Engineered bacteriophage and kit for capturing SARS-CoV-2, and method for detecting SARS-CoV-2 virus through bacteriophage or kit

Abstract

The invention discloses a phage for specifically capturing SARS-CoV-2 virus, the phage is an engineered M13 phage, so that an FGKGGYEKTWKLGD sequence peptide or an EFTSKAR sequence peptide is displayed on a P8 protein of a shell of the phage, and the peptide has specific affinity to a spike S1 protein of the SARS-CoV-2 virus.

Description

Technical Field

[0001] The present invention relates to the technical fields of biomedicine and molecular biology, and in particular to the technical fields of biomedicine and molecular biology. Specifically, it relates to engineered phages for capturing the SARS-CoV-2 virus. Background Art

[0002] The novel coronavirus that emerged in 2019 is called SARS-CoV-2, which causes a respiratory disease called COVID-19 and has spread rapidly worldwide.

[0003] Compared with the severe acute respiratory syndrome coronavirus (SARS-CoV) and the Middle East respiratory syndrome coronavirus (MERS-CoV), the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is highly contagious, and even patients with mild symptoms are highly transmissible. The COVID-19 disease caused by this virus has spread rapidly worldwide, so there is an urgent need for effective and rapid diagnostic methods to detect SARS-CoV-2 virus infection. The outer surface of the SARS-CoV-2 virus is covered with spike proteins, which is one of the unique characteristics of the coronavirus family.

[0004] The spike protein of SARS-CoV-2 is the main mechanism by which the virus infects target cells. This protein consists of two main parts: the S1 subunit and the S2 subunit. The S1 subunit is a very flexible region and contains a region called RBD, through which the virus can recognize and bind to the ACE2 receptor, which is the channel for the virus to enter human cells.

[0005] Currently, some antibodies specific to SARS-CoV-2 have been documented and described in the following documents.

[0006] CN113861288A describes a broad-spectrum neutralizing antibody against the coronavirus SARS-CoV-2. Using phage antibody library technology, it successfully obtained broad-spectrum neutralizing single-domain antibodies B3A3 and I3A10 that specifically bind to the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein. The single-domain antibodies disclosed in the invention have high affinity for the antigen and have obvious inhibitory effects on the main epidemic strains of SARS-CoV-2. This document also elaborates on the use method of magnetic beads.

[0007] This document describes the use of phage display technology for therapeutic purposes to generate antibodies (nanobodies) with antiviral activity against SARS-CoV-2. In the present invention, phages are used for diagnostic and non-therapeutic purposes because, as detailed below, such phages display the peptide sequence FHKGGYEKTWKLGD that binds to the major phage coat protein (P8), which has specific affinity for the viral spike protein and can directly capture and enrich SARS-CoV-2 in biological samples for diagnostic purposes.

[0008] Document CN113444170A describes a phage display antibody library and screening antibodies capable of binding to the S protein of the novel coronavirus SARS-CoV-2; the invention is based on synthetic biology and phage display technology; mutations are introduced into the hypervariable regions of the antibody variable region; and the gene is transferred into Escherichia coli to construct a synthetic antibody library containing 108 antibodies; the phage display antibody library of the present invention can screen antibodies with specificity and detection functions, expanding a powerful resource for biological research and medical diagnosis.

[0009] The known document describes the application of selective recognition of the SARS-CoV-2 S1 protein based on a methodology for generating an antibody library. Although the known document proposes to diagnose SARS-CoV-2 by antibodies that recognize the virus, it is still very different from the present invention for the following reasons:

[0010] ● The system according to the present invention uses a peptide sequence displayed on the major phage coat protein (P8),

[0011] which protein has approximately 2700 copies (whereas the above-known patent uses the phage coat protein P3);

[0012] ● The entire phage structure is used for functionalizing magnetic beads, which are used to capture and enrich the SARS-CoV-2 virus, which is not involved in the known patent.

[0013] Document CN111333722A is also known, which document describes SARS-CoV-2 inhibitors and their applications, specifically, describes a method and its application for SARS-CoV-2 neutralizing antibodies. This document uses phage display technology to construct a large-capacity human phage immune antibody library, and uses the SARS-CoV-2 S protein as a bait to screen out single-chain human antibody fragments to obtain antibodies with potent effects on the SARS-CoV-2 virus. The antibodies of the present invention can be used to treat diseases caused by novel coronavirus infection and have important clinical application value.

[0014] In addition, CN111592595A describes neutralizing antibodies against the novel coronavirus SARS-CoV-2 and their applications. The antibodies can be used to prepare diagnostic reagents or kits, drugs or pharmaceutical compositions for detecting, preventing, and treating COVID-19. The present invention utilizes phage display technology to perform differential antibody screening against SARS-CoV-2-RBD and SARS-CoV-1-RBD, and obtains neutralizing antibodies against the novel coronavirus SARS-CoV-2.

[0015] The main difference between these documents and the present invention is that in the latter, phages are used for diagnostic and non-therapeutic purposes, as detailed below. Such phages display the peptide sequence FHKGGYEKTWKLGD on the major phage coat protein (P8), which has specific affinity for the viral spike protein, to capture and directly concentrate the novel coronavirus SARS-CoV-2 in biological samples for diagnostic purposes.

[0016] CN111647054A describes a reagent for detecting antibodies against the novel coronavirus SARS-CoV-2 and its applications. Specifically, it relates to a polypeptide whose sequence contains the novel coronavirus SARS-CoV-2 corresponding to SEQ ID NO.1. A primer composition for synthesizing the polypeptide, a preparation method of the polypeptide, and the polypeptide for preparing a reagent for detecting or diagnosing the novel coronavirus SARS-CoV-2, especially for preparing a colloidal gold reagent strip and related kits. The specific primers designed in the present invention can successfully synthesize S protein / N protein antigen peptides with excellent binding activity, and the colloidal gold chromatography test strip prepared therefrom can quickly and effectively detect anti-S protein / anti-N protein antibodies against the novel coronavirus SARS-CoV-2 and prevent false negative results. This document describes the application of phage display technology.

[0017] However, the content described in the cited document relates to a diagnostic system for detecting IgG / IgM antibodies against coronaviruses, rather than the direct diagnosis of Sars-Cov-2 as described in the present invention.

[0018] The object of the present invention is to provide a method for detecting the SARS-CoV-2 virus.

[0019] This and other objects, such as those claimed in the appended claims, can be achieved by an engineered phage designed to capture the SARS-CoV-2 virus. Summary of the Invention

[0020] According to the present invention, the phage for specifically capturing severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is an engineered M13 phage that displays on the major coat protein of the phage, namely, the P8 protein, a peptide of the sequence FHKGGYEKTWKLGD (hereinafter referred to as capture phage S-α) or EFTSKAR (hereinafter simply referred to as capture phage S1-6), both of which have specific affinity for the spike S1 protein of the SARS-CoV-2 virus.

[0021] The kit for capturing SARS-CoV-2 virus according to the present invention comprises a surface functionalized with S-α capture phage or FHKGGYEKTWKLGD peptide or S1-6 capture phage or using EFTSKAR peptide. The surface is preferably selected from magnetic beads, metallic materials (such as gold or platinum), semiconductors (such as silicon or silicon nitride), or polymers (such as nitrocellulose).

[0022] According to the present invention, the method for obtaining the above capture phage S-α with the FHKGGYEKTWKLGD peptide or the above capture phage S1-6 with the EFTSKAR peptide provides for engineering the M13 phage by phage display technology.

[0023] More specifically, the method comprises the following steps:

[0024] - Providing a phage display library of M13 phages,

[0025] - Biopanning the phage library with His-tagged S1 spike protein by the following steps:

[0026] Or providing magnetic microspheres functionalized with SARS-CoV-2 spike S1 protein,

[0027] Or selecting the previously biopanned phage library against the above functionalized magnetic microspheres,

[0028] Or eluting the selected phages and separating them from the magnetic microspheres,

[0029] Or isolating the phages displayed on the coat peptide P8 protein of the FHKGGYEKTWKLGD sequence or EFTSKAR sequence among the selected phages.

[0030] The method for detecting SARS-CoV-2 according to the present invention, carried out by the above kit comprising S-α capture phage, FHKGGYEKTWKLGD peptide, S1-6 capture phage or EFTSKAR peptide immobilized on the above type of surface, provides for the following steps:

[0031] - Providing a sample containing SARS-CoV-2,

[0032] - Capturing SARS-CoV-2 virus using S-α capturing phage immobilized on the surface, or FGKGGYEKTWKLGD peptide, or S1-6 capturing phage, or EFTSKAR peptide,

[0033] - Separating SARS-CoV-2 virus through an appropriate washing procedure,

[0034] - Detecting the capture of the virus by S-α capturing phage, FHKGGYEKTWKLGD peptide, S1-6 capturing phage or EFTSKAR peptide through an appropriate transduction method, such as optical transduction, electrical transduction, electrochemical transduction or electrochemiluminescence transduction.

[0035] In the case of using microspheres as the surface, the step of separating the virus by washing includes capturing magnetic microspheres using a magnetic device.

[0036] According to the present invention, SARS-CoV-2 virus can be isolated from various types of samples (such as biopsy samples and swab samples), and then used for the diagnosis of SARS-CoV-2 viral diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] These and other features and advantages of the present invention will become clear through the following exemplary description of the preferred embodiments, and are not limited by the drawings, in which elements labeled with the same or similar numbers represent elements having the same or similar functions and structures, and in which:

[0038] - Figure 1a and Figure 1b respectively represent the capturing phage S-α with the FHKGGYEKTWKLGD peptide sequence and the S1-6 capturing phage with the EFTSKAR peptide sequence;

[0039] - Figure 2a and Figure 2b respectively show the surface functionalized with the FHKGGYEKTWKLGD peptide sequence and the surface functionalized with the EFTSKAR peptide sequence;

[0040] - Figure 3 shows a schematic diagram of a possible implementation manner of the SARS-CoV-2 virus capture method in the case of a surface presented by magnetic microspheres functionalized with capturing phage. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0041] According to the present invention and with reference to Figure 1a and Figure 1b, a phage (phage clone) for specifically capturing SARS-CoV-2 virus is an M13 phage, which has been appropriately modified to display hundreds (up to 2,800) of peptide segments with the sequences of FGKGGYEKTWKLGD or EFTSKAR on its major protein (i.e., P8 protein) of the outer shell. In Figure 1a and Figure 1b , the above-mentioned phages are respectively indicated by reference numerals 10’ and 10”. The peptide with the sequence of FHKGGYEKTWKLGD or EFTSKAR has specific affinity for the spike S1 protein of SARS-CoV-2 virus.

[0042] According to the present invention, a kit for capturing SARS-CoV-2 virus includes a surface, which is functionalized with the capturing phage S-α or S1-6 (as shown in Figure 3 ), or functionalized with the FHKGGYEKTWKLGD peptide or the EFTSKAR peptide (as shown in Figure 2a and 2b ). In Figure 2a and 2b , the surface is indicated by reference numeral 20, the FHKGGYEKTWKLGD peptide is indicated by reference numeral 12, and the EFTSKAR peptide is indicated by reference numeral 13. In Figure 3 , the surface is indicated by reference numeral 20’. The surfaces 20 and 20’ are preferably selected from magnetic beads, metallic materials (such as gold or platinum), semiconductors (such as silicon or silicon nitride), or polymers (such as nitrocellulose). The diameter of the magnetic microspheres is preferably 0.5 micrometer to 2.7 micrometers.

[0043] Referring to Figure 3 , a method for capturing SARS-CoV-2 virus (indicated by reference numeral 30) by the aforementioned kit will be described below. The kit includes the capturing phage S-α or S1-6 (labeled as reference numeral 10) and magnetic microspheres (labeled as reference numeral 20’).

[0044] The method includes the following steps:

[0045] - Providing a sample containing SARS-CoV-2 virus,

[0046] - Using the S-α or S1-6 capturing phage immobilized on the magnetic microspheres to capture SARS-CoV-2 virus,

[0047] - Using a suitable magnetic device (such as a magnet) to separate the SARS-CoV-2 virus.

[0048] An example of the operation of capturing SARS-CoV-2 virus with microspheres is shown below. The microspheres are functionalized with phage capturing S-α or S1-6, and it is specified that the S-α capturing phage is immobilized on magnetic microspheres.

[0049] According to this example, 20 μL (1 mg) of "Chemicell SIMAG-AMINE" magnetic microspheres with a diameter of 1 μm are taken out from the master batch tube and added to 180 μL of sterile ultrapure water to reach a concentration of 9 x 10 9 microspheres / mL. 20 μL is taken from the above ultrapure water containing microspheres and added to another 180 μL of water to make the concentration reach 0.1 mg. Then, the microspheres are washed with 500 μL of water on a rotator at 8 rpm for 10 minutes at room temperature, and then collected with a magnet. At room temperature, they are treated with 1 mL of MES buffer (0.9 g dissolved in 50 mL of ultrapure water, pH 6.0) on a rotator at 8 rpm for 10 minutes for two washes. Then the microspheres are resuspended in 250 μL of MES EDC buffer (0.01 g of EDC in 250 μL of MES buffer). Then 10 μL of S-α phage is taken out from a solution with a concentration of 4×10 13 and 90 μL of water is added to the test tube to make the total volume 100 μL, corresponding to about 336 phages per microsphere. Then the above test tube is shaken manually for 1 minute and incubated on a rotator for 2 hours. Then, the microspheres are washed three times with 1 mL of phosphate buffer (PBS) on a rotator for 5 minutes each time and collected with a magnetic separator. Then, 1.5 mL of blocking buffer (PBS + 4% bovine serum albumin, 0.005 g of sodium azide) is added on a rotator within 1 hour and 30 minutes. Then, the microbeads are placed on a magnet to collect for 20 minutes, washed once with 500 μL of PBS, and resuspended in 200 μL of PBS.

[0050] The ability of the above S-α capturing phage-functionalized magnetic microspheres to detect SARS-CoV-2 virus is tested by ELISA method as shown below.

[0051] 20 μL of S-α phage-functionalized microspheres (336 phages per 1.8×10 7The microspheres) were correspondingly added to 100 μL of SARS-CoV-2 at different dilutions (1:5, 1:50, 1:100, 1:500) (e.g., "Amplirum Total SARS-CoV-2 Control Swab"). In a 2 mL test tube, 100 μL of PBS was used instead of the virus as a control (K-negative). After rolling incubation for 1 hour, the test tube was shaken at 100 rpm, washed once with 100 μL of wash buffer, and then the microspheres were collected on a magnet for 5 minutes. Subsequently, 100 μL of anti-spike protein antibody horseradish peroxidase diluted 1:200 ("Mouse Anti-SARS-CoV-2 Spike Protein Monoclonal Antibody") was added to the test tube, and then incubated on a rotator at 100 rpm for 1 hour. Then, five washing operations were performed with 100 μL of wash buffer. After the last wash, 100 μL of TMB was added, and the reaction was terminated with 100 μL of sulfuric acid (H 2 SO 4 ). The supernatant was then transferred to a 96-well plate, and the absorbance was read at a wavelength of 450 nm. The results obtained are shown in the following table:

[0052]

[0053] The data reported above indicate that the S-α phage with the FGKGGYEKTWKLGD functional sequence motif on the P8 protein can effectively capture SARS-CoV-2 virus diluted to 1:50 (the absorbance value is more than three times the absorbance value of the control sample). Specifically, the virus suspension "Amplirum Total SARS-CoV-2 Control Swab" used contains approximately 30,000 virus copies / mL. Tests conducted with 100 μL of the virus suspension showed that at a dilution of 1:5, there were approximately 600 virus particles, at a dilution of 1:50, there were approximately 60 virus particles, at a dilution of 1:100, there were approximately 30 virus particles, and at a dilution of 1:500, there were approximately 6 virus particles. Although currently evaluated under the limitations of ELISA technology, the proposed detection method can detect 30 to 60 SARS-CoV-2 virus particles, i.e., this value is similar to the value detected by reverse transcription polymerase chain reaction (RT-PCR) technology (500 copies / mL).

[0054] An exemplary embodiment of the above method for obtaining the capture phage is outlined below.

[0055] To find a specific peptide that can bind to the spike S1 protein of the SARS-CoV-2 virus, the phage display library "M13 P8 Phage Display 12 Amino Acids" was selected for magnetic microspheres (e.g., Dynabeads microspheres) functionalized with His tags using the spike S1 protein of the SARS-CoV-2 virus.

[0056] In the first step of screening, the phage display library is screened against non-functionalized magnetic beads to remove all phages that may bind non-specifically to these materials (thus obtaining a so-called subtracted library).

[0057] Then, the library thus obtained is biopanned using His-tagged S1 spike protein (e.g., "SINOBIOLOGICAL INC. 40591-V08H") resuspended in 400 μL of sterile ultrapure water to a final concentration of 250 μg / mL.

[0058] Then, 200 μL of the above water containing 50 μg of spike S1 protein is taken and transferred to a micro sample vial, e.g., a 1.5 mL micro sample vial. 150 μL of sterile ultrapure water and 350 μL of 2X binding / washing buffer are then added to the micro vial until the final volume of the phage display library reaches 700 μL. The 2X binding / washing buffer used is prepared with, for example, 11.98 g / L -1 NaH 2 PO 4 100 mM (e.g., "Fluka cat. no. 71496 - 1 kg, lot no. BCBC5685V"), 35.06 g / L - 1 NaCl (600 mM) (e.g., "Fluka cat. no. S9888 - 1 kg, lot no. 12740") and 0.02% Tween 20 (e.g., "SIGMA cat. no. P1379 - 250 mL, lot no. S8BE240V").

[0059] To functionalize the microspheres, 50 μL (2 mg) of His-tagged magnetic microspheres (e.g., using the kit "Dynabeads His-tag isolation and pulldown - cat. no. 10103D, 10104D (Invitrogen")) are taken and transferred to a sterile micro vial, e.g., a 2 mL micro vial, and then placed on a magnet for 2 minutes. Then, the spike S1 His-tag protein previously diluted in 1X binding / washing buffer (700 μL) is added to the microspheres and mixed. Then the micro vial is incubated on a rotary shaker at room temperature for 10 minutes. After the incubation time ends, the micro vial is placed on a magnet for 2 minutes, and the supernatant is aspirated and discarded. Finally, four washes with 300 μL of 1X binding / washing buffer are performed for 2 minutes each, finally obtaining the microsphere / spike protein S1 complex.

[0060] To screen for phages against the SARS-CoV-2 spike S1 protein, 700 μL of the pre-adsorbed phage display library obtained previously was mixed with the above microsphere / spike protein S1 complex and incubated in a rotator at room temperature for 30 minutes to obtain a microsphere / spike protein S1 / phage complex. Then, the microtube containing the above microsphere / spike S1 protein / phage complex was placed on a magnet for 2 minutes. The supernatant containing the remaining phage library that did not bind to the spike S1 protein was removed from the microtube, transferred to a new tube, and stored at -80 °C. For the S1 / phage complex remaining in the microsphere / spike microtube, it was washed four times with 300 μL of 1X binding / washing buffer. Each time during washing, the microtube was placed on a rotator for 5 minutes, then on a magnet for 2 minutes, and then the supernatant was discarded.

[0061] After the last wash of the microsphere / spike protein S1 / phage complex, the phage was eluted with 200 μL of glycine-BSA buffer at pH 2.2 (for example, glycine hydrochloride "SIGMA catalog number G8898-1kg, batch 055k0188", concentration 22.3 g / L; BSA "Applichem catalog number A6588-0100, batch 5Y009437", concentration 0.1 g / L) and incubated at room temperature for 20 minutes.

[0062] To release any phages that were still more firmly attached to the microspheres, it was preferred to sonicate the solution in an ice bath at 20 kHz for 10 minutes. Then the microspheres were collected by magnetic adsorption for 5 minutes, and the supernatant containing the phage was recovered. Finally, the eluate was neutralized with 150 μL of Tris-HCl buffer (1 M) at pH 9.1.

[0063] The eluted phage library obtained by the above exemplary method had the following titration values:

[0064] Total library titer = 1 x 10 13 TU / mL

[0065] Number of phages in 5 μL = 5 x 10 10 TU / mL (input)

[0066] Number of phages in 1 μL = 1 x 10 10 TU / mL

[0067] Number of phages bound to the target after screening (spike S1 protein) = 5 x 10 4 TU / mL

[0068] - Yield = Number of phages linked to the target / Input = 5 x 10 4 / 5 x 10 10 = 1 x 10-6

[0069] Subsequently, the obtained eluted phage library was amplified to increase the number of phages from the screening.

[0070] In the amplification step, Escherichia coli TG1 cells were placed in lysogeny broth (LB) and cultured with stirring at 37 °C until the optical density (OD600) reached 0.8. Subsequently, 800 μL of Escherichia coli TG1 was infected with 200 μL of the phage suspension eluted from the screening and incubated at 37 °C for 15 minutes under static conditions, followed by incubation for 20 minutes with gentle shaking. 1 mL of this suspension of infected cells was inoculated into a 150 mm Petri dish containing LA + ampicillin + glucose medium and incubated at 37 °C for 16 hours to obtain Escherichia coli TG1 cells infected with phages. Then a layer of the above cells was obtained, and 7 mL of LB medium, 5 μL of ampicillin (from a 2000-fold stock solution), and 2.5 mL of 80% glycerol were poured onto it. Then these cells were recovered using a spatula (scraped), transferred to a 20 mL test tube, aliquoted, and stored at -20 °C.

[0071] In the second amplification step, 10 μL of the cell suspension was used to inoculate the scrape into 2 mL of LA + ampicillin medium and cultured with shaking at 37 °C until the optical density OD600 reached 0.4. 500 μL aliquots of this suspension were dispensed into a test tube, and 1 μL of helper phage M13K07 (10^11 phages / mL) was added to obtain a final concentration of 10 9 phages / mL. The sample was incubated at 37 °C under static conditions for 15 minutes and then incubated for 20 minutes under stirring conditions at 250 rpm. The infected cells were diluted with 1X PBS solution. Subsequently, 100 μL of the 10 -3 and 10 -4 dilutions were plated on LA + ampicillin + IPTG + XGAL medium and incubated at 37 °C for 24 hours until blue colonies were obtained.

[0072] Then approximately fifty phages were isolated. Except for one phage named S-α, the selected phages were labeled with S and a serial number. Each colony was amplified and then tested in ELISA to find the phage with the strongest reactivity against the spike protein S1 of SARS-CoV-2.

[0073] In carbonate-bicarbonate buffer, the SARS-CoV-2 spike S1 protein was adsorbed overnight on a microtiter plate. For CO 3 2- / HCO 3 -For the preparation of the buffer, 0.14 g of NaHCO 3 and 0.079 g of Na 2 CO 3 are added to 50 mL of ultrapure H 2 O. Then the solution is filtered through a 0.22 μm filter, and 2 μL of the spike S1 protein is resuspended in 10 μL of CO 3 2- / HCO 3 - buffer to obtain a final concentration of 5 μg / mL of the spike S1 protein.

[0074] Then it is washed with the wash buffer by manually shaking the culture plate for 3 minutes. Then 300 μL / well of the blocking buffer (PBS + 6% skim milk powder + 0.05% Tween 20) is added, and the culture plate is incubated at 37 °C for 2 hours. Then it is washed once with 300 μL / well of the wash buffer, 100 μL / well of the phage precipitate at a concentration of 10 12 phages / mL (dissolved in Tris-buffered saline (TBS)) is added, and then the plate is incubated at 37 °C for 1 hour. Subsequently, it is washed 5 times with the wash buffer, 1 minute each time, 100 μL of the anti-M13-pVIII-HRP antibody diluted 1:5000 (batch aliquot: lot number 9547458, item number 27-9421-01) is added to each well, and then the plate is incubated at 37 °C for 1 hour. Then, it is washed 10 times with 300 μL / well of the wash buffer, 1 minute each time, and 100 μL of TMB is added to each well. The plate is then incubated in the dark for 30 minutes, and the onset of phage staining is observed; 100 μL / well of H 2 SO 4 is used to terminate the reaction. Finally, the absorbance (spike protein absorbance) is measured at a wavelength of 450 nm using a microplate reader (e.g., "Multiskan" microplate reader). Unfunctionalized microspheres are used as a control (K-).

[0075] The results obtained are shown in the following table:

[0076]

[0077]

[0078] The absorbance values shown in bold in the above table highlight the positive reactions in the ELISA, indicating that phages S30, S34, S35, S3, S1-6, S27, S36, S42, S43, and S-α are recognizing the spike S1 protein.

[0079] In addition, to evaluate the ability of phages to recognize not only the purified spike protein S1 but also the whole SARS-CoV-2 virion, an ELISA procedure was performed as described above using SARS-CoV-2 virus adsorbed on microtiter plates (e.g., "amplirum total SARS-CoV-2 control swab") as the target. Unfunctionalized microspheres were used as a control (K-).

[0080] The results obtained are shown in the following table:

[0081] Phage Virus absorbance Control (K-) S1-6 3.83 0.152 S11 0.770 0.155 S31 0.218 0.139 S33 0.184 0.069 S34 0.705 0.166 S35 0.094 0.063 S36 0.084 0.058 S42 0.065 0.058 S43 0.105 0.057 S-α 3.59 0.2

[0082] The absorbance values highlighted in bold in the above table highlight the positive reactions in the enzyme-linked immunosorbent assay (ELISA), indicating that S1-6, S11, S34, and S-α phages are able to recognize the SARS-CoV-2 virus.

[0083] The DNA of S1-6, S11, S34, and S-α phages was amplified using PCR technology and then sequenced to determine the coding sequence of the p8 protein fusion peptide that can bind to the spike S1 protein.

[0084] The mixture for PCR amplification was: 21.25 μL of sterile PCR-grade water, 10 μL of buffer, 5 μL each of the E24 primer (5')GCTACCCTCGTTCCGATGCTGTC 3’)-40RE(5’GTTTTCCCAGTCACGAC 3’). The mixture was denatured at 95 °C for 10 minutes in a thermal cycler, and then 0.25 μL of my TAQ was added. The following PCR cycles were performed for each sample: 94 °C, 4 minutes, 30 cycles, each cycle consisting of: 94 °C for 30 seconds, 52 °C for 30 seconds, 72 °C for 30 seconds, and 72 °C for 7 minutes. At the end of the process, 35 μL was taken for DNA purification and sequencing.

[0085] The sequencing results are as follows:

[0086] S1-6, S11, and S34 phages showed a nucleotide sequence corresponding to EFTSKAR;

[0087] S-α phage displayed a functional coding sequence motif for the FHKGGYEKTWKLGD peptide.

Claims

1. A phage for specifically capturing SARS-CoV-2 virus, wherein the phage is an engineered M13 phage that displays the peptide sequence FHKGGYEKTWKLGD or EFTSKAR on the P8 protein of its outer shell, and the peptide has specific affinity for the spike protein S1 of SARS-CoV-2 virus.

2. A kit for capturing SARS-CoV-2 virus, the kit comprising a surface functionalized with a capture phage engineered to display the peptide sequence FHKGGYEKTWKLGD or EFTSKAR on the P8 protein of its outer shell, or functionalized with the FHKGGYEKTWKLGD peptide or the EFTSKAR peptide.

3. The kit according to claim 2, wherein, the surface is selected from magnetic microspheres, metal electrodes, semiconductors or polymers.

4. The kit according to claim 3, wherein, the magnetic microspheres have a diameter of 0.5 μm to 2.7 μm.

5. A method for detecting SARS-CoV-2 virus, comprising the steps of: - providing a sample containing SARS-CoV-2 virus, - capturing the SARS-CoV-2 virus by a capture phage engineered to display the peptide sequence FHKGGYEKTWKLGD or EFTSKAR on the P8 protein of its outer shell, or by the FHKGGYEKTWKLGD peptide or the EFTSKAR peptide, wherein the capture phage or peptide is immobilized on a surface respectively, - separating the SARS-CoV-2 virus by a washing procedure, and - detecting the capture of the SARS-CoV-2 virus by the capture phage or the peptide by transduction.

6. The method according to claim 5, wherein, the transduction is optical transduction, electrical transduction, or electrochemical or electrochemiluminescence transduction.

7. The method according to claim 5 or 6, wherein the capture phage is immobilized on magnetic microspheres, and the step of separating the SARS-CoV-2 virus by a washing procedure comprises capturing the magnetic microspheres by a magnetic device.

Images