: / / 8.130.55.37 / ) of the Institute of Vegetables, Beijing Academy of Agriculture and Forestry Sciences, through bioinformatics analysis and characteristic screening of perfect SNP loci with MAF>0.3, heterozygosity less than 0.1, deletion rate less than 0.1 and 50bp conserved sequences at both wings (no InDel, no SSR, no other SNP), 2 SNP loci with a SNP frequency difference of 1 between common round-headed cabbage and other Brassica oleracea populations were obtained.

[0032] The basic information of the 2 SNP loci is shown in Table 1. The positions of the SNP loci on the chromosome are based on the Brassica oleracea reference genome: Brassica oleracea var. oleracea cultivar TO1000 v2.1.

[0033] Table 1. Basic information of 2 specific non-synonymous SNP loci of common round-headed cabbage

[0034]

[0035] 1.2 Specific SNP primers for identifying common round-headed cabbage

[0036] Based on the 2 SNP loci discovered in Step 1.1, 2 pairs of KASP primers were designed and used for SNP genotyping of 200 Brassica oleracea varieties with known population attributes. Among them, each primer pair includes a first forward primer, a second forward primer, and a common reverse primer, and their sequences are shown in Table 2 below.

[0037] Table 2. Specific SNP primers for identifying common headed cabbage

[0038]

[0039] Note: GAAGGTGACCAAGTTCATGCT is the FAM fluorescent tag sequence, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent tag sequence.

[0040] Example 2: Validation of the effectiveness of SNP primer combinations

[0041] The basic information of the 35 tested Brassica oleracea varieties in this example is shown in the first to third columns of Table 3 below. Among the 35 varieties, all were collected from the market. According to the phenotype, 12 tested varieties were common headed cabbages, and 23 tested varieties were other Brassica oleracea vegetables (cauliflower or broccoli).

[0042] 2.1 Obtaining genomic DNA of the tested varieties

[0043] The genomic DNA of the seedlings of 35 tested varieties (seedlings containing young roots and cotyledons mixed from 30 seeds) was extracted respectively by the CTAB method to obtain the genomic DNA of the tested varieties.

[0044] The quality and concentration of the genomic DNA of the tested varieties must meet the requirements of PCR. The passing standards are as follows: agarose gel electrophoresis shows a single DNA band without obvious smearing; the A260 / A280 ratio detected by the ultraviolet spectrophotometer Nanodrop2000 (Thermo) is about 1.8, and the A260 / A230 ratio is greater than 1.8; the concentration of the genomic DNA of the tested varieties is 10 - 30 ng / μL.

[0045] 2.2 PCR amplification detection of SNP loci

[0046] Using the genomic DNA of 35 tested varieties as templates respectively, PCR amplifications were carried out using the KASP primer pair targeting the SNP locus (A02_13766456G / A) numbered SNP21 and the KASP primer pair targeting the SNP locus (A02_13796934C / G) numbered SNP22 to obtain the corresponding PCR amplification products. In each PCR reaction system, the concentration ratio of the first forward primer, the second forward primer, and the reverse common primer is 2:2:5.

[0047] The reaction procedure is as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 61°C - 55°C (touch-down program is selected, decreasing by 0.6°C per cycle), extension for 1 min, and 10 cycles of amplification; denaturation at 94°C for 20 s, annealing and extension at 55°C for 1 min, and 26 additional cycles of amplification.

[0048] The PCR reagent is: a kit with the ability of competitive allele-specific PCR detection. In this example, Mastermix from LGC company is used (product number PartNo.KBS-1016-002 for 96 or 384-well plates or PartNo.KBS-1016-011 for 1536-well plates).

[0049] Table 3. PCR reaction system for 384-well or 96-well plates

[0050]

[0051] After completing step 2, when the temperature of each PCR amplification product drops below 40°C, the fluorescence values are read by scanning with the FAM and HEX beams of a microplate reader (the FAM fluorescence label sequence is observed and read at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the HEX fluorescence label sequence is observed and read at an excitation wavelength of 528 nm and an emission wavelength of 560 nm). The genotypes of 35 test varieties based on each SNP locus are judged according to the fluorescence signal color. The specific judgment principles are as follows:

[0052] PCR result of the test sample based on SNP21 locus: If a blue fluorescence signal is shown, the genotype of this locus is G:G (the same as the last base at the 3' end of the first forward primer of the KASP primer pair for SNP21 locus), and it is thus judged that the test sample is not common cabbage; if a red fluorescence signal is shown, the genotype of this locus is A:A (the same as the last base at the 3' end of the second forward primer of the KASP primer pair for SNP21 locus), and it is thus judged that the test sample is common cabbage; if a green fluorescence signal is shown, the genotype of this locus is heterozygous, one base is G (the same as the last base at the 3' end of the first forward primer of the KASP primer pair for SNP21 locus), and the other base is A (the same as the last base at the 3' end of the second forward primer of the KASP primer pair for SNP21 locus), and it is thus judged as G:A. In this example, the statistical results of the genotypes of 35 test samples based on SNP21 are shown in the 4th column of Table 4 below (partial results are shown in Figure 1 )

[0053] When the PCR result of the sample to be tested based on the SNP22 locus shows a blue fluorescence signal, the genotype of this locus is G:G (the same as the last base at the 3' end of the first forward primer of the KASP primer pair for the SNP22 locus), and it is thus determined that the sample to be tested is not common cabbage; when it shows a red fluorescence signal, the genotype of this locus is C:C (the same as the last base at the 3' end of the second forward primer of the KASP primer pair for the SNP22 locus), and it is thus determined that the sample to be tested is common cabbage; when it shows a green fluorescence signal, the genotype of this locus is heterozygous, one base is G (the same as the last base at the 3' end of the first forward primer of the KASP primer pair for the SNP22 locus), and the other base is C (the same as the last base at the 3' end of the second forward primer of the KASP primer pair for the SNP22 locus), and it is thus determined as G:C. The genotype statistical results of 35 test samples based on SNP22 in this example are shown in the 5th column of Table 4 below (partial results are shown in Figure 2 )

[0054] If the fluorescence signal is weak after PCR amplification, affecting data analysis, cycles can be added (denaturation at 94°C for 20 s, annealing and extension at 55°C for 1 min, 5 cycles) until the fluorescence signal clusters tightly and the relative fluorescence values of FAM and HEX are between 1 and 2.

[0055] The results in Table 4 show that both primer sets can achieve good genotyping effects in 35 test varieties, and the genotyping results are highly consistent. The specific consistency data can be found in Section 2.3 of this example.

[0056] Table 4. Basic information of 35 test varieties

[0057]

[0058] 2.3. Efficiency evaluation of identifying 35 test varieties as common cabbage by two primer pairs

[0059] (1) Statistically analyze the genotypes of 35 test varieties based on SNP21.

[0060] The results showed that there were 12 tested varieties with the SNP21 genotype of A:A homozygous type in Table 4 above, which were determined to be common headed cabbages. According to the phenotypic statistical results of the tested samples in the third column of Table 4 above, 12 of them were common headed cabbages, with a consistency of 100%. There were 23 tested varieties with the SNP21 genotype of G:G homozygous type in Table 4 above, which were determined to be non-common headed cabbages; according to the phenotypic statistical results of the tested varieties in the third column of Table 4 above, all these 23 samples were non-common headed cabbages, with a consistency of 100%. Therefore, according to Table 4 above, in this example, through the use of the SNP21 primer pair and based on the genotype at the SNP21 locus, among the identification results of 35 tested varieties, the genotypes and phenotypes all matched. Therefore, the consistency between the results of the KASP primer pair for SNP21 in identifying common headed cabbages among 35 tested samples and the phenotypes was 100%.

[0061] (2)Statistically analyze the genotypes of 35 tested varieties based on SNP22.

[0062] The results showed that there were 12 tested varieties with the SNP22 genotype of C:C homozygous type in Table 4 above, which were determined to be common headed cabbages. According to the phenotypic statistical results of the tested samples in the third column of Table 4 above, 12 of them were common headed cabbages, with a consistency of 100%. There were 23 tested varieties with the SNP22 genotype of G:G homozygous type in Table 4 above, which were determined to be non-common headed cabbages; according to the phenotypic statistical results of the tested varieties in the third column of Table 4 above, all these 23 samples were non-common headed cabbages, with a consistency of 100%. Therefore, according to Table 4 above, in this example, through the use of the SNP22 primer pair and based on the genotype at the SNP22 locus, among the identification results of 35 tested varieties, the genotypes and phenotypes all matched. Therefore, the consistency between the results of the KASP primer pair for SNP22 in identifying common headed cabbages among 35 tested samples and the phenotypes was 100%.

[0063] Thus, it can be seen that the SNP loci and their specific primer pairs developed in Example 1 can efficiently and accurately identify whether the variety to be tested is a common headed cabbage, and the genotype linkage degree of the SNP21 and SNP22 loci is very high (the results of identifying whether the variety to be tested is a common headed cabbage based on the genotypes of these two SNP loci are completely consistent with the phenotypes). In the identification of whether the seeds of cabbage varieties are common headed cabbages, the KASP primer pair for SNP21 and the KASP primer pair for the SNP22 locus can be used as a primer group together to identify common headed cabbages, complementing each other and further improving the accuracy of identifying common headed cabbage seeds.

[0064] Example 3 Use the SNP primer combination developed in Example 1 to detect whether the variety to be tested is a common headed cabbage

[0065] 3.1. Use the primer combinations targeting SNP21 locus and SNP22 locus developed in Example 1 to detect whether the variety to be tested belongs to Brassica oleracea var. capitata

[0066] (1) Obtaining the genomic DNA of the variety to be tested

[0067] After grinding the seeds of the variety to be tested with liquid nitrogen, the genomic DNA was extracted respectively by the CTAB method to obtain the genomic DNA of the variety to be tested.

[0068] (2) Using the genomic DNA of the variety to be tested as a template, perform PCR amplification respectively with the KASP primer pair of SNP21 and the KASP primer pair of SNP22 to obtain the corresponding PCR amplification products. In each PCR reaction system, the concentration ratio of the first forward primer, the second forward primer and the universal reverse primer is 2:2:5. The reaction program and reagents are the same as in Example 2.

[0069] (3) After completing step (2), when the temperature of each PCR amplification product drops below 40°C, read the fluorescence values by scanning with the FAM and HEX beams of the microplate reader (the FAM fluorescence tag sequence is observed and read at the excitation wavelength of 485 nm and the emission wavelength of 520 nm, and the HEX fluorescence tag sequence is observed and read at the excitation wavelength of 528 nm and the emission wavelength of 560 nm), obtain the fluorescence signal color, and determine the genotype of the corresponding SNP locus according to the method in Example 2, thereby judging whether the variety to be tested is Brassica oleracea var. capitata.

[0070] The SNP genotyping results of 60 varieties to be tested using the KASP primer pair of SNP21 are shown in Figure 3 ;

[0071] The SNP genotyping results of 60 varieties to be tested using the KASP primer pair of SNP22 are shown in Figure 4 .

[0072] The statistical results are shown in columns 2 - 3 of Table 5. The test varieties with the homozygous genotype of A:A at the SNP21 locus and the homozygous genotype of C:C at the SNP22 locus are determined to be Brassica oleracea var. capitata. The test varieties with the homozygous genotype of G:G at the SNP21 locus and the homozygous genotype of G:G at the SNP22 locus are determined not to be Brassica oleracea var. capitata.

[0073] Table 5. Whether 60 varieties to be tested belong to Brassica oleracea var. capitata

[0074]

[0075] 3.2. According to the phenotype, judge whether the variety to be tested is Brassica oleracea var. capitata.

[0076] The phenotypic statistical results are shown in the 4th column of Table 5.

[0077] The results of this example show that the identification results of the SNP primer combination developed in this experiment are completely consistent with the phenotypic identification results. Thus, it can be seen that the SNP primer combination developed based on this experiment can detect whether the variety to be tested belongs to common headed cabbage.

[0078] The above content is a further detailed description of the present invention in combination with specific implementation manners. It cannot be determined that the specific implementation of the present invention is only limited to these descriptions. For those of ordinary skill in the technical field to which the present invention pertains, without departing from the concept of the present invention, several simple deductions or substitutions can still be made, which should all be regarded as falling within the protection scope determined by the claims submitted for the present invention.

Claims

1. An SNP primer for identifying common headed cabbage, characterized in that, The primer is a KASP primer pair targeting the SNP locus of Brassica oleracea. Each primer pair includes a first forward primer, a second forward primer, and a common reverse primer. The SNP locus is the SNP locus at position 13766456 on chromosome 2 of the Brassica oleracea reference genome, and the nucleotide base at this locus is G or A, that is, A02_13766456G / A. Among them, the A:A homozygous type is the genotype of common headed cabbage, and the G:G homozygous type is the genotype of non-common headed cabbage. Or, it is at position 13796934 on chromosome 2 of the Brassica oleracea reference genome, and the nucleotide base at this locus is C or G, that is, A02_13796934C / G. Among them, the C:C homozygous type is the genotype of common headed cabbage, and the G:G homozygous type is the genotype of non-common headed cabbage. In the primer pair targeting the A02_13766456G / A locus, the base sequence of the first forward primer is as shown in SEQ ID NO.1; the base sequence of the second forward primer is shown in SEQ ID NO.2; the base sequence of the common reverse primer is shown in SEQ ID NO.

3. In the primer pair targeting the A02_13796934C / G locus, the base sequence of the first forward primer is as shown in SEQ ID NO.4; the base sequence of the second forward primer is as shown in SEQ ID NO.5; the base sequence of the common reverse primer is as shown in SEQ ID NO.

6.

2. A kit for identifying common headed cabbage, characterized in that, The kit includes the primer pair described in claim 1.

3. Use of the SNP primer according to claim 1, characterized in that, The SNP primer is used to assist in breeding common headed cabbage varieties or to identify whether Brassica oleracea varieties are common headed cabbage. When the genotype at the A02_13766456G / A locus is the A:A homozygous type, the test sample is common headed cabbage; when it is the G:G homozygous type, the test sample is non-common headed cabbage. Or / and, when the genotype at the A02_13796934C / G locus is G:G homozygous, the test sample is non-common headed cabbage; when it is the C:C homozygous type, the test sample is common headed cabbage.

4. A method for identifying common headed cabbage, characterized in that, The method includes: (1) Extraction of genomic DNA from the Brassica oleracea sample to be tested. (2) Using the genomic DNA of the Brassica oleracea sample to be tested as a template, performing PCR amplification respectively with each primer pair in the primer described in claim 1. (3) Performing fluorescence detection and analysis on the amplification product to obtain the genotype of the corresponding SNP locus of the Brassica oleracea sample to be tested, thereby determining whether the Brassica oleracea sample to be tested is common headed cabbage. When the genotype at the A02_13766456G / A locus is the A:A homozygous type, the Brassica oleracea sample to be tested is common headed cabbage; when it is the G:G homozygous type, the Brassica oleracea sample to be tested is non-common headed cabbage. Or / and, when the genotype at the A02_13796934C / G locus is G:G homozygous, the Brassica oleracea sample to be tested is non-common headed cabbage; when it is the C:C homozygous type, the Brassica oleracea sample to be tested is common headed cabbage.

5. The method for identifying common round-headed cabbage according to claim 4, characterized in that, The conditions for the PCR amplification are as follows in sequence: pre-denaturation at 94°C for 15 minutes, denaturation at 94°C for 20 s; annealing at 61°C - 55°C for 1 min, with a total of 10 cycles, where 61°C is the annealing temperature for the first cycle, and the annealing temperature decreases by 0.6°C for each subsequent cycle; denaturation at 94°C for 20 s, renaturation / extension at 55°C for 1 min, with a total of 26 cycles.

6. The method for identifying common round-headed cabbage according to claim 4, characterized in that, The concentration ratio of the first forward primer, the second forward primer, and the universal reverse primer of the primer pair in the PCR system is 2:2:

5.

7. The method for identifying common headed cabbage according to claim 4, characterized in that, The concentration of the genomic DNA of the cabbage-like sample to be tested is 10 - 30 ng / μL, and the ratio of A260 / A280 in the ultraviolet spectrophotometry detection is greater than 1.8.

Images