An SNP molecular marker associated with the body length growth trait of Litopenaeus vannamei, a detection primer thereof, and an application thereof

Abstract

The present invention discloses an SNP molecular marker associated with the body length growth trait of Litopenaeus vannamei, a detection primer thereof, and its application. The sequence of the SNP molecular marker is shown in SEQ ID NO.1. The SNP locus is located at the 282nd position from the 5'-end of the sequence shown in SEQ ID NO.1, and the polymorphism of the SNP molecular marker is of the T / C type. This SNP locus can be used for screening the body length of Litopenaeus vannamei in the assisted breeding of Litopenaeus vannamei. The primer designed according to the SEQ ID NO.1 sequence or the kit prepared from this primer can be used to detect this SNP locus. The SNP molecular marker Chr37_11743678 provided by the present invention can be used to assist in selecting fast-growing parents. By selecting parents with the CC genotype in this SNP molecular marker, the growth rate of the breeding population can be improved, providing an innovative tool for the molecular breeding of Litopenaeus vannamei, shortening the breeding cycle, and facilitating the development of the industry and the improvement of efficiency.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular marker-assisted breeding of aquatic animals, and particularly relates to an SNP molecular marker associated with the body length growth trait of Litopenaeus vannamei, a detection primer thereof, and applications thereof. Background Art

[0002] Litopenaeus vannamei, also known as the whiteleg shrimp or Pacific white shrimp, belongs to the phylum Arthropoda, class Crustacea, order Decapoda, family Penaeidae, genus Penaeus. It is a pillar species in the global aquaculture industry, with the highest aquaculture production and being one of the aquaculture species with the highest single output value. Litopenaeus vannamei is widely cultured due to its fast growth rate, strong environmental adaptability, and high economic value. However, during the aquaculture process, there are significant differences in the growth performance of Litopenaeus vannamei. The growth traits of shrimp are mainly affected by various genetic and environmental factors. Among them, body weight and growth rate are important indicators to measure its economic value. A lighter body weight or a slow growth rate will seriously affect the aquaculture benefit and economic benefit.

[0003] The molecular breeding of Litopenaeus vannamei mainly relies on traditional breeding selection methods. Although these methods can improve growth traits to a certain extent, they have the following defects: (1) Long breeding cycle and low efficiency: Traditional breeding methods select better-performing individuals for reproduction. However, due to the strong quantitative and environmental influence of growth traits, the breeding cycle is long and the efficiency is low, making it difficult to meet the growing market demand; (2) Lack of accurate molecular markers: Although some genomics technologies (such as genomic selection, marker-assisted selection) have been applied to the breeding of shrimp, there is still a lack of efficient molecular markers for growth traits. Existing markers are often more general and cannot accurately identify genetic factors highly related to growth traits, resulting in limited efficiency of genetic improvement; (3) Difficulty in achieving the accuracy of genetic improvement: Due to the complex genetic basis of the growth traits of Litopenaeus vannamei, traditional phenotypic selection methods are often greatly affected by environmental factors, making it difficult to accurately screen and transmit excellent growth traits.

[0004] In recent years, the rapid development of molecular breeding technology has brought new ideas to the aquaculture industry. SNP (Single Nucleotide Polymorphism) refers to the polymorphism of single nucleotides in the genome. As the third-generation molecular marker, SNP molecular markers are currently the most widely used and latest molecular markers, with characteristics such as high density, strong stability, and co-dominance. They are currently the most widely used molecular marker technology in economic crustaceans such as shrimp and crabs. However, as a complex quantitative trait, the growth traits of Litopenaeus vannamei still need further exploration and verification of new genetic markers.

[0005] Therefore, the development of SNP molecular markers for the body length growth trait of Litopenaeus vannamei is of great significance for the breeding of new varieties of Litopenaeus vannamei, provides an innovative tool for the molecular breeding of Litopenaeus vannamei, shortens the breeding cycle, and helps the development of the industry and the improvement of efficiency. Summary of the Invention

[0006] The object of the present invention is to provide an SNP molecular marker, detection primers associated with the body length growth trait of Litopenaeus vannamei, and apply them to the breeding of fast-growing varieties of penaeid shrimps, accelerate the genetic improvement of growth traits, improve breeding efficiency and economic benefits. To achieve the above object:

[0007] On the one hand, the present invention provides an SNP molecular marker, and the sequence of the SNP molecular marker is shown as SEQ ID NO.1; the SNP locus is located at the 282nd position from the 5' end of the sequence shown as SEQ ID NO.1; the polymorphism of the SNP molecular marker is of the T / C type.

[0008] On the other hand, the present invention provides an application of an SNP molecular marker in the assisted breeding of Litopenaeus vannamei, and the sequence of the SNP molecular marker is shown as SEQ ID NO.1; the SNP locus is located at the 282nd position from the 5' end of the sequence shown as SEQ ID NO.1; the polymorphism of the SNP molecular marker is of the T / C type.

[0009] Furthermore, the assisted breeding is the body length screening of Litopenaeus vannamei.

[0010] On the other hand, the present invention provides a primer pair, and the base sequence of the primer pair is:

[0011] Forward primer Fw: 5'-TGTAGAAATGCGCTCACATGC-3';

[0012] Reverse primer Rw: 5'-ATTACAGACGCACAGCAGCA-3';

[0013] Furthermore, the primer pair is used to detect the SNP molecular marker, and the sequence of the SNP molecular marker is shown as SEQ ID NO.1; the SNP locus is located at the 282nd position from the 5' end of the sequence shown as SEQ ID NO.1; the polymorphism of the SNP molecular marker is of the T / C type.

[0014] On the other hand, the present invention provides an application of a primer pair in the assisted breeding of Litopenaeus vannamei.

[0015] On the other hand, the present invention provides a detection kit for Litopenaeus vannamei, and the detection kit includes a primer pair; the base sequence of the primer pair is:

[0016] Forward primer Fw: 5’-TGTAGAAATGCGCTCACATGC-3’;

[0017] Reverse primer Rw: 5’-ATTACAGACGCACAGCAGCA-3’.

[0018] On the other hand, the present invention provides the application of the detection kit in the assisted breeding of Litopenaeus vannamei.

[0019] On the other hand, the present invention provides a method for assisted breeding of Litopenaeus vannamei, comprising the following steps:

[0020] Step A: Detect the SNP molecular marker of Litopenaeus vannamei to obtain the genotype of the SNP locus; the sequence of the SNP molecular marker is as shown in SEQ ID NO.1; the SNP locus is located at the 282nd position from the 5’ end of the sequence shown in SEQ ID NO.1; the polymorphism of the SNP molecular marker is T / C type;

[0021] Step B: Screen according to the genotype of the SNP locus; the genotype of the SNP locus is CC, TC or TT genotype; the screening is based on the body length of Litopenaeus vannamei;

[0022] Step C: Use Litopenaeus vannamei with the CC genotype of the SNP locus for breeding.

[0023] Further, step A includes:

[0024] Step A-1: Extract the genomic DNA of Litopenaeus vannamei;

[0025] Step A-2: Using the genomic DNA of Litopenaeus vannamei as a template, perform PCR amplification with the following primer pair: Forward primer Fw: 5’-TGTAGAAATGCGCTCACATGC-3’, Reverse primer Rw: 5’-ATTACAGACGCACAGCAGCA-3’;

[0026] The PCR amplification system is a 25 μL amplification system; the 25 μL amplification system includes: genomic DNA of Litopenaeus vannamei (100 ng / μL), 1 μL; Forward primer Fw (10 μM), 1 μL; Reverse primer Rw (10 μM), 1 μL; 2×Taq Plus Master Mix Ⅱ (Plus), 12.5 μL; enzyme-free and sterile water, 9.5 μL;

[0027] The PCR amplification program sequentially includes: pre-denaturation at 95℃ for 3 min; then perform 32 cycles: 95℃ for 15 s; 56℃ for 20 s; 72℃ for 40 s; sufficient extension at 72℃ for 10 min;

[0028] The PCR amplification product was obtained, and sequencing was performed using the PCR amplification product to obtain the genotype of the SNP locus; the genotype of the SNP locus was C / T at position 282 of the sequence shown in SEQ ID NO.1.

[0029] Furthermore, the body length of Litopenaeus vannamei individuals with the CC genotype at the SNP locus > the body length of Litopenaeus vannamei individuals with the TC genotype at the SNP locus > the body length of Litopenaeus vannamei individuals with the TT genotype at the SNP locus.

[0030] Furthermore, Litopenaeus vannamei individuals with the CC genotype at the SNP locus were retained, and breeding was carried out by pairing the parents of Litopenaeus vannamei with the CC genotype.

[0031] In the present invention, a SNP molecular marker Chr37_11743678 associated with body length located on chromosome 37 of Litopenaeus vannamei was mapped by genome-wide association analysis. The sequence of this SNP molecular marker is shown in SEQ ID NO.1. The SNP locus is located at position 282 from the 5' end of the sequence shown in SEQ ID NO.1, and the polymorphism is of the T / C type. Primers SEQ ID NO.2 and SEQ ID NO.3 designed according to the SEQ ID NO.1 sequence can detect this SNP molecular marker, and the above primers can also be prepared into a kit. Therefore, the SNP molecular marker Chr37_11743678 provided by the present invention can be used to assist in the selection of fast-growing parents. By selecting parents with the CC genotype in this SNP molecular marker, the growth rate of the breeding population can be improved, providing an innovative tool for the molecular breeding of Litopenaeus vannamei, shortening the breeding cycle, and facilitating industrial development and efficiency improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The above content of the present invention and the following specific embodiments will be better understood when read in conjunction with the accompanying drawings. It should be noted that the drawings are only examples of the claimed technical solutions.

[0033] Figure 1 It is the Manhattan plot of the genome-wide association analysis of the body length of Litopenaeus vannamei in Example 1;

[0034] Figure 2 It is the box plot of the body length distribution of Litopenaeus vannamei individuals with different genotypes in Example 1 (where the abscissa is the genotype, red is the CC genotype, green is the CT genotype, and blue is the TT genotype; the ordinate is the body length of Litopenaeus vannamei, with the unit of (mm); "*" represents that there is a significant difference in the body length of Litopenaeus vannamei individuals between two genotypes in terms of the P value; "****" represents that there is an extremely significant difference in the body length of Litopenaeus vannamei individuals between two genotypes);

[0035] Figure 3 Agarose gel electrophoresis pattern of Litopenaeus vannamei genomic DNA in Example 2 (where A is the electrophoresis result of Litopenaeus vannamei genomic DNA numbered 1-8; B is the electrophoresis result of Litopenaeus vannamei genomic DNA numbered 9-16; M is Marker; 1-16 are all target genes, with a length exceeding 5000 bp and good integrity).

[0036] Figure 4 Agarose gel electrophoresis pattern of PCR amplification products of Litopenaeus vannamei in Example 2 (where A is the electrophoresis result of Litopenaeus vannamei genomic DNA numbered 1-8; B is the electrophoresis result of Litopenaeus vannamei genomic DNA numbered 9-16; M is Marker; 0 is the blank control: enzyme-free and sterile water; 1-8 and 9-16 are all PCR products of the target sequence, with a length of about 348 bp).

[0037] Figure 5 Flow chart for sequence sequencing in Example 2

[0038] Figure 6 Peak diagram of the sequencing result of the PCR amplification product of Litopenaeus vannamei in Example 2 (where the genotype at the 219th position is the target genotype). Detailed implementation manners

[0039] The detailed features and advantages of the present invention are described in detail below in the specific implementation manners. The content is sufficient to enable any person skilled in the art to understand the technical content of the present invention and implement it accordingly. According to the description, claims and drawings disclosed in this specification, those skilled in the art can easily understand the related objectives and advantages of the present invention.

[0040] It should be noted that in this specification, similar reference numerals and letters denote similar items in the following drawings. Therefore, once an item is defined in one drawing, it does not need to be further defined and explained in subsequent drawings.

[0041] To make the objectives, technical solutions and advantages of the present invention clearer, the embodiments of the present invention will be further described in detail below with reference to the drawings. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels unless otherwise specified.

[0042] (1) Source of sample materials

[0043] In this embodiment, Litopenaeus vannamei was purchased from Hainan Renhai Aquatic Science and Technology Co., Ltd. (Wenchang City, Hainan Province).

[0044] (2) Source of reagents and consumables

[0045] Table 1 Sources and Catalog Numbers of Reagents and Consumables Required for Experiments

[0046]

[0047] (3)Sources of Instrument and Equipment

[0048] Table 2 Sources and Models of Instrument and Equipment Required for Experiments

[0049]

[0050] Example 1

[0051] An SNP molecular marker associated with the body length growth trait of Litopenaeus vannamei, comprising the following steps:

[0052] S1. Sample collection and sequencing, specifically referring to the following steps:

[0053] Randomly select 996 individuals from an 8-month-old Litopenaeus vannamei population. Measure the body length of each Litopenaeus vannamei with a ruler (accurate to 1 mm), and collect its antenna samples for genomic analysis. Send the antenna samples of Litopenaeus vannamei to Novogene Co., Ltd. in Beijing for genomic resequencing. A total of 14,276,173 SNP loci are obtained. After quality control of the above-obtained 14,276,173 SNP loci, a total of 2,706,353 SNP loci are screened out.

[0054] S2. Analysis of the association between the body length of Litopenaeus vannamei and genotypes, specifically referring to the following steps:

[0055] (1)According to the gene resequencing results in step S1, using the whole-genome SNP genotyping data of the 2,706,353 SNP loci that have been screened out, perform principal component analysis (PCA) and population structure analysis using PLINK software. Take the first ten principal components, the population structure matrix, and gender as covariates to control the interference of population structure and gender on the analysis results. Use the compressed mixed linear model (CMLM) of the GAPIT package to combine the SNP genotypes and phenotypic data of Litopenaeus vannamei for genome-wide association analysis (GWAS, Genome-Wide Association Studies).

[0056] The formula is as follows:

[0057] ,

[0058] Among them, Y is an n×1 phenotypic vector that contains the phenotypic values of n individuals. X is an n×p design matrix that includes independent variables of fixed effects, such as SNP genotypes and other covariates (gender, age, etc.). β is a p×1 vector of fixed-effect coefficients, representing the fixed effect of SNP genotypes on the phenotype. Zc is an n×q compressed design matrix used to represent random effects. uc is a q×1 random-effect vector, which is usually assumed to follow a multivariate normal distribution uc~N(0, Iq), where Iq is a q×q identity matrix, is the variance of the random effect. is an n×1 error vector, assuming ~N(0, In), where In is an n×n identity matrix, is the variance of the error.

[0059] According to the Bonferroni correction, α Bonferroni = α / m, where α is the global significance level (usually taken as 0.05), and m is the number of independent tests performed (usually the number of SNPs tested).

[0060] The results are as Figure 1 shown. Through GWAS analysis, the significance threshold for determining the degree of association between SNPs and the body length trait of Litopenaeus vannamei is 1.85×10 -8 . The SNP molecular marker Chr37_11743678 associated with the body length growth trait of Litopenaeus vannamei was located at the 11,743,678th position on chromosome 37 of Litopenaeus vannamei. The nucleotide sequence of this SNP molecular marker Chr37_11743678 is as shown in SEQ ID NO.1. Through genotyping, it was found that the genotypes of this SNP molecular marker Chr37_11743678 were CC, TC, and TT. Among them, the 282nd base from the 5' end of the SNP molecular marker as shown in SEQ ID NO.1 was T or C, which was a T / C type SNP molecular marker. After classifying the individuals of Litopenaeus vannamei using the genotypes, an association analysis was performed on the body length of Litopenaeus vannamei.

[0061] (2) Use one-way analysis of variance (ANOVA) to detect the differences in body length among the three genotype groups of Litopenaeus vannamei, and use the T-test to pairwise compare the body lengths between different genotypes, namely CC vs TC, CC vs TT, and TC vs TT (Table 3), and visually display the body length distribution of individuals with different genotypes through a box plot ( Figure 2 ).

[0062] As shown in Table 3, the three genotypes of the SNP locus Chr37_11743678 all significantly affect the body length growth trait of Litopenaeus vannamei (for one-way ANOVA, a P - value < 0.05 indicates a significant difference; for pairwise T - tests, a P - value < 0.05 indicates a significant difference). Among them, the average body length of Litopenaeus vannamei individuals with the CC genotype is significantly greater than that of individuals with the TC genotype and the TT genotype (P < 0.05), and the average body length of individuals with the TC genotype is significantly greater than that of TT individuals (P < 0.05).

[0063] As Figure 2 shown, the box plot shows the distribution of the three genotypes (CC, CT, TT) of the SNP locus lg37_11743678 in the body length trait of Litopenaeus vannamei. The average values for each genotype are 211.28 mm (CC), 205.16 mm (CT), and 199.31 mm (TT); the maximum values are 237.63 mm (CC), 246.51 mm (CT), and 250.32 mm (TT); the minimum values are 188.47 mm (CC), 174.48 mm (CT), and 157.2 mm (TT). The standard deviation of the CT genotype is 12.58, that of the TT genotype is 11.57, and that of the CC genotype is 12.47.

[0064] It can be seen that the individuals with the CC genotype have the highest average body length and a relatively balanced distribution, showing more superior growth traits. By pairwise T - test to analyze the significance of the body length differences between genotypes, "*" indicates a P - value < 0.05 (significant difference), and "****" indicates a P - value < 0.0001 (extremely significant difference). The test results show that the difference between the CC and CT genotypes is significant (*), while the differences between the CC and TT, and CT and TT genotypes are extremely significant (****).

[0065] From this, it can be known that the C allele contributes to the body length growth of Litopenaeus vannamei and is a favorable allele; while the T allele has a negative effect on growth. Therefore, the CC genotype is the best genotype and has important selection value in the breeding process.

[0066] Body length is an important indicator to measure the growth and development of Litopenaeus vannamei, and is closely related to the individual's adaptability to the environment, economic value, production performance, and reproductive ability.

[0067] In the breeding process, by gradually eliminating individuals carrying unfavorable genotypes (such as TC and TT types) and preferentially retaining individuals with favorable genotypes (such as CC type), the frequency of favorable genotypes at this locus can be increased generation by generation, thereby improving the growth performance and market competitiveness of the entire population.

[0068] Table 3 Correlation analysis between SNP locus Chr37_11743678C / T of molecular marker and body length of Litopenaeus vannamei

[0069]

[0070] Example 2

[0071] Application of an SNP molecular marker associated with the body length growth trait of Litopenaeus vannamei in breeding, including the following steps:

[0072] S1. Extraction of genomic DNA of Litopenaeus vannamei

[0073] Randomly select 16 large and small shrimps from the 8-month-old Litopenaeus vannamei population, cut the shrimp whiskers of Litopenaeus vannamei, grind them into powder using liquid nitrogen, and extract the genomic DNA of Litopenaeus vannamei using a marine animal genomic DNA extraction kit (Tiangen Biochemical, and all the following reagents and consumables are from this kit). The DNA extraction steps are referred to as follows:

[0074] (1) Sample pretreatment: Weigh 30 mg of shrimp whiskers, add 200 μL of GA buffer into a centrifuge tube, mix gently, and shake for 15 seconds to ensure that the shrimp whisker tissue is completely wetted.

[0075] (2) Proteinase K digestion: Add 20 μL of Proteinase K solution (20 mg / mL) into the centrifuge tube, mix well, and incubate in a 56°C incubator until the tissue is completely dissolved.

[0076] (3) Lysis and precipitation: Add 200 μL of GB lysis buffer, mix well, and place in a 70°C water bath for 10 minutes, then add 200 μL of absolute ethanol and mix well.

[0077] (4) Adsorption column purification: Transfer the mixture to a CB3 adsorption column, place it in a collection tube, centrifuge at 12000 rpm for 30 seconds, and then discard the waste liquid. Then add 500 μL of GD buffer and 600 μL of PW washing solution respectively, centrifuge for 30 seconds each time, and wash the adsorption column to remove impurities.

[0078] (5) Adsorption column drying: Place the washed adsorption column in a centrifuge tube again, centrifuge at 12000 rpm for 2 minutes, and then let it stand at room temperature for 2 - 5 minutes to ensure that the ethanol in the adsorption column is completely evaporated.

[0079] (6) DNA elution: Place the adsorption column in a new centrifuge tube, add 50 - 200 μL of sterilized water to the middle of the adsorption column, let it stand at room temperature for 2 minutes, and then centrifuge at 12000 rpm for 2 minutes to collect the eluted DNA solution.

[0080] (7)Quality inspection and preservation: Use a spectrophotometer to detect the concentration and purity of DNA to ensure that the OD 260 / OD 280 is between 1.8 - 2.0, and the OD 260 / OD 230 is greater than 2.0.

[0081] The final concentration of the obtained Litopenaeus vannamei genomic DNA is 100 ng / μL. Use 1.5% agarose gel electrophoresis to detect the Litopenaeus vannamei genomic DNA, and store the remaining Litopenaeus vannamei genomic DNA in a -20°C refrigerator for future use.

[0082] The results of the first agarose gel electrophoresis are as Figure 3 shown. Among them, M is the Marker, and 1 - 16 are all target genes, with lengths exceeding 5000 bp and good integrity.

[0083] S2. Primer design

[0084] Use the Primer - BLAST function module of NCBI to design primers for the SEQ ID NO.1 sequence (referred to as the target sequence) where the SNP molecular marker of Litopenaeus vannamei exists:

[0085] Forward primer Fw: SEQ ID NO.2: 5’ - TGTAGAAATGCGCTCACATGC - 3’

[0086] Reverse primer Rw: SEQ ID NO.3: 5’ - ATTACAGACGCACAGCAGCA - 3’.

[0087] Send the synthesized SNP molecular marker primers (Fw and Rw) to Beijing Tsingke Biotechnology Co., Ltd. for primer synthesis, which will be used for subsequent PCR amplification reactions.

[0088] S3. PCR amplification reaction

[0089] Use the Litopenaeus vannamei genomic DNA obtained in step S1 of Example 2 as a template, and use the SNP molecular marker primers (SEQ ID NO.2 and SEQ ID NO.3) synthesized in step S2 of Example 2 to perform PCR amplification reactions on the target sequence. The specific steps are as follows:

[0090] (1)The PCR amplification reaction system (25 μL system) is designed as follows:

[0091] Litopenaeus vannamei genomic DNA (100 ng / μL), 1 μL;

[0092] Forward primer Fw (10 μM), 1 μL;

[0093] Reverse primer Rw (10 μM), 1 μL;

[0094] 2×Taq Plus Master Mix Ⅱ (Plus), 12.5 μL;

[0095] Enzyme-free and sterile water, 9.5 μL.

[0096] (2) The PCR amplification reaction program is as follows:

[0097] Pre-denaturation at 95°C for 3 min;

[0098] Denaturation at 95°C for 15 s;

[0099] Annealing at 56°C for 20 s;

[0100] Extension at 72°C for 40 s, with a total of 32 cycles from denaturation to extension;

[0101] Full extension at 72°C for 10 min;

[0102] Store at 4°C.

[0103] After the PCR amplification reaction, the PCR amplification product is obtained, and the PCR amplification product is detected by 1.5% agarose gel electrophoresis.

[0104] The results of the second agarose gel electrophoresis are as Figure 4 shown, where M is Marker; 1 and 10 are blank controls: enzyme-free and sterile water; 2 - 9 and 11 - 18 are all target sequences, and there are relatively bright bands at around 348 bp for the target sequences.

[0105] Verification of S4 and SNP sites

[0106] The PCR amplification product obtained in step S3 is sent to Novogene Co., Ltd. in Beijing for forward sequencing. The sequencing primer T is: 5’-CAAAGGTCATCCTCATGTTCAT-3’ (SEQ ID NO.4). For the specific primer design and sequencing process, see Figure 5 , and from Figure 5 it can be known that the target sequence SEQ ID NO.1 is PCR amplified by the forward primer SEQ ID NO.2 and the reverse primer SEQ ID NO.3 to obtain the PCR amplification product, and then the PCR amplification product is forward sequenced by the sequencing primer SEQ ID NO.4 to obtain the sequencing result SEQ ID NO.5 of the SNP site Chr37_11743678.

[0107] According to the sequencing peak map of the PCR amplification product ( Figure 6)Genotype the SNP locus Chr37_11743678 (G: SEQ ID NO.5). The sequence length of SEQ ID NO.5 is shorter than that of SEQ ID NO.1. That is, for the Chr37_11743678 molecular marker, the 282nd base from the 5'-end is T or C as shown in SEQ ID NO.1, which is a T / C type SNP molecular marker. This is equivalent to the 219th base from the 5'-end being T or C as shown in SEQ ID NO.5 for the Chr37_11743678 molecular marker, which is also a T / C type SNP molecular marker.

[0108] If there is only one C base peak at position 219, the genotyping result is CC type; if there is only one T base peak at position 219, the genotyping result is TT type; if there are both C and T base peaks at position 219, the genotyping result is T / C type.

[0109] The body lengths corresponding to the genotypes of the measured Litopenaeus vannamei and the genotype frequencies in large and small shrimps are shown in Table 4. The average body length of Litopenaeus vannamei with the CC genotype at the 219th position is 226.73 mm, and the genotype frequency in large shrimps is 45%, while the genotype frequency in small shrimps is 0; the average body length of Litopenaeus vannamei with the TC genotype at the 219th position is 204.55 mm, and the genotype frequency in large shrimps is 45%, while the genotype frequency in small shrimps is 30%; the average body length of Litopenaeus vannamei with the TT genotype at the 219th position is 177.23 mm, and the genotype frequency in large shrimps is 10%, while the genotype frequency in small shrimps is 70%.

[0110] Table 4 Distribution of body lengths corresponding to the genotypes of Litopenaeus vannamei and genotype frequencies in large and small shrimps

[0111]

[0112] Therefore, the CC genotype is associated with a faster growth rate, while the TT genotype is associated with a slower growth rate. Therefore, by selecting parents with the CC genotype in the SNP locus Chr37_11743678 marker, the growth rate of the breeding population can be improved.

[0113] It can be concluded therefrom that through genome-wide association study, the present invention locates the SNP molecular marker Chr37_11743678 related to body length on chromosome 37 of Litopenaeus vannamei. The sequence of this SNP molecular marker is shown in SEQ ID NO.1. The SNP locus is located at the 282nd position from the 5'-end of the sequence shown in SEQ ID NO.1, and the polymorphism is of the T / C type. The primers SEQ ID NO.2 and SEQ ID NO.3 designed according to the sequence of SEQ ID NO.1 can detect this SNP molecular marker, and the above primers can also be prepared into a kit. Therefore, the SNP molecular marker Chr37_11743678 provided by the present invention can be used to assist in the selection of fast-growing parents. By selecting parents with the CC genotype in this SNP molecular marker, the growth rate of the breeding population can be increased, providing an innovative tool for the molecular breeding of Litopenaeus vannamei, shortening the breeding cycle, and facilitating the development of the industry and the improvement of efficiency.

[0114] The terms and expressions used herein are for descriptive purposes only, and the present invention should not be limited to these terms and expressions. The use of these terms and expressions does not exclude any equivalent features of the illustration and description (or parts thereof), and it should be recognized that various modifications that may exist should also be included within the scope of the claims. Other modifications, variations, and substitutions may also exist. Accordingly, the claims should be regarded as covering all such equivalents.

[0115] Similarly, it should be noted that although the present invention has been described with reference to the current specific embodiments, those of ordinary skill in the art in this technical field should recognize that the above embodiments are only used to illustrate the present invention, and various equivalent changes or substitutions can be made without departing from the spirit of the present invention. Therefore, as long as the changes and modifications of the above embodiments are within the scope of the spirit of the present invention, they will fall within the scope of the claims of the present invention.

Claims

1. An application of SNP molecular markers in assisted breeding of Penaeus vannamei, characterized in that: The sequence of the SNP molecular marker is as shown in SEQ ID NO.1; the SNP site is located at the 282nd position from the 5' end of the sequence shown in SEQ ID NO.1; the polymorphism of the SNP molecular marker is T / C type; The auxiliary breeding is for breeding the long-bodied individuals or the fast-growing individuals of the vannamei shrimp.

2. Application of a SNP molecular marker reagent in breeding long-bodied individuals or fast-growing individuals of Penaeus vannamei, characterized in that: The reagent is a primer pair, and the base sequence of the primer pair is: Forward primer Fw: 5′-TGTAGAAATGCGCTCACATGC-3′; Reverse primer Rw: 5′-ATTACAGACGCACAGCAGCA-3′; The sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP site is located at the 282nd position from the 5' end of the sequence shown in SEQ ID NO.1; the polymorphism of the SNP molecular marker is T / C type.

3. Application of a SNP molecular marker kit in breeding long-bodied individuals or fast-growing individuals of Penaeus vannamei, characterized in that: The kit includes a primer pair; the base sequence of the primer pair is: Forward primer Fw: 5′-TGTAGAAATGCGCTCACATGC-3′; Reverse primer Rw: 5′-ATTACAGACGCACAGCAGCA-3′; The sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP site is located at the 282nd position from the 5' end of the sequence shown in SEQ ID NO.1; the polymorphism of the SNP molecular marker is T / C type.

4. A method for assisted breeding of Penaeus vannamei, characterized in that: The following steps are involved: Step A: detecting the SNP molecular marker of Litopenaeus vannamei to obtain the genotype of the SNP site; the sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP site is located at the 282nd position from the 5' end of the sequence shown in SEQ ID NO.1; the polymorphism of the SNP molecular marker is T / C type; Step B: screening according to the genotype of the SNP site; the genotype of the SNP site is CC, TC or TT; the screening is based on the body length of the vannamei shrimp; Step C: breeding the shrimp Penaeus vannamei with the CC genotype of the SNP site.

5. The method for assisted breeding of Penaeus vannamei according to claim 4, characterized in that: The step A comprises: Step A-1: ​​extracting genomic DNA of the shrimp Penaeus vannamei; Step A-2: using the genomic DNA of the vannamei shrimp as a template, PCR amplification was performed using the following primer pair: forward primer Fw: 5'-TGTAGAAATGCGCTCACATGC-3', reverse primer Rw: 5'-ATTACAGACGCACAGCAGCA-3'; The PCR amplification system is a 25 μL amplification system; the 25 μL amplification system includes: 1 μL of genomic DNA of Penaeus vannamei with a concentration of 100 ng / μL; 1 μL of forward primer Fw with a concentration of 10 μM; 1 μL of reverse primer Rw with a concentration of 10 μM; 12.5 μL of 2×Taq Plus Master Mix Ⅱ Plus; 9.5 μL of enzyme-free sterile water; The PCR amplification procedure includes: pre-denaturation at 95°C for 3 min; then 32 cycles of: 95°C for 15 s; 56°C for 20 s; 72°C for 40 s; full extension at 72°C for 10 min; A PCR amplification product is obtained, and the PCR amplification product is used for sequencing to obtain the genotype of the SNP site; the genotype of the SNP site is T / C at position 282 of the sequence shown in SEQ ID NO.

1.

6. The method for assisted breeding of Penaeus vannamei according to claim 4, characterized in that: The basis for screening according to the genotype of the SNP site is: the body length of the vannamei shrimp individuals with the CC genotype of the SNP site> the body length of the vannamei shrimp individuals with the TC genotype of the SNP site> the body length of the vannamei shrimp individuals with the TT genotype of the SNP site.

7. The method for assisted breeding of Penaeus vannamei according to claim 4, characterized in that: The vannamei shrimp with CC genotype at the SNP site is retained, and breeding is performed by pairing and breeding the vannamei shrimp parents with CC genotype.

Images