Nucleic acid amplification kit and nucleic acid detection method

Abstract

The invention relates to a nucleic acid amplification kit and a nucleic acid detection method, the nucleic acid amplification kit comprises a nucleic acid extraction reagent, and the nucleic acid extraction reagent comprises the following components: Tris-HCl, NaCl, triethylenetetramine, dithiothreitol and a surfactant; wherein the working concentration of the Tris-HCl is 0.05 mol / L to 0.2 mol / L; the working concentration of the NaCl is 120 to 140 mM; the working concentration of the triethylene tetramine is 80 to 110 mM; the working concentration of the dithiothreitol is 3 to 6 mM; and the volume fraction of the surfactant is 0.1%-0.5%. According to the nucleic acid amplification kit disclosed by the invention, cells in a biological sample can be quickly cracked and high-concentration nucleic acid can be released, the released nucleic acid can keep certain stability, and the concentration meets the requirement of a subsequent direct expansion step; meanwhile, triethylenetetramine can be rapidly combined with protein impurities in cells, so that the triethylenetetramine cannot inhibit the activity of DNA polymerase.

Description

Technical Field

[0001] The present application relates to the technical field of nucleic acid extraction, and more particularly, to a nucleic acid extraction reagent, a nucleic acid detection kit and a method. Background Art

[0002] The preparation of long-fragment genomic DNA molecules has a wide range of demands in the biological field, especially in DNA sequencing and genome assembly. The SMRT long-read sequencing technology can reach 60-100 Kb for the single-molecule sequencing length, while the nanopore sequencing technology can detect single-molecule DNA fragments up to Mb level. With the development of sequencing technologies and technologies such as optical mapping, there is a higher demand for simply and rapidly extracting long-fragment genomic DNA molecules. However, there are problems of long time consumption, complex operation and easy decomposition during the extraction of long-fragment genomic DNA.

[0003] How to extract long-fragment genomic DNA is a difficulty in nucleic acid preparation. Summary of the Invention

[0004] In order to solve the above problems and achieve direct amplification of long-fragment genomic DNA, the first object of the present application is to provide a nucleic acid amplification kit, including a nucleic acid extraction reagent, and the nucleic acid extraction reagent includes the following components: Tris-HCl, NaCl, triethylenetetramine, dithiothreitol and a surfactant; wherein, the working concentration of Tris-HCl is 0.05-0.2 mol / L; the working concentration of NaCl is 120-140 mM; the working concentration of triethylenetetramine is 80-110 mM; the working concentration of dithiothreitol is 3-6 mM; the volume fraction of the surfactant is 0.1%-0.5%.

[0005] The present application uses a combination of high concentrations of sodium chloride, triethylenetetramine, dithiothreitol and a surfactant, so that the cells in the nucleic acid sample can be rapidly lysed and release a high concentration of nucleic acid. The released nucleic acid can maintain a certain stability and meet the concentration requirements for subsequent direct amplification of long-fragment amplicons; at the same time, triethylenetetramine can rapidly bind to protein impurities in the cells, such as hemoglobin, cell debris, proteins, etc., so that they do not inhibit the activity of DNA polymerase.

[0006] In one embodiment, the nucleic acid extraction reagent satisfies at least one of the following conditions (1)-(2):

[0007] (1) The pH of the nucleic acid extraction reagent is 7-9;

[0008] (2) The surfactant includes at least one of Triton-X10, NP-40, Triton X-100, SDS and CTAB.

[0009] In one embodiment, the kit further includes a long - fragment nucleic acid amplification reagent, and the long - fragment nucleic acid amplification reagent includes a long - fragment nucleic acid amplification primer set.

[0010] In one embodiment, the long - fragment nucleic acid amplification primer set includes HBA2 primer pair, α3.7 primer pair, α4.2 primer pair, SEA primer pair, THAI primer pair and HBB primer pair;

[0011] The HBA2 primer pair includes the sequences shown in SEQ ID No.1 and SEQ ID No.2;

[0012] The α3.7 primer pair includes the sequences shown in SEQ ID No.3 and SEQ ID No.4;

[0013] The α4.2 primer pair includes the sequences shown in SEQ ID No.5 and SEQ ID No.6;

[0014] The SEA primer pair includes the sequences shown in SEQ ID No.7 and SEQ ID No.8;

[0015] The THAI primer pair includes the sequences shown in SEQ ID No.9 and SEQ ID No.10;

[0016] The HBB primer pair includes the sequences shown in SEQ ID No.11 and SEQ ID No.12.

[0017] The second object of the present application is to provide a nucleic acid detection method, which includes directly amplifying after mixing a biological sample to be detected and the nucleic acid extraction reagent in the above - mentioned nucleic acid amplification kit.

[0018] In one embodiment, when mixing the biological sample to be detected and the nucleic acid extraction reagent, the biological sample to be detected is heated to release the nucleic acid in the biological sample to be detected;

[0019] Optionally, the heating temperature is 90 - 95 °C, and the heating time is 10 - 20 min.

[0020] In one embodiment, after heating the biological sample to be detected, it further includes:

[0021] Using the long - fragment nucleic acid amplification reagent to amplify the heated biological sample to be detected.

[0022] In one embodiment, after heating the biological sample to be detected, it further includes:

[0023] Preserving the heated biological sample to be detected;

[0024] Optionally, the storage time does not exceed 7 days.

[0025] In one embodiment, the biological sample to be tested is at least one of saliva, blood, urine, and tissue fluid.

[0026] In one embodiment, the biological sample to be tested is an oral swab;

[0027] Optionally, the volume of the nucleic acid extraction reagent required for one oral swab is 0.1 mL to 1 mL.

[0028] In one embodiment, the long fragment nucleic acid amplification reagent is used to detect the HBA1 / 2 and HBB gene mutations in the biological sample to be tested;

[0029] Optionally, the HBA1 / 2 and HBB gene mutations include deletion mutations and non-deletion mutations;

[0030] Optionally, the deletion mutations include HBA1 / 2 gene deletion mutations, and the HBA1 / 2 gene deletion mutations include -- THAI , -- SEA , -α 3.7 and -α 4.2 and at least one of them;

[0031] Optionally, the non-deletion mutations include HBA2 gene point mutations, and the HBA2 gene point mutations include at least one of QS, CS, and WS;

[0032] Optionally, the non-deletion mutations include HBB gene mutations, and the HBB gene mutations include at least one of -32(C-A), -30(T-C), -29(A-G), -28(A-G), Cap+40-43(-AAAC), Int(T-G), CD14 / 15(+G), CD17(A-T), CD26(G-A), CD27 / 28(+C), CD31(-C), CD41 / 42(-TCTT), CD43(G-T), CD71 / 72(+A), IVS-I-1(G-T, G-A), IVS-I-5(G-C), and IVS-II-654(C-T). BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0034] Figure 1Gel electrophoresis detection results of the direct amplification products after processing nucleic acid samples with Solution 1 and Solution 2 provided in Example 1 of this application;

[0035] Figure 2 Gel electrophoresis detection results of the direct amplification products after processing nucleic acid samples with the nucleic acid extraction reagent provided in Example 2 of this application;

[0036] Figure 3 Gel electrophoresis detection results of different genomic samples provided in Example 3 of this application;

[0037] Figure 4 Bioinformatics analysis results of the sequencing data of the wild-type genomic sample provided in Example 3 of this application;

[0038] Figure 5 For the αα / -α 3.7 Bioinformatics analysis results of the sequencing data of the deletion-type genomic sample;

[0039] Figure 6 For the -α 4.2 Bioinformatics analysis results of the sequencing data of the deletion-type genomic sample;

[0040] Figure 7 For the αα / -- SEA Bioinformatics analysis results of the sequencing data of the deletion-type genomic sample;

[0041] Figure 8 For the -- THAI Bioinformatics analysis results of the sequencing data of the deletion-type genomic sample;

[0042] Figure 9 Gel electrophoresis repeatability detection results of different genomic samples provided in Example 4 of this application. Detailed Description of the Invention

[0043] Reference to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each example is provided by way of explanation and not limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present application without departing from the scope or spirit of the present application. For example, features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment.

[0044] Accordingly, it is intended that this application cover such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features, and aspects of this application are disclosed in or are obvious from the following detailed description. Those of ordinary skill in the art should understand that this discussion is only a description of exemplary embodiments and is not intended to limit the broader aspects of this application.

[0045] As used herein, the term "primer" refers to an oligonucleotide, whether naturally occurring in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions inducing the synthesis of a primer extension product complementary to a nucleic acid strand (e.g., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single-stranded for maximum efficiency of amplification, but may alternatively be double-stranded. If double-stranded, the primer is first treated to separate its strands before being used to prepare the extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to prime the synthesis of the extension product in the presence of the inducing agent. The exact length of the primer will depend on many factors, including temperature, primer source, and method of use. For example, in some embodiments, the primer ranges from 10 to 100 or more nucleotides (e.g., 10 to 300, 15 - 250, 15 - 200, 15 - 150, 15 - 100, 15 - 90, 20 - 80, 20 - 70, 20 - 60, 20 - 50 nucleotides, etc.).

[0046] To at least partially solve at least one of the above technical problems, a first aspect of this application provides a nucleic acid amplification kit, including a nucleic acid extraction reagent, and the nucleic acid extraction reagent includes the following components: Tris-HCl, NaCl, triethylenetetramine, dithiothreitol, and a surfactant; wherein, the working concentration of Tris-HCl is 0.05 - 0.2 mol / L; the working concentration of NaCl is 120 - 140 mM; the working concentration of triethylenetetramine is 80 - 110 mM; the working concentration of dithiothreitol is 3 - 6 mM; the volume fraction of the surfactant is 0.1% - 0.5%.

[0047] Specifically, the Tris-HCL buffer system is used to adjust the pH of the solution, provide a stable pH environment, and maintain a certain ionic concentration.

[0048] NaCl can reduce the solubility of DNA in water and does not damage the structure of DNA.

[0049] Surfactants are mainly used to extract soluble proteins from animal cells or tissues. During cell lysis, non-ionic surfactants can, on the one hand, accelerate the dissolution of extracellular membrane proteins and lipids, speeding up nucleic acid release, and on the other hand, can well protect nucleic acids, enabling them to be preserved in an alkaline environment.

[0050] Triethylenetetramine is used as a metal chelating agent, which can chelate metal ions and inhibit the activity of nucleases released after cell lysis to reduce DNA degradation.

[0051] Triethylenetetramine acts synergistically with surfactants to rapidly lyse cells to release DNA and can quickly bind to protein impurities in cells, such as hemoglobin, cell debris, proteins, etc., so that they do not inhibit the activity of DNA polymerase.

[0052] Dithiothreitol is a reducing agent whose main function is to break the disulfide bonds in RNase proteins, release the proteins bound to chromosomal DNA from the DNA, and destroy the stable activity of the proteins.

[0053] This application uses a combination of high concentrations of sodium chloride, triethylenetetramine, dithiothreitol, and surfactants, enabling the cells in the nucleic acid sample to be rapidly lysed and release high concentrations of nucleic acids. The released nucleic acids can maintain a certain stability and meet the requirements for the nucleic acid concentration in subsequent direct amplification of long fragment amplicons.

[0054] The nucleic acid extraction reagent provided by this application only needs to be simply mixed and incubated with the biological sample to be tested, and the released nucleic acids can be directly subjected to conventional PCR amplification without any additional steps such as purification and centrifugation, effectively saving the time for the entire nucleic acid detection.

[0055] In some embodiments, to maintain the stability of the released nucleic acids, the pH of the nucleic acid extraction reagent is 7-9. Further, it can be 7-8.

[0056] In some specific embodiments, to achieve the lysis effect on cell membranes, the surfactant includes at least one of Triton-X10, NP-40, Triton X-100, SDS, and CTAB.

[0057] In some embodiments, the kit further includes a long fragment nucleic acid amplification reagent, and the long fragment nucleic acid amplification reagent includes a long fragment nucleic acid amplification primer set for directly amplifying the high concentration of nucleic acids released in the nucleic acid sample, and the amplified long fragments can be stably preserved.

[0058] In some specific embodiments, the long fragment nucleic acid amplification primer set includes HBA2 primer pair, α3.7 primer pair, α4.2 primer pair, SEA primer pair, THAI primer pair, and HBB primer pair;

[0059] The HBA2 primer pair includes the sequences shown in SEQ ID No.1 and SEQ ID No.2;

[0060] The α3.7 primer pair includes the sequences shown in SEQ ID No.3 and SEQ ID No.4;

[0061] The α4.2 primer pair includes the sequences shown in SEQ ID No.5 and SEQ ID No.6;

[0062] The SEA primer pair includes the sequences shown in SEQ ID No.7 and SEQ ID No.8;

[0063] The THAI primer pair includes the sequences shown in SEQ ID No.9 and SEQ ID No.10;

[0064] The HBB primer pair includes the sequences shown in SEQ ID No.11 and SEQ ID No.12.

[0065] Among them, the sequences of each primer pair specifically include:

[0066] HBA2-F: GTATTTACCTAGCAAGTCTTCCATCAGATAGC (SEQ ID No.1);

[0067] HBA2-R: GGATAGAGAGAACCCAGGCACACA (SEQ ID No.2);

[0068] 3.7-F: CCCTACCCAGAGCCAAGTTTGTTTATCT (SEQ ID No.3);

[0069] 3.7-R: TGAAAAGTCTGGGAATAAAACTCGGGAAAGA (SEQ ID No.4);

[0070] 4.2-F: CTTTGGGCTGGGAGGAATCTAGGG (SEQ ID No.5);

[0071] 4.2-R: AGTATAGATGGGGTTTCTACATGTTGATCAGG (SEQ ID No.6);

[0072] SEA-F: CCAGCTCCTGTCCCACTGCC (SEQ ID No.7);

[0073] SEA-R: CTGCAGTACCAGTAAATCTCGCCAAAGA (SEQ ID No.8);

[0074] THAI-F: CTTCCCAGGACAGTGAGCAAGACAG (SEQ ID No.9);

[0075] THAI-R: CTCGTGACCTTATGATTTGCCCGC (SEQ ID No.10);

[0076] HBB-F: CCTAACTTTTCATACTAAGCCCAGTCCTTCC (SEQ ID No.11);

[0077] HBB-R: GTAAGTATTTTGCATATTCTGGAGACGCAGG (SEQ ID No.12).

[0078] The second aspect of the present application provides a nucleic acid detection method, including mixing a biological sample to be tested and the above-mentioned nucleic acid extraction reagent to release the nucleic acid in the biological sample to be tested.

[0079] In some embodiments, when mixing the biological sample to be tested and the nucleic acid extraction reagent, the biological sample to be tested is heated to release the nucleic acid in the biological sample to be tested.

[0080] Specifically, the nucleic acid extraction reagent of the present application and the biological sample to be tested are mixed and incubated after heating, which can quickly release high-concentration nucleic acid and be used for subsequent direct nucleic acid amplification steps. At the same time, the released nucleic acid can be kept stable and the storage time of the released nucleic acid can be extended.

[0081] In some specific embodiments, the heating temperature is 90-95 °C and the heating time is 10-20 min.

[0082] In some embodiments, after heating the biological sample to be tested, it further includes:

[0083] Using a long-fragment nucleic acid amplification reagent to amplify the heated biological sample to be tested for direct amplification of the released high-concentration nucleic acid.

[0084] In some specific embodiments, the long-fragment nucleic acid amplification reagent contains the above-mentioned long-fragment nucleic acid amplification primer set for detecting HBA1 / 2 and HBB gene mutations in the biological sample to be tested;

[0085] Specifically, HBA1 / 2 and HBB gene mutations include deletion mutations and non-deletion mutations;

[0086] Among them, the deletion mutations include HBA1 / 2 gene deletion mutations, and the HBA1 / 2 gene deletion mutations include -- THAI 、-- SEA 、-α 3.7 and -α 4.2 at least one of;

[0087] The non-deletion mutations include HBA2 gene point mutations, and the HBA2 gene point mutations include at least one of QS, CS, and WS;

[0088] The non-deletion mutations also include HBB gene mutations, and the HBB gene mutations include at least one of -32(C-A), -30(T-C), -29(A-G), -28(A-G), Cap+40-43(-AAAC), Int(T-G), CD14 / 15(+G), CD17(A-T), CD26(G-A), CD27 / 28(+C), CD31(-C), CD41 / 42(-TCTT), CD43(G-T), CD71 / 72(+A), IVS-I-1(G-T, G-A), IVS-I-5(G-C), and IVS-II-654(C-T).

[0089] In some embodiments, after the biological sample to be tested is heat-treated, it further includes: storing the heat-treated biological sample to be tested. The nucleic acid extraction reagent of the present application can store the long fragment DNA released from the biological sample to be tested at room temperature for a short time without being degraded.

[0090] In some specific embodiments, the storage time of the long fragment DNA released from the biological sample to be tested does not exceed 7 days.

[0091] In some embodiments, the biological sample to be tested is from at least one of saliva, blood, urine, and tissue fluid.

[0092] In some specific embodiments, the biological sample to be tested is an oral swab.

[0093] In some specific embodiments, the oral swab is a flocked swab. Specifically, 0.1-1 mL (such as 0.2, 0.5, or 1 mL) of the nucleic acid extraction reagent is added to one swab sample to lyse cells, release, and store DNA. Further, 0.5 mL of the nucleic acid extraction reagent (0.5 mL can soak the swab) is added to one swab sample.

[0094] In summary, the nucleic acid extraction reagent of the present application can quickly lyse the cells in the swab, release DNA, bind most PCR inhibitors, and can store DNA at room temperature for a short time without being degraded. The acid treatment reagent combines the three functions of "lysis", "release", and "storage".

[0095] All operations of the nucleic acid extraction method of the present application are completed in a single reaction tube, without involving the transfer of genomic DNA between different reaction tubes, thus saving time and cost while avoiding the loss and possible contamination of genomic DNA.

[0096] The whole process of the nucleic acid extraction method of the present application is simple and fast. The extraction process of the whole genomic DNA only includes a lysis step and takes 10 minutes.

[0097] The nucleic acid extraction method of the present application is relatively safe and will not cause harm to the physical health of operators.

[0098] The reagents used in the nucleic acid extraction method of the present application are all safe and non-toxic, and at the same time avoid using highly toxic organic solvents such as phenol-chloroform used in traditional genomic DNA precipitation methods.

[0099] The genomic DNA extracted by the nucleic acid extraction reagent of the present application has reliable length and quality, strong repeatability, and can be used for direct amplification of samples. Compared with traditional silica gel membrane column and magnetic bead purification methods, the present application avoids mechanical damage to genomic DNA. Compared with the method of extracting long-fragment genomic DNA based on low-melting-point agarose gel embedding, the present application has significantly improved in experimental operability and repeatability.

[0100] The nucleic acid amplification kit of the present application is applicable to technical platforms such as third-generation sequencing of multiple long-fragment amplicons.

[0101] The implementation scheme of the present application will be described in detail below in combination with examples.

[0102] The upstream and downstream primers used in the examples of the present application were synthesized by Shanghai Bio-Giga Biotechnology Co., Ltd. The amplification reagents used in the examples of the present application were purchased from Toyobo (Shanghai) Biotechnology Co., Ltd., with the product number KMM-101. Nuclease-Free Water was purchased from Merck, with the product number W4502-1L. Oral swab samples in the examples of the present application were collected from healthy people and patients with thalassemia.

[0103] Example 1 Preparation of Nucleic Acid Extraction Reagent

[0104] On the basis of the basic protocol, the formulation was adjusted to obtain Protocol 1 and Protocol 2, as shown in Table 1 specifically. Two nucleic acid extraction reagents, Protocol 1 and Protocol 2, were prepared according to the formulation in Table 1.

[0105] Table 1

[0106]

[0107] After shaking the nucleic acid extraction reagent containing the oral swab of a healthy person on a vortex shaker for 2 minutes, heat it at 95 degrees for 10 minutes, centrifuge it, and transfer the supernatant to a new EP tube, making good marks for measuring the DNA concentration.

[0108] Specifically, use the Qubit 4.0 instrument from Thermo company to detect the fluorescence shown after the reaction of double-stranded DNA with a specific fluorescent dye to measure the DNA concentration. The detection results are shown in Table 2.

[0109] Table 2

[0110] Nucleic acid extraction reagent Concentration (ng / ul) Protocol 1 14.67 Protocol 2 15.43

[0111] Perform direct amplification using the oral swab lysate sample stored in the above-mentioned new EP tube. The amplification primers are shown in Table 3 below.

[0112] Table 3

[0113]

[0114]

[0115] Prepare the amplification reagent according to the formula in Table 4.

[0116] Table 4

[0117]

[0118] Prepare the reaction system with the above-mentioned oral swab lysate and amplification reagent according to the formula in Table 5 below, and amplify the wild-type genomic DNA from healthy people in the above-mentioned oral swab lysate.

[0119] Table 5

[0120] Component Volume Amplification reagent 37 μl Oral swab lysate (10 ng / μl) 1 μl Water 12 μl Total volume 50 μl

[0121] On the PCR instrument, perform pre-amplification according to the conditions shown in Table 6 below.

[0122] Table 6

[0123]

[0124] After the amplification is completed, take 5 μl of each reaction system sample and detect it on a 1% DNA gel. The detection results are as Figure 1 shown, Figure 1 in which "1" represents the detection result of the direct amplification product of the nucleic acid extracted by Scheme 1, Figure 1 in which "2" represents the detection result of the direct amplification product of the nucleic acid extracted by Scheme 2. According to Figure 1It can be seen that the nucleic acid extracted by Protocol 2 can achieve direct amplification detection of long-fragment DNA, while the nucleic acid extracted by Protocol 1 cannot. The reason is that Protocol 1 may contain EDTA, a substance that inhibits amplification.

[0125] Therefore, in this embodiment, Protocol 2 is selected as the optimized sample of the nucleic acid extraction reagent, and the concentrations of the components in Protocol 2 are adjusted. The swab DNA is preserved with the nucleic acid extraction reagent with adjusted concentrations, and the DNA concentration is measured using the above method. The specific detection results are shown in Table 7.

[0126] Table 7

[0127]

[0128] By comparing the formulations of different concentrations of each comparative protocol, the finally screened nucleic acid extraction reagent formulation that can achieve direct amplification of long-fragment DNA includes: 0.05 - 0.2 mol / L Tris-HCl, 120 - 140 mM NaCl, 80 - 110 mM triethylenetetramine, 3 - 6 mM dithiothreitol, 0.1% - 0.5% Triton X-10 surfactant, and the balance of water. The pH of the nucleic acid extraction reagent is 7 - 9.

[0129] Example 2 Stability Test of Preserving Swab DNA at Room Temperature

[0130] The nucleic acid extraction reagents of 2 formulations in Table 8 are used to process 4 nucleic acid samples respectively. The processing method includes the following steps: a) Insert the swab head into the oral cavity, press it tightly against the inner cheek on one side of the oral cavity, and scrape back and forth more than 20 times (for example, 20 to 30 times), and the scraping time is more than 1 minute; b) After sampling, put the swab sample into a storage tube containing the nucleic acid extraction reagent to form a uniform mixture (i.e., the swab crude sample), avoiding contact with other parts; c) Store and transport the formed uniform mixture at ambient temperature. The swab is a flocked swab, and 0.5 mL of the nucleic acid extraction reagent (0.5 mL can soak the swab) is added to one swab sample.

[0131] Table 8

[0132] Component Formulation 1 (4 cases) Formulation 2 (4 cases) Tris-HCl 0.05 mol / L 0.2 mol / L NaCl 120 mM 140 mM Triethylenetetramine 80 mM 110 mM Dithiothreitol 3 mM 6 mM Triton X-10 0.1％ 0.5％ PH 7 9

[0133] Vortex-shake the 8 preservative solutions with swabs on a vortex shaker for 2 minutes. Take 50 μl of the preservative solution containing the sample and heat it at 95 °C for 10 minutes at 0 / 3 / 7 days of storage. Centrifuge and take the supernatant into a new EP tube and make good marks.

[0134] The concentration of DNA was quantified using Qubit 4.0. After the double-stranded DNA reacted with a specific fluorescent dye, fluorescence was detected using a Qubit 4.0 instrument from Thermo. The test results are shown in Tables 9 and 10.

[0135] Table 9

[0136]

[0137] Table 10

[0138]

[0139] The following amplification experiment electrophoresis was used to verify whether two wild-type bands could be amplified from DNA stored at room temperature for 7 days. The amplification primers are shown in Table 3. The amplification reagents were prepared according to the formula in Table 4. The reaction system was prepared according to Table 5, and 8 oral swab samples from healthy individuals were amplified. On a PCR instrument, pre-amplification was carried out according to the conditions shown in Table 6. After amplification, 5 μl was taken from each sample and detected on a 1% DNA gel. The results of the agarose gel electrophoresis are as Figure 2 shown, Figure 2 in which the bands numbered 1 to 8 are two long fragment bands amplified from the samples of 8 healthy individuals respectively. According to Figure 2 it can be seen that the samples of the nucleic acid extraction reagent of this application stored for 7 days can amplify long fragment amplicons larger than 1500 kp.

[0140] Example 3 Detection of thalassemia gene mutations

[0141] The subjects rinsed their mouths three times with cold water, then waited for 5 min (specifically, it could be 5 to 10 min), and then carried out the following steps: a) Insert the flocked swab head into the mouth and scrape back and forth tightly against the inner cheek on one side of the mouth more than 20 times, with a total collection time of about 2 minutes (it is advisable to be more than 1 minute); b) After sampling, put the flocked swab into a storage tube containing 0.5 mL of nucleic acid extraction reagent, avoiding contact with other parts; c) The formed uniform mixture, that is, the DNA crude sample, was stored at ambient temperature within 7 days. The oral swab lysate obtained by heating the DNA crude sample at 95 °C for 10 minutes was used for the following amplification experiment. Among them, the subjects were from diagnosed thalassemia patients and healthy individuals.

[0142] The amplification primer sequences are shown in Table 3. Prepare 10-person portions of the amplification reagents according to Table 4.

[0143] Prepare the reaction system according to Table 5, amplify the genomes containing different types of HBA1 / 2 and HBB gene mutations from 4 confirmed thalassemia patients and the wild-type genome from healthy people. Different types of HBA1 / 2 and HBB gene mutations are shown in Table 11. On a PCR instrument, perform pre-amplification according to the conditions shown in Table 6.

[0144] Table 11

[0145]

[0146] After the amplification is completed, take 5 μl of each reaction system sample and detect it on a 1% DNA gel. The detection results of the DNA gel diagram of the sample are as Figure 3 shown.

[0147] After the amplification is completed, purify the pre-amplified product with 80 μl of Agencourt Ampure XP magnetic beads (Beckman Coulter, Cat#A63880) according to the manufacturer's instructions. Dissolve the purified product in 10 μl of Elution buffer. Measure the DNA concentration with Qubit dsDNA HS reagent (ThermoFisher, Cat#Q32850) on a Qubit 3 Fluorometer (ThermoFisher, Cat#Q33216), and dilute the amplified product to 20 ng / μl with ddH2O.

[0148] Prepare the reaction system according to Table 12 below.

[0149] Table 12

[0150] Component Volume DNA (100 - 200 fmol) 24 μl NEBNext FFPE DNA Repair Buffer 1.75 μl ultra II End-prep reaction buffer 1.75 μl ultra II End-prep enzyme mix 1.5 μl NEBNext FFPE DNA Repair Mix 1 μl Total volume 30 μl

[0151] On a PCR instrument, perform the reaction under the following conditions: 20°C: 5 minutes; 65°C: 5 minutes

[0152] Take 22.5 μl for the next Barcode ligation.

[0153] Prepare the Barcode ligation reaction system according to Table 13 below.

[0154] Table 13

[0155] Component Volume end-prepped DNA 22.5 μl Native Barcode 2.5 μl Blunt / TA Ligase Master Mix 25 μl Total volume 50 μl

[0156] React at room temperature for 10 minutes. After the reaction is completed, mix multiple samples together, purify them with 1x Ampure PB magnetic beads (PacBio, Cat#100 - 265 - 900) according to the manufacturer's instructions, and elute with 65 μl of Nuclease-free water. The eluted product is used for the next adapter ligation reaction.

[0157] Prepare the adapter ligation reaction system according to Table 14 below.

[0158] Table 14

[0159]

[0160] Construct a DNA sequencing library according to the following steps:

[0161] 1) Add reagents sequentially with reference to the above system, flick about 10 times, mix well and centrifuge briefly, incubate at 18 - 25 °C for 10 min.

[0162] 2) Vortex the magnetic beads to mix well, then take 40 μl and add it to the adapter ligation system, flick to mix well and place it on a low-speed micro-vortex mixer, incubate at room temperature for 5 min.

[0163] 3) After brief centrifugation, place it on a magnetic stand for adsorption until the liquid becomes clear; keep the adsorption state and aspirate the supernatant.

[0164] 4) Remove the EP tube from the magnetic stand, slowly add 200 μl of SFB along the side where the magnetic beads are adsorbed, gently resuspend the magnetic beads by rotating the EP tube and then place it back on the magnetic stand (as long as the magnetic beads do not adhere to the wall and form aggregates), aspirate the supernatant after the liquid becomes clear.

[0165] 5) Repeat the previous step.

[0166] 6) Remove the EP tube, centrifuge briefly and then place it back on the magnetic stand, aspirate the remaining liquid, air-dry naturally for about 30 s (do not let the aggregated magnetic beads crack), add 14 μl of Elution Buffer (EB) to wash the magnetic beads.

[0167] 7) Remove the EP tube, flick to resuspend the magnetic beads and place at room temperature for 10 min.

[0168] 8) After brief centrifugation, place it back on the magnetic stand, wait for the liquid to become clear, aspirate 14 μl and transfer it to a new 1.5 mL EP tube.

[0169] 9) Take 1 μl of the DNA ligated with the adapter for Qubit quantification.

[0170] Sequencing on the machine:

[0171] Perform sequencing on the machine on the nanopore sequencer gridion using the nanopore sequencing kit SQK-LSK109 according to the following steps.

[0172] 1) Take 30 μl of Flush Tether (FLT) and add it to Flush Buffer (FB) and mix well.

[0173] 2) Rotate 90° clockwise to open the Priming port. Adjust a 1 mL pipette to 200 μl, vertically touch the Priming port hole and slowly rotate to aspirate 230 μl to remove air bubbles in the pipeline. At this time, there is a small amount of liquid at the tip of the pipette, indicating that the air bubbles in the pipeline have been discharged.

[0174] 3) Use a 1 mL pipette to aspirate 800 μl of FB, and slowly push it into the pipeline from the Priming port hole by clockwise rotating the pipette volume setting wheel / ring (or directly pressing). Note that a small amount of liquid is reserved at the tip of the pipette. Re-balance the chip at room temperature for another 5 minutes.

[0175] 4) Add reagents and DNA library successively according to the system in Table 15 below.

[0176] Table 15

[0177] Component Volume Sequencing buffer (SQB) 37.5 μl Loading Beads (LB), mix well immediately before use 25.5 μl DNA library 12 μl Total volume 75 μl

[0178] Among them, the DNA library refers to the DNA sample after the adaptor ligation is completed.

[0179] 5) After the chip leveling is completed, gently push outwards to open the SpotON and observe whether there is any residual white crystal around the SpotON sample port and SpotON sample cover (which is likely to remain during the second use). If there is any residue, a 10 μl pipette can be used to aspirate a small amount of FB to dissolve the white crystal and then aspirate the liquid to avoid air bubbles generated by liquid volatilization due to loose sealing.

[0180] 6) Use a 1 mL pipette to aspirate 200 μl of FB, and slowly push it into the pipeline from the Priming port hole by clockwise rotating the pipette range adjustment wheel / ring. Note that a small amount of liquid is reserved at the tip of the pipette, so that the FB gushes out from the SpotON sample port and then falls back, thus rinsing the area around the SpotON sample port.

[0181] 7) Gently aspirate and dispense the Loading sample up and down to mix it, and take 75 μl and add it drop by drop to the SpotON sample port. It can be seen that the Loading beads are evenly dispersed.

[0182] 8) First, close the SpotON sample cover, then rotate counterclockwise to close the Priming port, and finally aspirate the liquid in the pipeline from the Waste port 1. Place it on the sequencer to set up the experiment.

[0183] The bioinformatics analysis results of the sequencing data for different gene mutation types are as Figures 4 - 8 shown. According to Figures 4 - 8From the analysis results, it can be seen that the nucleic acid extracted and preserved by the nucleic acid extraction reagent of the present application can be directly amplified and library constructed, and the detection of long fragment amplicons can be achieved.

[0184] Example 4 Repeatability Experiment

[0185] Resample the subjects in Example 3, rinse the oral cavity three times with cold water, then wait for 5 min (specifically, it can be 5 to 10 min), and then perform the following steps: a) Insert the flocked swab head into the oral cavity, scrape back and forth tightly against the inner cheek on one side of the oral cavity for more than 20 times, and the total collection time is about 2 minutes (it is advisable to be more than 1 minute); b) After sampling, put the flocked swab into a storage tube containing 0.5 mL of nucleic acid extraction reagent, avoiding contact with other parts; c) The formed uniform mixture, that is, the crude DNA sample, is stored at ambient temperature within 7 days. The oral swab lysate obtained by heating the crude DNA sample at 95 °C for 10 minutes is used for the following amplification experiments.

[0186] The amplification primer sequences are shown in Table 3. Prepare 10-person portions of amplification reagents according to Table 4.

[0187] Prepare the reaction system according to Table 5, and amplify the genomes containing different types of HBA1 / 2 and HBB gene mutations from the confirmed thalassemia patients in Example 3. The mutation sites are shown in Table 11. On the PCR instrument, perform pre-amplification according to the conditions shown in Table 6.

[0188] After amplification, take 5 μL of each reaction system sample and detect it on a 1% DNA gel. The detection results of the DNA gel diagram of the sample are as Figure 9 shown.

[0189] According to Figure 9 the experimental results, it can be seen that Figure 9 the detection effect of the long fragment DNA in Figure 3 is consistent with the detection results of the long fragment DNA in

[0190] Therefore, the nucleic acid extraction reagent of the present application can repeatedly achieve the release, extraction, preservation of nucleic acids, and direct amplification detection of long fragment DNA.

[0191] The above embodiments merely represent several implementation manners of the present application. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all fall within the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims.

Claims

1. A nucleic acid amplification kit, characterized in that: The invention comprises a nucleic acid extraction reagent, which comprises the following components: Tris-HCl, NaCl, triethylenetetramine, dithiothreitol and a surfactant; wherein the working concentration of Tris-HCl is 0.05-0.2 mol / L; the working concentration of NaCl is 120-140 mM; the working concentration of triethylenetetramine is 80-110 mM; the working concentration of dithiothreitol is 3-6 mM; and the volume fraction of the surfactant is 0.1%-0.5%.

2. The kit according to claim 1, characterized in that The nucleic acid extraction reagent meets at least one of the following conditions (1) to (2): (1) The pH of the nucleic acid extraction reagent is 7 to 9; (2) The surfactant includes at least one of Triton-X10, NP-40, Triton X-100, SDS and CTAB.

3. The kit according to claim 1 or 2, characterized in that The kit also includes a long-fragment nucleic acid amplification reagent, which includes a long-fragment nucleic acid amplification primer set.

4. The kit according to claim 3, characterized in that The long-fragment nucleic acid amplification primer set includes an HBA2 primer pair, an α3.7 primer pair, an α4.2 primer pair, a SEA primer pair, a THAI primer pair and an HBB primer pair; The HBA2 primer pair includes the sequences shown in SEQ ID No.1 and SEQ ID No.2; The α3.7 primer pair includes the sequences shown in SEQ ID No. 3 and SEQ ID No. 4; The α4.2 primer pair includes the sequences shown in SEQ ID No.5 and SEQ ID No.6; The SEA primer pair includes the sequences shown in SEQ ID No.7 and SEQ ID No.8; The THAI primer pair includes the sequences shown in SEQ ID No.9 and SEQ ID No.10; The HBB primer pair includes the sequences shown as SEQ ID No.11 and SEQ ID No.

12.

5. A nucleic acid detection method, characterized in that: The method comprises mixing a biological sample to be tested with a nucleic acid extraction reagent in the kit according to any one of claims 1 to 4.

6. The method according to claim 5, characterized in that When the biological sample to be tested and the nucleic acid extraction reagent are mixed, the biological sample to be tested is heated to release the nucleic acid in the biological sample to be tested; Optionally, the heating temperature is 90-95° C., and the heating time is 10-20 min.

7. The method according to claim 6, characterized in that After the biological sample to be tested is heated, the following steps are also included: Directly amplify the heated biological sample using a long-fragment nucleic acid amplification reagent; or Preserving the heated biological sample to be tested; Optionally, the storage time does not exceed 7 days.

8. The method according to claim 6 or 7, characterized in that: The biological sample to be tested comes from at least one of saliva, blood, urine and tissue fluid.

9. The method according to claim 8, characterized in that The biological sample to be tested is an oral swab; Optionally, the volume of the nucleic acid extraction reagent required for an oral swab is 0.1 mL to 1 mL.

10. The method according to claim 7, characterized in that The long-fragment nucleic acid amplification reagent is used to detect HBA1 / 2 and HBB gene mutations in a biological sample to be tested; Optionally, the HBA1 / 2 and HBB gene mutations include deletion mutations and non-deletion mutations; Optionally, the deletion mutation includes an HBA1 / 2 gene deletion mutation, and the HBA1 / 2 gene deletion mutation includes-- THAI 、-- SEA , -α 3.7 and -α 4.2 At least one of; Optionally, the non-deletion mutation includes a point mutation in the HBA2 gene, and the point mutation in the HBA2 gene includes at least one of QS, CS and WS; Optionally, the non-deletion mutation includes HBB gene mutation, and the HBB gene mutation includes at least one of -32 (CA), -30 (TC), -29 (AG), -28 (AG), Cap+40-43 (-AAAC), Int (TG), CD14 / 15 (+G), CD17 (AT), CD26 (GA), CD27 / 28 (+C), CD31 (-C), CD41 / 42 (-TCTT), CD43 (GT), CD71 / 72 (+A), IVS-I-1 (GT, GA), IVS-I-5 (GC) and IVS-II-654 (CT).

Images