System for targeted quantitative detection of breast cancer cells in blood and preparation method and application thereof

Abstract

The invention belongs to the technical field of biological detection, and particularly discloses a system for targeted quantitative detection of breast cancer cells in blood and a preparation method and application thereof. The system comprises a magnetic nanoparticle composite material, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, a hydrogen peroxide solution, a phosphate buffer salt solution, a urease solution, a urea solution and a phenol red solution, wherein the magnetic nanoparticle composite material comprises magnetic Fe3O4 nanoparticles and polydopamine which grows on the surfaces of the Fe3O4 nanoparticles in an auto-polymerization manner; the nucleotide sequence of the first modified nucleic acid chain is used for modifying the magnetic nanoparticle composite material; the nucleotide sequence of the second modified nucleic acid chain is used for modifying the Ag nanoparticles. The method has the advantages of high sensitivity, low detection limit, low cost and simplicity in operation, realizes sensitive detection of breast cancer cells in blood, solves the problem of complex matrix interference, and has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a system for targeted quantitative detection of breast cancer cells in blood, and a preparation method and application thereof. Background Art

[0002] Cancer has long been a topic of widespread concern. Breast cancer has received widespread attention as the leading cause of cancer death in women. Because breast cancer cannot be accurately diagnosed in its early stages, it may develop unnoticed. Therefore, early diagnosis and timely treatment of cancer play a key role in improving patient survival rates.

[0003] Circulating tumor cells (CTCs) are tumor cells that circulate in the peripheral blood after being shed from the primary tumor. CTCs are regarded as a new and reliable tumor biomarker for early cancer diagnosis and can be detected in the peripheral blood of patients with metastatic and primary tumors. However, due to the low concentration of CTCs in human blood and the difficulty in detection, accurate quantitative detection and analysis of CTCs is a very challenging task for researchers. Therefore, methods for rapid capture and highly sensitive detection of CTCs in real human blood samples are becoming increasingly important in cancer detection, and achieving highly sensitive detection in ultra-low levels of CTCs is beneficial to the diagnosis and treatment evaluation of early breast cancer. Summary of the invention

[0004] In view of the above-mentioned shortcomings, the present invention provides a system for targeted quantitative detection of breast cancer cells in blood, a preparation method and application thereof, which has the advantages of high sensitivity, low detection limit, low cost and simple operation, and realizes sensitive detection of breast cancer cells in blood. By comparing with the published detection methods of breast cancer cells, the present method has an adjustable detection range and a lower detection limit, and solves the problem of complex matrix interference, and has good application prospects.

[0005] In order to achieve the above-mentioned object, the present invention provides a system for targeted quantitative detection of breast cancer cells in blood, comprising a magnetic nanoparticle composite material, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, a hydrogen peroxide solution, a phosphate buffered saline solution, a urease solution, a urea solution, and a phenol red solution; wherein

[0006] The magnetic nanoparticle composite material comprises magnetic Fe3O4 nanoparticles and polydopamine that self-polymerizes and grows on the surface of the Fe3O4 nanoparticles;

[0007] The nucleotide sequence of the first modified nucleic acid chain is shown in SEQ ID NO: 1, and is used to modify the magnetic nanoparticle composite material.

[0008] It should be noted that the first modified nucleic acid chain and the magnetic nanoparticle composite material are connected through the strong metal coordination between the polydopamine on the surface of the Fe3O4 nanoparticles and the first modified nucleic acid chain.

[0009] The nucleotide sequence of the second modified nucleic acid chain is shown in SEQ ID NO: 2, and is used to modify the Ag nanoparticles.

[0010] According to one aspect of the present invention, the 3' end of the second modified nucleic acid chain is modified with a thiol group, and the Ag nanoparticles are connected to the second modified nucleic acid chain via an Ag-S bond.

[0011] According to one aspect of the present invention, the particle size of the Ag nanoparticles is 75-300 nm.

[0012] It should be noted that the size of the magnetic nanoparticle composite material has little effect on the signal output.

[0013] In a specific embodiment, the particle size of the magnetic nanoparticle composite material is 150 nm, and the thickness of the polydopamine is 17 nm;

[0014] According to one aspect of the present invention, the concentration of the hydrogen peroxide solution is 10-30 mM, the pH value of the phosphate buffered saline solution is 7.4, the concentration of the urease solution is 10 nM, the concentration of the urea solution is 100 mM, and the concentration of the phenol red solution is 100 μM.

[0015] It should be noted that the pH value of the phosphate buffered saline solution is 7.4 in order to capture cancer cells under physiological conditions and to ensure that the morphology of cancer cells is normal. Therefore, its pH value is a fixed and generally applicable value.

[0016] Based on the same inventive concept, the present invention also provides a method for preparing the above system, comprising the following steps:

[0017] S1. Preparation of magnetic nanoparticle composite materials:

[0018] Synthesize magnetic Fe3O4 nanoparticles based on a hydrothermal method, and then grow a polydopamine layer on the surface of the magnetic Fe3O4 nanoparticles by self-polymerization;

[0019] S2. Preparation of Ag nanoparticles:

[0020] Silver nano seeds are prepared by sodium citrate reduction method; the silver nano seeds, ascorbic acid, silver nitrate and ammonia water are mixed and reacted to prepare uniform quasi-spherical Ag nano particles of 75-300nm.

[0021] According to one aspect of the present invention, the method for preparing the magnetic nanoparticle composite material comprises the following steps:

[0022] A1. Add ferric chloride hexahydrate and sodium acetate trihydrate to a solvent and stir to obtain a mixture; add sodium acetate to the mixture and stir to obtain a mixture, then transfer the mixture to a polytetrafluoroethylene-lined autoclave and raise the temperature to 200° C. to react for 12 hours, and then wash to obtain Fe3O4 magnetic nanoparticles;

[0023] A2. Add the Fe3O4 magnetic nanoparticles and DOPA hydrochloride solution into a Tris-HCl buffer solution and react for 8 hours, then wash and freeze-dry to obtain a magnetic nanoparticle composite material, namely, Fe3O4@PDA nanoparticles; wherein the pH value of the Tris-HCl buffer solution is 8.5.

[0024] Based on the same inventive concept, the present invention also provides the application of the above-mentioned system for targeted quantitative detection of breast cancer cells in blood or the system for targeted quantitative detection of breast cancer cells in blood prepared by the above-mentioned preparation method in the targeted quantitative detection of breast cancer cells in blood for non-disease diagnosis and treatment purposes.

[0025] According to one aspect of the present invention, the following steps are included:

[0026] T1, modifying the surface of the magnetic nanoparticle composite material with the first modified nucleic acid chain to obtain N1-Fe3O4@PDA nanoparticles; modifying the surface of the Ag nanoparticles with the second modified nucleic acid chain to obtain S1-Ag NPs complex;

[0027] T2, adding the N1-Fe3O4@PDA to the sample to be tested and incubating the mixture to form a cancer cell-magnetic nanoparticle coupling product;

[0028] T3, transferring the cancer cell-magnetic nanoparticle coupling product to the phosphate buffered saline solution by magnetic separation, and then adding the S1-Ag NPs and incubating to form a magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure;

[0029] T4. After adding the magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure to the hydrogen peroxide solution and reacting, taking the supernatant and adding it to the urease solution for incubation, then adding the urea solution and phenol red solution for incubation, and recording the ultraviolet absorption signal of the incubated solution.

[0030] According to one aspect of the present invention, the process of modifying the first modified nucleic acid chain on the surface of the magnetic nanoparticle composite material is specifically as follows:

[0031] The magnetic nanoparticle composite material and the first modified nucleic acid chain are added to a solution containing Ca 2+ The reaction was incubated in a HEPES buffer solution for 2 h, and then washed several times with a HEPES buffer solution by magnetic separation to obtain N1-Fe3O4@PDA nanoparticles;

[0032] The process of modifying the surface of the Ag nanoparticles with the second modified nucleic acid chain is specifically as follows:

[0033] The thiolated second modified nucleic acid chain is incubated with TCEP, and then mixed and incubated with Ag nanoparticles to obtain a mixture; citric acid buffer and phosphate buffer are sequentially added to the mixture and mixed, and then centrifuged to obtain an S1-Ag NPs complex.

[0034] According to one aspect of the present invention, in step T2, the incubation conditions for adding N1-Fe3O4@PDA are incubation at 37°C for 120 min; in step T3, the incubation conditions for adding S1-Ag NPs are incubation at 37°C for 15 min; in step T4, the reaction time for adding hydrogen peroxide solution is 10 min, and the incubation conditions for adding urease solution are incubation at 37°C for 15 min.

[0035] The detection principle of the present invention:

[0036] Through the "one-to-many" combination of cancer cells and enzyme inhibition strategy, dual signal amplification detection of breast cancer cells in the blood is achieved. Figure 1 As shown in Figure B, first, in the presence of target cancer cells (referred to as CTCs), N1-Fe3O4@PDA nanoparticles and S1-Ag nanoparticles formed a sandwich structure with breast cancer cells. As the size of silver nanoparticles increased, Ag oxidized by H2O2 + The number of silver ions increases accordingly. Trace amounts of silver ions can completely inhibit the activity of urease. These silver ions released by H2O2 oxidation +It is regarded as a signal unit that acts on urease, thereby inhibiting the activity of urease. The decomposition of urea catalyzed by urease can release a large amount of ammonia, causing the pH of the solution to rise. Dual signal amplification detection is achieved through a "one-to-many" combination of cancer cells and enzyme inhibition strategy. When target breast cancer cells are present, silver nanoparticles with specific nucleic acid sequences can combine with breast cancer cells captured by magnetic nanoparticles to form a sandwich structure. After magnetic enrichment and separation, the magnetic nanoparticle-breast cancer cell-silver nanoparticle coupling complex is transferred to a hydrogen peroxide solution for reaction. The supernatant is taken by magnetic separation, and urease is added for incubation. The Ag nanoparticles captured on the surface of breast cancer cells are decomposed by the hydrogen peroxide solution into millions of silver ions that react with urease and inhibit its activity. In a solution containing urea, the pH indicator phenol red (pH=5.8) shows yellow, and characteristic absorption peaks appear at 430nm and 558nm. As breast cancer cells increase, the concentration of Ag ions increases, which greatly inhibits the activity of urease, resulting in inhibition of the decomposition of urea. The pH of the solution does not change significantly, and the absorption peak of phenol red at 430nm becomes higher, while the absorption peak at 558nm becomes lower and lower (the ratio of ultraviolet absorption peaks depends on the concentration of breast cancer cells). On the contrary, in the absence of breast cancer cells, the urea in the solution is hydrolyzed into ammonia under the catalysis of urease, resulting in an increase in the pH value of the solution. At the same time, as the alkalinity of the solution continues to increase, the color of the solution changes from yellow to pink, and the characteristic absorption peak at 558nm becomes higher and higher, while the absorption peak at 430nm almost disappears.

[0037] In addition, a single cancer cell can be captured by multiple silver nanoparticles at the same time, so that more silver ions can be released through hydrogen peroxide etching, thereby inhibiting the activity of urease to a greater extent than the silver ions released by a single Ag nanoparticle, further improving the signal amplification effect. By controlling the synthesis of silver nanoparticles with different particle sizes, the number of released silver ions can be controlled, thereby improving the sensitivity of the sensor. Compared with conventional colorimetric biosensors, the use of phenol red (phenol red is extremely sensitive to pH changes, with a dissociation constant (pKa) of 7.5 and a molar absorption coefficient of the alkaline form (ε = 5.64×10 4 M -1 cm -1 , 558nm) is able to indicate changes in solution pH in the range of 6.5-8.5. ) The sensitive changes of the biosensor as an indicator can be easily analyzed by the naked eye and absorption spectrometer, thus achieving qualitative and quantitative detection of breast cancer cells.

[0038] Beneficial effects of the present invention:

[0039] (1) The present invention can form a sandwich structure of magnetic nanoparticles-cancer cells-silver nanoparticles by functionalizing magnetic nanoparticles and silver nanoparticles with nucleic acid, and breast cancer cells as intermediate carriers. Since the size of silver nanoparticles can be controlled, a cancer cell can be captured by multiple silver nanoparticles at the same time, and the signal is amplified. Under the action of hydrogen peroxide solution, the silver nanoparticles are oxidized into millions of silver ions, which greatly inhibit the activity of urease and can further amplify the signal. In addition, the pH signal change of ammonia produced by urease-catalyzed urea decomposition is converted into the change of phenol red ultraviolet absorption peak and color change observable by naked eyes by phenol red, which also ensures that the reaction system has no contact with the color development system after magnetic separation and enrichment, avoiding the interference and influence of actual complex serum or blood samples on the system. In the experiment, serum and blood were used as actual samples to explore the anti-interference ability of the method. By adding spikes to the complex system to establish a standard curve, it was verified that the method has good detection performance in a complex matrix.

[0040] (2) The present invention has the advantages of high sensitivity, low detection limit, low cost and simple operation, and realizes sensitive detection of breast cancer cells in blood. By comparing with the published detection methods of breast cancer cells, the present method has an adjustable detection range and a lower detection limit, and solves the problem of complex matrix interference, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the principle of the system for targeted quantitative detection of breast cancer cells in blood of the present invention; wherein A is a schematic diagram of the nucleic acid functionalization modification of Fe3O4@PDA and Ag nanoparticles; B is a schematic diagram of the detection principle of targeted quantitative detection of breast cancer cells in blood;

[0042] Figure 2 The high-resolution transmission electron micrographs of Fe3O4 and Fe3O4@PDA prepared in Example 2 of the present invention; wherein A is a transmission electron micrograph of Fe3O4; B is a transmission electron micrograph of Fe3O4@PDA; C is a C element mapping of Fe3O4@PDA; D is a Fe element mapping of Fe3O4@PDA; E is a N element mapping of Fe3O4@PDA; and F is an O element mapping of Fe3O4@PDA.

[0043] Figure 3The SEM images and particle size analysis diagrams of silver nanoparticles of different particle sizes prepared in Example 2 of the present invention; wherein A is a silver nanoparticle with a particle size of 75 nm; B is a silver nanoparticle with a particle size of 100 nm; C is a silver nanoparticle with a particle size of 150 nm; D is a silver nanoparticle with a particle size of 200 nm; E is a silver nanoparticle with a particle size of 300 nm; F is a graph showing the relationship between the amount of silver nanoseed added and the particle size of the silver nanoparticles;

[0044] Figure 4 The first modified nucleic acid chain of Example 1, the Fe3O4@PDA nanopowder of Example 2, and the Fe3O4@PDA after nucleic acid functionalization modification of Example 3 are UV-visible absorption spectra and potential verification diagrams; wherein A is an UV-visible light absorption spectrum diagram; B is a potential verification diagram;

[0045] Figure 5 The UV-visible absorption spectra and potential verification diagrams of the second modified nucleic acid chain of Example 1, the Ag nanoparticles of Example 2, and the Ag nanoparticles after nucleic acid functionalization modification of Example 3 of the present invention; wherein A is the UV-visible light absorption spectrum diagram; B is the potential verification diagram;

[0046] Figure 6 The sensitivity analysis of MCF-7 detection evaluated by UV-visible absorption spectroscopy of breast cancer cells of different concentrations in Example 3 of the present invention is shown; wherein A is a UV-visible absorption spectrum of breast cancer cells of different concentrations; B is a UV absorption peak ratio curve of breast cancer cells of different concentrations; C is a UV absorption peak ratio curve of breast cancer cells of different logarithmic concentrations. DETAILED DESCRIPTION

[0047] To make the present invention easier to understand, the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. Unless otherwise defined, the professional terms used below are consistent with the meanings understood by professional and technical personnel in the field; unless otherwise specified, the raw materials and reagents involved in this article can be purchased from the market or prepared by known methods. The reagents and instruments used in the examples are conventionally selected in the field unless otherwise specified. The experimental methods for which specific conditions are not specified in the examples are implemented according to conventional conditions, such as the conditions described in the literature and books, or the methods recommended by the manufacturer.

[0048] Example 1: A system for targeted quantitative detection of breast cancer cells in blood:

[0049] A system for targeted quantitative detection of breast cancer cells in blood, comprising a magnetic nanoparticle composite material, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, a hydrogen peroxide solution, a phosphate buffered saline solution, a urease solution, a urea solution, and a phenol red solution; wherein:

[0050] The magnetic nanoparticle composite material comprises magnetic Fe3O4 nanoparticles and a polydopamine layer self-polymerized and grown on the surface of the Fe3O4 nanoparticles;

[0051] The nucleotide sequence of the first modified nucleic acid chain (abbreviated as N1) is shown in SEQ ID NO: 1, specifically: GCAGTTGATCCTTTGGATACCCTGG, which is used to modify the magnetic nanoparticle composite material;

[0052] The nucleotide sequence of the second modified nucleic acid chain (abbreviated as S1) is shown in SEQ ID NO: 2, specifically: TATTCCAAATATCTTCTAAAAAAAAAAAAAAA, and is used to modify the Ag nanoparticles.

[0053] The 3' end of the second modified nucleic acid chain is modified with a thiol group, specifically TATTCCAAATATCTTCTAAAAAAAAAAAAAAA-SH, and the Ag nanoparticle is connected to the second modified nucleic acid chain through an Ag-S bond; The 3' end of the second modified nucleic acid chain is modified with a thiol group, and the Ag nanoparticle is connected to the second modified nucleic acid chain through an Ag-S bond;

[0054] The particle size of the magnetic nanoparticle composite material is 150 nm, the thickness of the polydopamine layer is 17 nm; the particle size of the Ag nanoparticle is 75 to 300 nm;

[0055] The concentration of the hydrogen peroxide solution is 20 mM, the pH value of the phosphate buffered saline solution is 7.4, the concentration of the urease solution is 10 nM, the concentration of the urea solution is 100 mM, and the concentration of the phenol red solution is 100 μM.

[0056] Example 2: A method for preparing a system for targeted quantitative detection of breast cancer cells in blood:

[0057] A method for preparing a system for targeted quantitative detection of breast cancer cells in blood (Example 1), comprising the following steps

[0058] (1) A method for preparing a magnetic nanoparticle composite material, comprising the following steps:

[0059] 0.65 g of ferric chloride hexahydrate and 0.4 g of sodium acetate trihydrate were added to 40 mL of ethylene glycol and mechanically stirred for one hour. Next, 2.4 g of sodium acetate was added to the mixture and mixed for another 30 minutes. Later, the resulting solution was transferred to a polytetrafluoroethylene-lined autoclave. The temperature was raised to 200°C and maintained at that temperature for 12 hours. The synthesized Fe3O4 magnetic nanoparticles were then washed three times with ethanol and ultrapure water, respectively. Subsequently, the Fe3O4 magnetic nanoparticles and 2 mg / mL of DOPA hydrochloride solution were added to 40 mL of Tris-HCl buffer solution (pH = 8.5) and reacted for 8 hours to form Fe3O4@PDA nanoparticles ( Figure 1 A). Finally, the synthesized Fe3O4@PDA nanoparticles were washed three times with ultrapure water and then freeze-dried for 8 h to obtain Fe3O4@PDA black powder for later use.

[0060] (2) A method for preparing Ag nanoparticles, comprising the following steps:

[0061] Silver nanoparticles were prepared by sodium citrate reduction method. Different amounts of silver nanoparticles (concentration of 4.8×10 11 / mL, the volumes were 300μL, 125μL, 40μL, 20μL, 8μL respectively), ascorbic acid, silver nitrate and ammonia water were mixed to prepare uniform quasi-spherical silver nanoparticles of 75-300nm (75nm, 100nm, 150nm, 200nm, 300nm respectively).

[0062] The Fe3O4 and Fe3O4@PDA prepared in step (1) above were subjected to microscopic morphology analysis. Figure 2 As shown. Figure 2 A shows that the particle size of Fe3O4 prepared in the above step (1) is about 150nm; Figure 2 B shows that the particle size of Fe3O4@PDA obtained after the PDA layer grows on the Fe3O4 surface increases to about 170nm; Figure 2 CF shows that Fe, C, N and O elements are evenly distributed on Fe3O4@PDA. In summary, the above step (1) successfully prepared functional Fe3O4@PDA nanoparticles.

[0063] The silver nanoparticles of different particle sizes prepared in step (2) above were analyzed by scanning electron microscopy. The results are as follows: Figure 3 As shown. Figure 3 It can be seen that the above step (2) can prepare silver nanoparticles with different particle sizes, and as the amount of silver nanoseeds added decreases, the particle size of the silver nanoparticles increases continuously.

[0064] Example 3: Application of a system for targeted quantitative detection of breast cancer cells in blood for non-disease diagnosis and treatment purposes:

[0065] An application of a system for targeted quantitative detection of breast cancer cells in blood (Example 1) for non-disease diagnosis and treatment purposes comprises the following steps:

[0066] (1) The steps of nucleic acid functionalization modification of Fe3O4@PDA are as follows: 0.5 mg Fe3O4@PDA (prepared by the preparation method of Example 2) and 30 μL 100 μM N1 are added to a flask containing 2 mM Ca 2+ The reaction was incubated in 10 mM HEPES buffer solution (pH = 7.6) for 2 hours. Then, the synthesized N1-Fe3O4@PDA composite material ( Figure 1 A). Finally, the N1-Fe3O4@PDA composite was dispersed in 1 mL of a stock buffer (20 mM Tris-HCl, pH = 7.4, containing 0.1% Tween 20 and 0.1% BSA) and stored at 4°C.

[0067] (2) The steps of nucleic acid functionalization modification of Ag nanoparticles are as follows: First, in order to cut off possible disulfide bonds, the thiolated S1 is incubated with 2mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP for short) for 1 hour. Then, 20μL of 100μM S1 is incubated with Ag nanoparticles (75nm, 100nm, 150nm, 200nm, and 300nm Ag nanoparticles prepared by the preparation method of Example 2) for 30 minutes. Subsequently, 5μL of 500mM citric acid buffer (pH=3.0) is added to the mixture and mixed for 5 minutes. Next, 5μL of citric acid buffer is added and mixed for 30 minutes. After that, 100μL of 0.2M phosphate buffer (pH=7.4) is added to the mixture to make the solution close to neutral. After 5 minutes, the mixture is centrifuged at 5000 rpm for 5 minutes to remove unbound S1. Finally, the S1-Ag nanoparticle complex ( Figure 1 A) Dispersed in 500 μL of stock buffer (20 mM Tris-HCl, pH=7.4, 0.14 M NaCl and 0.1% BSA) and stored at 4°C.

[0068] (3) 16 μL of N1-Fe3O4@PDA was added to blood samples containing breast cancer cells (MCF-7) of different concentrations (0 cells / mL, 10 cells / mL, 50 cells / mL, 100 cells / mL, 500 cells / mL, 1000 cells / mL, 5000 cells / mL, 10000 cells / mL, 50000 cells / mL) and incubated at 37°C for 120 min to form cancer cell-magnetic nanoparticle coupling products. The cancer cell-magnetic nanoparticle coupling products were transferred to phosphate buffered saline (pH = 7.4) by magnetic separation, and then 20 μL of S1-Ag NPs was added and incubated with them (incubated at 37°C for 15 min) to form a magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure ( Figure 1 B).

[0069] (4) Then, 20 mM hydrogen peroxide solution was added to the magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure for etching for 10 min to release a large amount of silver ions. Then, 10 nM urease was added to the supernatant and incubated for 15 min (37 °C). Then, 100 μL of a mixed solution of 100 mM urea and 100 μM phenol red was added, and finally, the ultraviolet absorption signal of the phenol red solution was recorded.

[0070] The first modified nucleic acid chain (abbreviated as N1) involved in the above step (1), Fe3O4@PDA nanoparticles, and Fe3O4@PDA functionalized with nucleic acid were subjected to UV absorption spectroscopy and Zeta potential analysis. The results are as follows: Figure 4 As shown. Figure 4 It can be seen that Fe3O4@PDA modified with the first modified nucleic acid chain has the characteristic ultraviolet absorption peak of the first modified nucleic acid chain. At the same time, this phenomenon is well explained by the change in electric potential. This result shows that the first modified nucleic acid chain is successfully modified on Fe3O4@PDA.

[0071] The second modified nucleic acid chain (abbreviated as S1) involved in the above step (2), Ag nanoparticles, and Ag nanoparticles after nucleic acid functionalization modification were subjected to UV absorption spectroscopy and Zeta potential analysis. The results are as follows: Figure 5 As shown. Figure 5 It can be seen that the silver nanoparticles modified with the second modified nucleic acid chain have the characteristic ultraviolet absorption peak of the second modified nucleic acid chain. At the same time, this phenomenon is well explained by the change in electric potential. This result shows that the second modified nucleic acid chain is successfully modified on the silver nanoparticles.

[0072] Ag nanoparticles with a particle size of 200 nm were functionalized with nucleic acids and subjected to the above-mentioned detection and recording of the ultraviolet absorption signal of the phenol red solution to prepare ultraviolet-visible absorption spectra and ultraviolet absorption peak ratio curves of breast cancer cells of different concentrations. The results are shown in FIG. Figure 6 As shown. Figure 6 A shows that in the absence of target breast cancer cells, no silver nanoparticles will be captured. After etching with hydrogen peroxide solution and adding urease, the enzyme activity will not be inhibited. After adding phenol red indicator and urea, urease catalyzes the decomposition of urea to produce a large amount of ammonia, which increases the pH of the solution. The color of the solution changes from yellow to pink, and the characteristic absorption peak at 558nm becomes higher (originally a tiny peak), and the absorption peak at 430nm almost disappears. However, in the presence of target breast cancer cells, breast cancer cells become intermediate carriers, connecting magnetic nanoparticles and silver nanoparticles to form a sandwich structure, which decomposes and produces a large amount of silver ions under the action of hydrogen peroxide solution. When mixed with urease, the activity of urease is greatly inhibited. After adding urea and phenol red mixed solution, silver ions inhibit urease activity, thereby inhibiting the hydrolysis of urea. The pH of the solution does not change significantly, and the color remains yellow. With the increase of breast cancer cells, the concentration of Ag ions increases, which greatly inhibits urease activity, resulting in the inhibition of urea decomposition. The pH of the solution does not change significantly, and the absorption peak of phenol red at 430nm becomes higher, and the absorption peak at 558nm becomes lower and lower, indicating that the ratio of ultraviolet absorption peaks depends on the concentration of breast cancer cells. In summary, the dynamic changes of the ultraviolet absorption peaks of phenol red at 558nm and 430nm can indicate the changes in the decomposition of ammonia by urea in the solution, thereby indicating the changes in urease activity, and thus indicating the changes in the concentration of breast cancer cells captured by silver nanoparticles.

[0073] It should be noted that Figure 6 The peaks at 430 nm in A correspond to the concentrations of breast cancer from bottom to top: 0 cells / mL, 10 cells / mL, 50 cells / mL, 100 cells / mL, 500 cells / mL, 1000 cells / mL, 5000 cells / mL, 10000 cells / mL, 50000 cells / mL, Figure 6 The opposite is true at 558 nm in A.

[0074] Depend on Figure 6 BC shows that there is a nonlinear positive correlation between the concentration of MCF-7 (breast cancer cells) and the ratio of the UV absorption peaks at 430nm and 558nm. The detection limit of MCF-7 is 2 cells / mL, and the dynamic range is 10 cells / mL to 10 4 cells / mL, the standard calibration curve is displayed in the range of 10 cells / mL to 104 cells / mL, which is logarithmically related to the concentration of MCF-7. 2 =0.990. That is, the detection limit of 200 nm silver nanoparticles for MCF-7 is 2 cells / mL.

[0075] The same detection was performed on the silver nanoparticles of other particle sizes (75nm, 100nm, 150nm, 300nm), and the results were as follows: the detection limit of 75nm silver nanoparticles for MCF-7 was 89cells / mL, the detection limit of 100nm silver nanoparticles for MCF-7 was 48cells / mL, the detection limit of 150nm silver nanoparticles for MCF-7 was 15cells / mL, and the detection limit of 300nm silver nanoparticles for MCF-7 was 13cells / mL.

[0076] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by any technician familiar with the art within the technical scope disclosed in the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on the protection scope of the claims.

Claims

1. A system for targeted quantitative detection of breast cancer cells in blood, characterized in that: It comprises a magnetic nanoparticle composite material, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, a hydrogen peroxide solution, a phosphate buffered saline solution, a urease solution, a urea solution, and a phenol red solution; wherein, The magnetic nanoparticle composite material comprises magnetic Fe3O4 nanoparticles and a polydopamine layer self-polymerized and grown on the surface of the Fe3O4 nanoparticles; The nucleotide sequence of the first modified nucleic acid chain is shown in SEQ ID NO: 1, and is used to modify the magnetic nanoparticle composite material; The nucleotide sequence of the second modified nucleic acid chain is shown in SEQ ID NO: 2, and is used to modify the Ag nanoparticles.

2. The system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that: The 3' end of the second modified nucleic acid chain is modified with a thiol group, and the Ag nanoparticles are connected to the second modified nucleic acid chain via an Ag-S bond.

3. The system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that: The particle size of the magnetic nanoparticle composite material is 150 nm, the thickness of the polydopamine is 17 nm; and the particle size of the Ag nanoparticle is 75-300 nm.

4. The system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that: The concentration of the hydrogen peroxide solution is 10-30 mM, the pH value of the phosphate buffered saline solution is 7.4, the concentration of the urease solution is 10 nM, the concentration of the urea solution is 100 mM, and the concentration of the phenol red solution is 100 μM.

5. The method for preparing a system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that: The following steps are involved: S1. Preparation of magnetic nanoparticle composite materials: Synthesize magnetic Fe3O4 nanoparticles based on a hydrothermal method, and then grow a polydopamine layer on the surface of the magnetic Fe3O4 nanoparticles by self-polymerization; S2. Preparation of Ag nanoparticles: Silver nano seeds are prepared by sodium citrate reduction method; the silver nano seeds, ascorbic acid, silver nitrate and ammonia water are mixed and reacted to prepare uniform quasi-spherical Ag nano particles of 75-300nm.

6. The method for preparing a system for targeted quantitative detection of breast cancer cells in blood according to claim 5, characterized in that: The preparation method of the magnetic nanoparticle composite material comprises the following steps: A1. Add ferric chloride hexahydrate and sodium acetate trihydrate to a solvent and stir to obtain a mixture; add sodium acetate to the mixture and stir to obtain a mixture, then transfer the mixture to a polytetrafluoroethylene-lined autoclave and raise the temperature to 200° C. to react for 12 hours, and then wash to obtain Fe3O4 magnetic nanoparticles; A2. Add the Fe3O4 magnetic nanoparticles and DOPA hydrochloride solution into a Tris-HCl buffer solution and react for 8 hours, then wash and freeze-dry to obtain a magnetic nanoparticle composite material, namely, Fe3O4@PDA nanoparticles; wherein the pH value of the Tris-HCl buffer solution is 8.

5.

7. Use of the system for targeted quantitative detection of breast cancer cells in blood according to any one of claims 1 to 4 or the system for targeted quantitative detection of breast cancer cells in blood prepared by the preparation method according to claims 5 to 6 for non-disease diagnosis and treatment purposes of targeted quantitative detection of breast cancer cells in blood.

8. The use according to claim 7, characterized in that: The following steps are involved: T1, modifying the surface of the magnetic nanoparticle composite material with the first modified nucleic acid chain to obtain N1-Fe3O4@PDA nanoparticles; modifying the surface of the Ag nanoparticles with the second modified nucleic acid chain to obtain S1-Ag NPs complex; T2, adding the N1-Fe3O4@PDA to the sample to be tested and incubating the mixture to form a cancer cell-magnetic nanoparticle coupling product; T3, transferring the cancer cell-magnetic nanoparticle coupling product to the phosphate buffered saline solution by magnetic separation, and then adding the S1-Ag NPs and incubating to form a magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure; T4. After adding the magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure to the hydrogen peroxide solution and reacting, taking the supernatant and adding it to the urease solution for incubation, then adding the urea solution and phenol red solution for incubation, and recording the ultraviolet absorption signal of the incubated solution.

9. The use according to claim 8, characterized in that: The process of modifying the first modified nucleic acid chain on the surface of the magnetic nanoparticle composite material is specifically as follows: The magnetic nanoparticle composite material and the first modified nucleic acid chain are added to a solution containing Ca 2+ The reaction was incubated in a HEPES buffer solution for 2 h, and then washed several times with a HEPES buffer solution by magnetic separation to obtain N1-Fe3O4@PDA nanoparticles; The process of modifying the surface of the Ag nanoparticles with the second modified nucleic acid chain is specifically as follows: The thiolated second modified nucleic acid chain is incubated with TCEP, and then mixed and incubated with Ag nanoparticles to obtain a mixture; citric acid buffer and phosphate buffer are sequentially added to the mixture and mixed, and then centrifuged to obtain an S1-Ag NPs complex.

10. The use according to claim 8, characterized in that: In step T2, the incubation condition for adding N1-Fe3O4@PDA was 37°C for 120 min; in step T3, the incubation condition for adding S1-Ag NPs was 37°C for 15 min; in step T4, the reaction time for adding hydrogen peroxide solution was 10 min, and the incubation condition for adding urease solution was 37°C for 15 min.

Images