Novel receptors with synthetic transmembrane domains for enhanced control of ligand dependent transcriptional activation

Abstract

The present disclosure relates generally to manipulation of chimeric polypeptide signaling to reduce cancer cell proliferation, and in particular to a new class of receptors engineered to (i) bind to a ligand displayed on the surface of a target cell, and (ii) have a synthetic transmembrane domain. The disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding such receptors, host cells genetically modified with the nucleic acids, and methods for modulating cell activity and / or for the treatment of various diseases, such as cancer.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 389,787, filed on August 15, 2022, the disclosure of which is incorporated herein by reference in its entirety (including any drawings). Statement Regarding Federal Funding of Research and Development

[0002] This invention was made with government support under Grant No. OD025751 awarded by the National Institutes of Health. The government has certain rights in this invention. Incorporation of Sequence Listing

[0003] This application contains a Sequence Listing, which is hereby incorporated by reference in its entirety. The attached Sequence Listing text, entitled "2023-08-14 Sequence_Listing_ST26 048536-730001 WO.xml", was created on August 14, 2023 and is 126,933 bytes. Technical Field

[0004] The present disclosure generally relates to a new class of receptors with synthetic transmembrane domains, which bind to ligands displayed on the surface of target cells, and to manipulation of receptor signaling to reduce cancer cell proliferation. The present disclosure also provides compositions and methods covering the receptors, nucleic acids encoding the receptors, host cells genetically modified by the nucleic acids, and methods for regulating the activity of cells and / or for treating various diseases. Background Art

[0005] An important issue limiting the development of human gene therapy is the regulation of therapeutic gene expression so that gene expression or the vector used to achieve expression does not enhance immunogenicity, thereby leading to host rejection. One way to achieve gene expression is activation of gene expression using chimeric polypeptides (such as, for example, Notch receptors, Notch-based receptors, or hinge-Notch receptors as disclosed in US 11,202,801, which is incorporated herein by reference in its entirety.

[0006] Notch and Notch-based receptors are type I transmembrane proteins that mediate cell-cell contact signaling and play a central role in other aspects of development and cell-to-cell communication (e.g., communication between two contacting cells, where one contacting cell is a "receiving" cell and the other contacting cell is a "sending" cell). Notch and Notch-based receptors expressed in receiving cells recognize their ligands, which are expressed on sending cells (e.g., delta / serrate / lag or "DSL" protein family). The engagement of Notch and DSL ligands on these contacting cells results in a two-step proteolysis of the notch receptor, which ultimately results in the release of the intracellular portion of the receptor from the membrane into the cytoplasm. This released domain changes the behavior of the receiving cell by functioning as a transcriptional regulator. Notch receptors participate in a variety of cellular functions during development and are required for the cellular functions, and are important for the functions of numerous cell types between species.

[0007] Notch has a metalloprotease cleavage site (denoted as "S2") that is normally protected from cleavage by the Notch negative regulatory region (NRR), which contains three LIN-12-Notch repeat (LNR) modules and the heterodimerization domain (HD) of the Notch extracellular subunit (NEC). Located at the C-terminus of the HD domain is the transmembrane domain (TMD). It contains the S3 cleavage site, which is a substrate for intramembrane proteolysis regulated by the γ-secretase complex (γSec). S3 proteolysis results in the release of the Notch intracellular domain. This event will only occur after the rate-limiting S2 cleavage occurs, making S3 accessible to γSec.

[0008] Examples of existing first-generation synthetic derivatives of Notch receptors (commonly referred to as "SynNotch receptors") exploit this simple and direct signaling behavior by replacing the extracellular ligand binding domain (which contains multiple EGF-like repeats in wild-type Notch) with antibody derivatives, and replacing the cytoplasmic domain with selected transcriptional activators, while still relying on the functionality of Notch NRR (L. Morsut et al., Cell (2016) 164: 780-91). Typically, SynNotch signaling is associated with ligand binding, but it is difficult to regulate the sensitivity and response of the receptor. In addition, the NRR spans approximately 160 amino acids, making this domain alone the size of some mature proteins (such as insulin or epidermal growth factor (EGF)). This makes the expression of the chimeric polypeptide less efficient, and due to size constraints related to vector capacity, the resulting chimeric polypeptide may exceed the capacity of some cloning and transfection vectors.

[0009] Next-generation SynNotch, which does not require NRR receptors, is able to bind user-defined ligands displayed on the cell surface and initiate proteolysis of the receptor to release transcriptional regulators, thereby inducing a customized transcriptional program in the cell. The receptor only requires a cleavable transmembrane domain, an extracellular juxtamembrane domain that is tunable to regulate receptor cleavage, and a positively charged juxtamembrane sequence.

[0010] Receptors, whether natural or synthetic, have different characteristics, such as "noise" (i.e., the baseline level of expression induced in the absence of the intended ligand) and signal or sensitivity (the amount of expression induced by binding of the intended ligand). Typically, signaling through Notch and "SynNotch" is linked to ligand binding, but it is difficult to tune the sensitivity and response of receptors, so more tools are needed to provide synthetic receptors with a wider range of more easily tunable characteristics.

[0011] Another major obstacle to the efficacy of many immunotherapy-based methods for solid tumors (including cell therapy) is the delivery of drugs or the activation of immune cells in solid tumors. Cells of the monocyte / macrophage lineage constitute the main composition of immune cells infiltrating into solid tumors. Since these cell types are actively recruited and retained in solid tumors, they can be important cell types for delivering gene therapy.

[0012] In view of these issues, there remains a need in the art for alternative receptors that can confer enhanced control over ligand-dependent transcriptional activation and that can complement existing standard of care immunotherapy for cancer and other immune diseases. Summary of the invention

[0013] The disclosure especially provides the method and composition of the chimeric polypeptide with synthetic transmembrane domain (STMD) that covers functional in primary human T cells.Surprisingly, changing the chimeric polypeptide still provides functional and adjustable receptor to cover STMD, and the receptor shows a certain range of signal characteristics mediated by STMD.As described below, these receptors provide a certain range of sensitivity based on the position of specific amino acid residues in STMD.

[0014] This article particularly provides chimeric polypeptides, which have (a) an extracellular ligand binding domain (ECD) with binding affinity for a selected ligand; (b) STMD, which includes one or more ligand-inducible proteolytic cleavage sites; and (c) an intracellular domain (ICD) with a transcriptional regulator (TR), wherein the binding of a selected ligand to the extracellular ligand binding domain induces the release of cleavage and transcriptional regulators at the ligand-inducible proteolytic cleavage site. In some embodiments, the chimeric polypeptide further includes a hinge domain between the extracellular ligand binding domain and the STMD. In some embodiments, the hinge domain is from CD8α or CD28. In some embodiments, the hinge domain is a truncated CD8α hinge domain or a similar hinge.

[0015] In some embodiments, the chimeric polypeptide comprises ECD, STMD and ICD in order from the N-terminus to the C-terminus of the first polypeptide. In some embodiments, the chimeric polypeptide comprises ECD, hinge domain, STMD and ICD in order from the N-terminus to the C-terminus of the first polypeptide.

[0016] In some embodiments, the STMD includes one or more valine residues. In some embodiments, the STMD includes a series of at least five valine residues (i.e., five adjacent valine residues). In some embodiments, the STMD includes 5 to 30 valine residues. In some embodiments, the STMD includes 10 to 25 valine residues. In some embodiments, the STMD further includes two continuous glycine residues. In some embodiments, the two continuous glycine residues are located at any one of the positions 5 to 30 of the polyvaline TMD, wherein position 30 is closer to the C-terminal of the chimeric polypeptide than position 5. In some embodiments, the STMD is composed of valine residues.

[0017] In some embodiments of the chimeric polypeptides of the present disclosure, the ligand comprises a protein or a carbohydrate. In some embodiments, the ligand is selected from the group consisting of a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor associated antigen, and a tumor specific antigen. In some embodiments, the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD 158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), and signal regulatory protein alpha (SIRPα).

[0018] In some embodiments of the chimeric polypeptides of the present disclosure, the extracellular binding domain (ECD) comprises a ligand binding portion of a receptor. In some embodiments, the ECD comprises an antigen binding portion capable of binding, e.g., a portion having binding affinity for a ligand on the surface of a cell.

[0019] In some embodiments of the chimeric polypeptides of the present disclosure, the antigen binding portion is selected from the group consisting of: antibodies, nanobodies, diabodies, triabodies or minibodies, F(ab')2 fragments, Fab fragments, single chain variable fragments (scFv) and single domain antibodies (sdAb) or functional fragments thereof. In some embodiments, the antigen binding portion comprises scFv. In some embodiments, the antigen binding portion is capable of binding, for example, a molecule having binding affinity for a tumor associated antigen selected from the group consisting of: CD19, B7H3 (CD276), BCMA, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD 117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, BCMA (CD269), ALPI, citrullinated vimentin, cMet and Axl. In some embodiments, the tumor-associated antigen is CD19, CEA, HER2, MUC1, CD20 or EGFR. In some embodiments, the tumor-associated antigen is CD19. In some embodiments, the cell is a pathogen.

[0020] In some embodiments, the ligand-inducible proteolytic cleavage site is two consecutive glycine residues.

[0021] In some embodiments of the chimeric polypeptide, the transcriptional regulator comprises a transcriptional activator, a transcriptional repressor, a site-specific nuclease, an inhibitory immune receptor, or an activating immune receptor. In some embodiments, the transcriptional regulator is selected from the group consisting of: Ga14-VP16, Ga14-VP64, tetR-VP64, ZFHD1-VP64, Ga14-KRAB, and HAP1-VP16.

[0022] In some embodiments, the chimeric polypeptides of the present disclosure include a ligand-inducible proteolytic cleavage site, a tumor-specific cleavage site, a disease-specific cleavage site, an autologous proteolytic peptide sequence, a nuclear localization signal, a juxtamembrane domain, a signaling domain, or any combination thereof.

[0023] In some embodiments of the chimeric polypeptides of the present disclosure, the signaling domain is from DAP12, CD3ζ, TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (ICOS), Fc.ε.RI, DAP10, DAP12, or CD66d.

[0024] In some embodiments, the juxtamembrane domain of the chimeric polypeptides of the present disclosure is the Notch 2 juxtamembrane domain or a similar polybasic domain.

[0025] In some embodiments of the chimeric polypeptides of the present disclosure, the ligand-inducible proteolytic cleavage site is cleavable by gamma secretase.

[0026] In some embodiments, the chimeric polypeptides of the present disclosure include an autologous proteolytic peptide sequence. In some embodiments, the autologous proteolytic peptide sequence is from porcine Teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis virus A (ERAV) 2A (E2A), Spodoptera litura virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), malarial disease virus 2A (BmIFV2A) or any combination thereof.

[0027] The chimeric polypeptide of any one of claims 1 to 31, wherein the STMD comprises an amino acid sequence encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:2 to SEQ ID NO:22, SEQ ID NO:27 or SEQ ID NO:30.

[0028] In some embodiments of the chimeric polypeptides of the present disclosure, the STMD comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, and SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55.

[0029] In some embodiments, the chimeric polypeptide is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:2 or SEQ ID NO:3.

[0030] On the other hand, the present disclosure provides a STMD for chimeric polypeptides. In some embodiments, the STMD comprises at least 5 valine residues. In some embodiments, the STMD comprises at least 10 valine residues. In some embodiments, the STMD comprises at least 20 valine residues. In some embodiments, the STMD comprises between 15 and 25 valine residues. In some embodiments, the STMD comprises a ligand-inducible proteolytic cleavage site, and wherein the binding of a selected ligand to an extracellular ligand-binding domain induces the release of cleavage and transcriptional regulatory factors at the ligand-inducible proteolytic cleavage site.

[0031] In yet another aspect, provided herein is a recombinant nucleic acid molecule comprising a nucleotide sequence encoding a chimeric polypeptide of the present disclosure.

[0032] In some embodiments, the recombinant nucleic acid molecule comprises a sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to any of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:27 or SEQ ID NO:30.

[0033] In another aspect, the present disclosure provides a vector comprising a recombinant nucleic acid molecule of the present disclosure. In some embodiments, the vector is an expression vector. In some embodiments, the expression vector is a viral vector. In some embodiments, the viral vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0034] On the other hand, the recombinant cell provided herein includes a chimeric polypeptide of the present disclosure or a recombinant nucleic acid of the present disclosure or a vector of the present disclosure or an STMD of the present disclosure. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is an immune cell, a neural cell, an epithelial cell, an endothelial cell or a stem cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, a CD4+T cell, a CD8+T cell or another T cell.

[0035] In some embodiments, the recombinant cell further comprises a nucleic acid sequence encoding a protein operably linked to a promoter, wherein expression of the protein is regulated by a transcriptional regulatory factor of the chimeric polypeptide. In some embodiments, the protein is heterologous. In some embodiments, the protein is a cytokine, a cytotoxin, a chemokine, an immunomodulator, a pro-apoptotic factor, an anti-apoptotic factor, a hormone, a differentiation factor, or a dedifferentiation factor.

[0036] In some aspects, the present disclosure provides pharmaceutical compositions comprising the recombinant cells of the present disclosure.

[0037] Yet on the other hand, the present invention provides a method for regulating the activity of a cell, the method comprising: providing a recombinant cell of the present disclosure, and contacting the recombinant cell with a selected ligand, wherein the binding of the selected ligand to the extracellular binding domain induces cleavage of the ligand-induced proteolytic cleavage site and releases a transcriptional regulatory factor, wherein the released transcriptional regulatory factor regulates the activity of the recombinant cell. In some embodiments, the contact is performed in vivo, ex vivo, or in vitro.

[0038] In some embodiments, the activity of the cell is selected from the group consisting of: expression of selected genes of the cell, proliferation of the cell, apoptosis of the cell, non-apoptotic death of the cell, differentiation of the cell, dedifferentiation of the cell, migration of the cell, secretion of the cell, adhesion of the cell and cytolytic activity of the cell. In some embodiments, the released transcriptional regulatory factors regulate the expression of the gene products of the cell. In some embodiments, the released transcriptional regulatory factors regulate the expression of heterologous gene products. In some embodiments, the gene products of the cell are selected from the group consisting of: chemokines, chemokine receptors, chimeric antigen receptors, cytokines, cytokine receptors, differentiation factors, growth factors, growth factor receptors, hormones, metabolic enzymes, pathogen-derived proteins, proliferation inducers, receptors, RNA-guided nucleases, site-specific nucleases, T cell receptors, toxins, toxin-derived proteins, transcriptional regulatory factors, transcriptional activators, transcriptional repressors, translational regulatory factors, translational activators, translational repressors, activating immune receptors, antibodies, apoptosis inhibitors, apoptosis inducing factors, engineered T cell receptors, immune activators, immune repressors and inhibitory immune receptors.

[0039] In some embodiments, the released transcriptional regulatory factor regulates the differentiation of cells, and wherein the cells are immune cells, stem cells, progenitor cells or precursor cells. In some embodiments, the administered recombinant cells regulate the activity of target cells in individuals. In some embodiments, the target cells are cancer cells. In some embodiments, the cancer cells are solid tumors or hematological malignant cells. In some embodiments, the hematological malignant cells are multiple myeloma cells.

[0040] In yet another aspect, the present disclosure provides a method for treating a health condition of an individual in need thereof, the method comprising: administering a first therapy to the individual, the first therapy comprising an effective number of recombinant cells of the present disclosure, wherein the recombinant cells treat the disease of the individual. In some embodiments, the method further comprises administering a second therapy to the individual. In some embodiments, the second therapy is selected from the group consisting of: chemotherapy, radiotherapy, immunotherapy, hormone therapy, and toxin therapy. In some embodiments, the first therapy and the second therapy are administered together, in the same composition or in a separated composition. In some embodiments, the first therapy and the second therapy are administered concomitantly. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy.

[0041] In another aspect, the present disclosure provides a method for inducing T cell signaling and gene regulation in T cells, comprising: (a) providing a vector having a chimeric polypeptide of the present disclosure; (b) transducing T cells with the vector, wherein binding of a selected ligand to the extracellular ligand binding domain of the chimeric polypeptide induces the release of intracellular signaling and transcriptional regulatory factors.

[0042] In yet another aspect, provided herein is a system for modulating the activity of cells, killing target cancer cells, or treating a disease in an individual in need thereof, wherein the system comprises one or more of the following: a chimeric polypeptide, a recombinant nucleic acid molecule, a recombinant cell, a pharmaceutical composition, and an STMD disclosed herein.

[0043] In yet another aspect, the present disclosure provides a method for producing the recombinant cell of the present disclosure, the method comprising providing a cell capable of protein expression, and contacting the provided cell with the recombinant nucleic acid of the present disclosure.

[0044] In another aspect, the present disclosure provides one or more of the following uses for treating a disease: a chimeric polypeptide, a recombinant nucleic acid molecule, a recombinant cell, and an STMD of the present disclosure. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor or a blood cancer. In some embodiments, the blood cancer is multiple myeloma.

[0045] In one aspect, also provided herein is the use of any invention disclosed herein for the preparation of a medicament for the treatment of a disease.

[0046] The foregoing summary is illustrative only and is not intended to be limiting in any way. In addition to the illustrative embodiments and features described herein, other aspects, embodiments, objects, and features of the present disclosure will become apparent from the drawings, detailed description, and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figures 1A-1C A schematic comparison between the first generation SynNotch with Notch-based regulatory region, the second generation Hinge Notch with hinge-based regulatory region, and the third generation chimeric polypeptide of the present disclosure with STMD is shown.

[0048] Figure 2A-2B Non-limiting examples of chimeric polypeptides according to some embodiments of the present disclosure are schematically illustrated. Figure 1A Depicted is a schematic structure of an exemplary chimeric polypeptide (referred to as the GG0 embodiment) having an anti-CD19 scFv extracellular domain (ECD) as disclosed herein having a transmembrane domain composed of a series of valine residues (polyvaline STMD), a Notch2 juxtamembrane domain (JMD), and an intracellular domain, wherein the intracellular domain includes a transcriptional regulator (TR) capable of regulating the transcription of a BFP reporter gene. Figure 2B The results of experiments using the BFP reporter gene for receptor activation in primary human CD3 T cells are schematically summarized. The results show that chimeric polypeptides with STMD and engineered to bind to the B lymphocyte antigen CD19 can activate the expression of the blue fluorescent protein BFP reporter gene when expressed in primary human CD3 T cells.

[0049] FIG. 3 shows structure-based engineering and activation profiles of two embodiments of chimeric polypeptides of the present disclosure having a polyvaline STMD ( Figure 3A ) and a modified polyvaline STMD engineered to include two destabilizing GG residues that may serve as a proteolytic cleavage site for γ-secretase or mediate cleavage by γ-secretase ( Figure 3B ). Reporter activation profiles for both embodiments showed increased activation of receptors engineered with GG residues in STMD.

[0050] Figure 4 Depicted is a schematic illustration of the engineering strategy to test the effect of positioning of destabilizing GG residues within polyvaline STMDs.

[0051] Figure 5 Schematic summary of the results of experiments performed to demonstrate the effect of placing GG residues along the STMD towards the N-terminus of chimeric polypeptides. These experiments demonstrate that receptor activation is possible and tunable in primary human CD3 T cells and K562 CD19 cells even when G residues are placed at the N-terminus and away from the C-terminus.

[0052] Figure 6Schematic summary of the results of activation experiments performed to demonstrate the effect of placing GG residues along the C-terminal tail of the polyvaline STMD. These experiments demonstrate that receptor activation is tunable and increases as the G residues move toward the C-terminus in primary human CD3 T cells and K562 CD19 cells. DETAILED DESCRIPTION

[0053] The present disclosure generally relates to a new class of chimeric polypeptides (such as receptors), which are engineered to regulate transcriptional regulation in a ligand-dependent manner, while having a fully synthetic transmembrane domain (STMD). The new receptor disclosed herein (STMD receptor) does not require Notch regulatory regions or any naturally occurring heterologous transmembrane, which was previously thought to be necessary for inducing type I transmembrane receptor cutting. In some embodiments, the receptor disclosed herein comprises an STMD with a series of identical residues, such as, for example, a series of valine (polyvaline STMD). In some embodiments, the receptor has a GG dipeptide, which can be used as a proteolytic cleavage site for γ-secretase or other proteases. The binding of the ligand displayed on the surface of the target cell may trigger the proteolytic cleavage of the receptor along the GG residues and the release of the transcriptional regulatory factor, which regulates the customized transcriptional program in the cell. The present disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding such receptors, host cells modified by the nucleic acid gene, and methods for regulating the activity of cells and / or for the treatment of various diseases (such as cancer).

[0054] The receptors of the present disclosure can be rationally designed to possess tunable features for enhanced control of proteolytic processes and potentially other intramembrane protein-protein interactions.

[0055] As described in the Examples, the new STMD receptors disclosed herein have been tested and validated in primary human T cells. It will be readily understood by those skilled in the art based on reading the present disclosure that the STMD receptors disclosed herein can be engineered into various immune cell types for enhanced recognition and clearance of tumors, or for control of autoimmunity and tissue regeneration in engineered cells. Therefore, engineered cells (e.g., immune cells engineered to express one or more STMD receptors disclosed herein) also fall within the scope of the present disclosure.

[0056] The STMD receptors disclosed herein may have better activity than existing synNotches and may become a more modular engineering platform. Existing synNotchs can be engineered to have ligand binding domains (such as scFv and nanobodies), but it is difficult to use native extracellular domains from receptors / ligands on synNotchs. In contrast, some STMD receptors disclosed herein may be adapted for other types of ligand binding domains, expanding the scope of targetable diseases and tissues.

[0057] In the following detailed description, reference is made to the accompanying drawings which form a part thereof. In the accompanying drawings, similar symbols generally identify similar components unless the context otherwise indicates. The illustrative alternatives described in the specific description, drawings, and claims are not intended to be limiting. Other alternatives may be used and other changes may be made without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects as generally described herein and shown in the accompanying drawings may be arranged, substituted, combined, and designed in a variety of different configurations, all of which are expressly contemplated and constitute a part of this application. definition

[0058] Unless otherwise defined, all technical terms, notes and other scientific terms or expressions used herein are intended to have the same meaning as those generally understood by those skilled in the art to which this application belongs. In some cases, for clarity and / or convenient reference, terms with generally understood meanings are defined herein, and the inclusion of such definitions herein should not be construed as indicating that there are substantial differences from what is generally understood in the art. Many of the techniques and procedures described or cited herein are well understood and frequently used by those skilled in the art using conventional methods.

[0059] Unless the context clearly dictates otherwise, the singular forms "a", "an", and "the" include plural referents. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following alternatives: "A", "B", "A or B", and "A and B".

[0060] As used herein, the terms "administration" and "administering" refer to the delivery of a biologically active composition or formulation by an administration route, including but not limited to oral, intravenous, intraarterial, intramuscular, intraperitoneal, subcutaneous, intramuscular, and topical administration, or a combination thereof. The terms include but are not limited to administration by a medical professional and self-administration.

[0061] The terms "cancer" or "tumor" are used interchangeably herein. These terms refer to the presence of cells with typical characteristics of cancer cells (such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features). Cancer cells are usually in the form of tumors, but such cells can exist alone in animals or can be non-neoplastic cells, such as leukemia cells. These terms include solid tumors, soft tissue tumors, or metastatic lesions. As used herein, the term "cancer" includes pre-malignant cancers and malignant cancers. In some embodiments, the cancer is a solid tumor, a soft tissue tumor, or a metastatic lesion.

[0062] As used herein, the terms "cell," "cell culture," "cell line," "recombinant host cell," "recipient cell," and "host cell" include the primary subject cell and any progeny thereof, without regard to the number of transfers.

[0063] As used herein, the term "operably connected" means a physical or functional connection between two or more elements (e.g., a polypeptide sequence or a polynucleotide sequence) that allows them to operate in their intended manner. For example, the operably connected between a polynucleotide of interest and a regulatory sequence (such as a promoter) is a functional connection that allows the expression of the polynucleotide of interest. In this context, the term "operably connected" refers to the positioning of a regulatory region and a coding sequence to be transcribed, so that the regulatory region effectively regulates the transcription or translation of the coding sequence of interest. Therefore, if a promoter can mediate the transcription of a nucleic acid sequence, it is in an operably connected state with the nucleic acid sequence. It should be understood that the operably connected elements can be adjacent or non-adjacent. In the context of a polypeptide, "operably connected" refers to a physical connection (such as directly or indirectly connected) between an amino acid sequence (different sections, modules or domains) to provide the described activity of the polypeptide. In the present disclosure, the various sections, regions or domains of the disclosed chimeric polypeptide and STMD receptor can be operably connected to maintain the correct folding, processing, targeting, expression, combination and other functional attributes of the polypeptide and receptor in cells. Unless otherwise indicated, the various segments, regions or domains of the disclosed chimeric polypeptides and STMD receptors are operably linked to each other. The operably linked segments, regions or domains of the disclosed chimeric polypeptides and STMD receptors may be adjacent or non-adjacent (e.g., linked to one another via a linker).

[0064] In the context of two or more nucleic acids or proteins, the term "percent identity" as used herein refers to two or more sequences or subsequences that are identical or have a specified percentage of identical nucleotides or amino acids (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity when compared and aligned over a comparison window or specified region to obtain maximum correspondence), as measured using BLAST or BLAST 2.0 sequence comparison algorithms using default parameters as described below or by manual alignment and visual inspection. See, for example, NCBI website ncbi.nlm.nih.gov / BLAST. Such sequences are otherwise referred to as "substantially identical". This definition also refers to or can be applied to the complement of a test sequence. This definition also includes sequences with deletions and / or additions and sequences with substitutions. Sequence identity typically exists over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence.

[0065] If desired, sequence identity can be calculated using published techniques and widely available computer programs such as the GCS program package (Devereux et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J Mol Biol 215:403, 1990). Sequence identity can be measured using sequence analysis software with the default parameters of the software, such as the sequence analysis software package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wisconsin 53705).

[0066] As used herein, and unless otherwise specified, a "therapeutically effective amount" of an agent is an amount sufficient to provide a therapeutic benefit in the treatment or management of cancer, or an amount sufficient to delay or minimize one or more symptoms associated with cancer. A therapeutically effective amount of a compound means an amount of a therapeutic agent, alone or in combination with other therapeutic agents, that provides a therapeutic benefit in the treatment or management of cancer. The term "therapeutically effective amount" can encompass an amount that improves overall therapy, alleviates or avoids symptoms or causes of cancer, or enhances the therapeutic efficacy of another therapeutic agent. An example of an "effective amount" is an amount sufficient to help treat, prevent, or alleviate one or more symptoms of a disease, which may also be referred to as a "therapeutically effective amount." "Relief" of a symptom means a reduction in the severity or frequency of one or more symptoms or the elimination of one or more symptoms. The exact amount of the composition (including a "therapeutically effective amount") will depend on the purpose of the treatment, and will be determined by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (Vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 22nd ed., 2012, Gennaro, ed., Lippincott, Williams & Wilkins).

[0067] As used herein, "subject" or "individual" includes animals, such as humans (e.g., human subjects) and non-human animals. In some embodiments, a "subject" or "individual" is a patient under the care of a doctor. Therefore, the subject can be a human patient or individual who suffers from, is at risk of suffering from, or is suspected of suffering from a disease (e.g., cancer) and / or one or more symptoms of a disease of interest. The subject can also be an individual who is diagnosed as having a risk of a disease of interest at or after diagnosis. The term "non-human animal" includes all vertebrates, such as mammals (e.g., rodents, such as mice) and non-mammals (such as non-human primates), such as sheep, dogs, cows, chickens, amphibians, reptiles, etc.

[0068] Where a range of values ​​is provided, it is understood that each intervening value, to the tenth unit of the lower limit (unless the context clearly indicates otherwise), between the upper and lower limits of the range and any other intervening values ​​stated or within the stated range are encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included within the smaller ranges and are also encompassed within the disclosure, subject to any specific excluded limits within the stated ranges. When a stated range includes one or two limits, ranges excluding either or both of those included limits are also encompassed within the disclosure.

[0069] Certain ranges are provided herein with numerical values ​​preceded by the term "about". The term "about" is used herein to provide literal support for the exact number that follows it, as well as for numbers that are close or approximately the number that precedes the term. In determining whether a number is close to or approximately the number specifically recited, a close or approximately number that is not recited may be a number that, in the context in which it appears, provides substantial equivalence to the number specifically recited.

[0070] As will be understood by those skilled in the art, for any and all purposes, such as in terms of providing a written specification, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be considered to fully describe and allow the same range to be decomposed into at least equal two, three, four, five, ten, etc. As a non-limiting example, each range discussed herein can be easily decomposed into a lower third, a middle third, and an upper third, etc. As will be understood by those skilled in the art, all expressions such as "up to", "at least", "greater than", "less than", etc. include the listed numbers and relate to the ranges that can be subsequently decomposed into sub-ranges as discussed above. Finally, as will be understood by those skilled in the art, a range includes each individual member. Therefore, for example, a group with 1-3 articles refers to a group with 1, 2, or 3 articles. Similarly, a group with 1-5 articles refers to a group with 1, 2, 3, 4, or 5 articles, and so on.

[0071] It should be understood that aspects and embodiments of the present disclosure described herein include aspects and embodiments that "comprising," "consisting of," and "consisting essentially of." As used herein, "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, "consisting of" does not exclude any elements, steps, or ingredients not specified in the claimed composition or method. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation of the term "comprising" herein (particularly in a description of components of a composition or a description of steps of a method) is understood to cover compositions and methods consisting essentially of the recited components or steps.

[0072] Headings, such as (a), (b), (i), etc., exist only to facilitate reading of the specification and claims. The use of headings in the specification or claims does not require that the steps or elements must be performed in alphabetical order, numerical order, or the order in which they appear.

[0073] It should be understood that certain features of the present disclosure described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, various features of the present disclosure described in the context of a single embodiment for brevity may also be provided separately or in any suitable sub-combination. All combinations of embodiments belonging to the present disclosure are specifically encompassed in the present disclosure and disclosed herein as if each and every combination were individually and specifically disclosed. In addition, all sub-combinations of various embodiments and elements thereof are also specifically encompassed in the present disclosure and disclosed herein as if each and every such sub-combination were individually and specifically disclosed herein. Compositions of the present disclosure Chimeric polypeptide

[0074] As described in more detail below, the present disclosure provides a new class of chimeric polypeptide receptors engineered to modulate transcriptional regulation in a ligand-dependent manner with various advantages over existing receptors, including the ability to associate with additional signaling chains via charged residues.

[0075] Accordingly, provided herein are chimeric polypeptides comprising (a) an extracellular ligand-binding domain (ECD) having binding affinity for a selected ligand; (b) a synthetic transmembrane domain (STMD) having one or more ligand-inducible proteolytic cleavage sites; and (c) an intracellular domain (ICD) comprising a transcriptional regulator (TR), wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcriptional regulator. Extracellular domain

[0076] In some embodiments, the chimeric polypeptide receptors disclosed herein and the extracellular domains of the STMD receptors have binding affinity for one or more target ligands. In principle, there are no particular restrictions on suitable ligands that can be targeted. In some embodiments, the target ligand is a cell surface ligand. Non-limiting examples of suitable ligands include cell surface receptors, adhesion proteins, integrins, mucins, lectins. In some embodiments, the ligand is a protein. In some embodiments, the ligand is a carbohydrate.

[0077] In some embodiments, the disclosed chimeric polypeptides and the extracellular domains of the STMD receptor are capable of binding to, e.g., having binding affinity for, a tumor-associated antigen (TAA) or a tumor-specific antigen (TSA). The term "tumor-associated antigen" or "TAA" generally refers to a molecule, such as a protein, that is present on tumor cells and on normal cells, or that is present on many normal cells but at a much lower concentration than on tumor cells. In contrast, the term "tumor-specific antigen" or "TSA" generally refers to a molecule, such as a protein, that is present on tumor cells but not on normal cells.

[0078] In some embodiments, the extracellular domain includes a ligand binding portion of a receptor. In some embodiments, the extracellular domain includes an antigen binding portion that is bound to one or more target antigens. In some embodiments, the antigen binding portion includes one or more antigen binding determinants of an antibody or its functional antigen binding fragment. In some embodiments, the antigen binding molecule is selected from the group consisting of: antibodies, nanobodies, double antibodies, three antibodies or mini antibodies, F (ab ') 2 fragments, Fab fragments, single chain variable fragments (scFv) and single domain antibodies (sdAb) or their functional fragments. In some embodiments, the antigen binding portion includes scFv.

[0079] Antigen binding moieties may include naturally occurring amino acid sequences or may be engineered, designed or modified to provide desired and / or improved properties, such as binding affinity. Typically, the binding affinity of an antigen binding moiety (e.g., an antibody) to a target antigen (e.g., CD19 antigen) may be calculated by the Scatchard method described by Frankel et al., Mol. Immunol, 16:101-106, 1979. In some embodiments, binding affinity may be measured by antigen / antibody dissociation rate. In some embodiments, binding affinity may be measured by competitive radioimmunoassay. In some embodiments, binding affinity may be measured by ELISA. In some embodiments, antibody affinity may be measured by flow cytometry. An antibody that "selectively binds" an antigen (e.g., CD19) is an antigen binding moiety that binds to an antigen with high affinity and does not significantly bind to other antigens.

[0080] Generally, there are no particular limitations on suitable antigens that can be targeted by the chimeric polypeptides and STMD receptors disclosed herein. Non-limiting examples of suitable target antigens include: CD19, B7H3 (CD276), BCMA, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD 117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, BCMA (CD269), ALPI, citrullinated vimentin, cMet, and Axl.

[0081] Additional antigens suitable for use with the chimeric polypeptides and STMD receptors disclosed herein include, but are not limited to, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13 receptor α1, IL-13 receptor α2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA). Other suitable target antigens include, but are not limited to, tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), macrocystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, melan-A protein (melanoma antigen recognized by T lymphocytes; MART-1), myo-D1, muscle-specific actin (MSA), neurofilaments, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptic vesicle protein, thyroglobulin, and thyroid transcription factor-1.

[0082] Other antigens suitable for use with the chimeric polypeptides and STMD receptors disclosed herein include, but are not limited to, pyruvate kinase isozyme M2 type (tumor M2-PK), CD19, CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1a, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, kappa light chain, lambda light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its isotype variants, TEM-8, sperm protein 17 (Sp17), and mesothelin. Other non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternate reading frame protein), Trp-p8, STEAP1 (prostatic six transmembrane epithelial antigen 1), abnormal ras protein, abnormal p53 protein, integrin beta 3 (CD61), prolactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene) and Ral-B. In some embodiments, the antigen is glypican 2 (GPC2), CD19, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3) or IL-13 receptor alpha.

[0083] In some embodiments, the chimeric polypeptides and STMD receptors disclosed herein include an extracellular domain, which includes an antigen binding portion that binds CD19, CEA, HER2, MUC1, CD20 or EGFR. In some embodiments, the chimeric polypeptides and STMD receptors disclosed herein include an extracellular domain, which includes an antigen binding portion that binds CD19. In some embodiments, the antigen binding portion includes an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with one or more of SEQ ID NO: 26 in the sequence list. In some embodiments, the antigen binding portion includes an amino acid sequence having 100% sequence identity with one or more of SEQ ID NO: 12-22 in the sequence list.

[0084] In some embodiments of the chimeric polypeptides of the present disclosure, the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80(B7.1), CD86(B7.2), CD94, CD95, CD134, CD140(PDGFR4), CD152, CD154, CD156, CD157, CD158, CD161, CD162, CD163, CD164, CD165, CD166, CD167, CD168, CD169, CD170, CD171, CD172, CD173, CD179A, CD179B, CD180(B7.1), CD86(B7.2), CD94, CD95 4. CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placental-like 2 (ALPPL2), B cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), and signal regulatory protein alpha (SIRPα).

[0085] In some embodiments, the ligand is a protein or a carbohydrate.

[0086] In some embodiments, the ligand is selected from the group consisting of a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen. Synthetic transmembrane domain (STMD)

[0087] The present disclosure provides STMD and chimeric polypeptides including the STMD. Generally, the transmembrane domain suitable for the chimeric polypeptide disclosed herein and the STMD receptor can be synthetic (STMD). In some embodiments, the STMD includes one or more alanine or leucine or valine residues or a combination thereof. In some embodiments, the STMD only includes valine residues. In some embodiments, the STMD includes one or more valine residues. In some embodiments, the STMD includes a series of at least 5 valine residues. In some embodiments, the STMD includes 1 to 35 valine residues, 5 to 30 valine residues, 10 to 25 valine residues, 15 to 20 valine residues or 15 to 25 valine residues.

[0088] In some embodiments, the STMD comprises at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 valine residues.

[0089] In some embodiments, the STMD consists of a valine residue (example GG0 encoded by SEQ ID NO: 2 in the sequence listing).

[0090] In some embodiments, the STMD may further include a glycine residue. In some embodiments, the STMD may further include two or more glycine residues. In some embodiments, the STMD includes two continuous glycine residues (i.e., diglycine or GG). In some embodiments, GG is located at the beginning of any position in position 1 to 20 or 1 to 25 or 1 to 30 of the polyvaline TMD, wherein position 30 is closer to the C-terminus of the chimeric polypeptide than position 1. In some embodiments, GG is at position 1 (GG1), position 2 (GG2), position 3 (GG3), position 4 (GG1), position 5 (GG5), position 6 (GG6), position 7 (GG7), position 8 (GG8), position 9 (GG9), position 10 (GG10), position 11 (GG11), position 12 (GG12), position 13 (GG13), position 14 (GG14), position 15 (GG15), position 16 (GG16), position 17 (GG17), position 18 (GG18), position 19 (GG19), or position 20 (GG20).

[0091] The STMD may include an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the following: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:27 or SEQ ID NO:30 or any functional variant thereof.

[0092] The STMD may include an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the following: SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 or any functional variant thereof.

[0093] In some embodiments, the STMD of the present disclosure is GG0 encoded by SEQ ID NO: 2. In some embodiments, the STMD is any one of GG1 to GG20 receptors (SEQ ID NO: 34 to SEQ ID NO: 55). GG1 to GG20 (GGX) are identical to GG0, except that they carry a GG substitution at numbered positions X and X+1 within the polyvaline TMD.

[0094] The STMD may include an amino acid sequence identical to any of the following: SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37 and SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54 or SEQ ID NO:55 or any functional variant thereof.

[0095] The STMDs of the present disclosure may include a ligand-inducible proteolytic cleavage site. In some embodiments, binding of a selected ligand to the extracellular ligand binding domain of a chimeric polypeptide of the present disclosure induces cleavage at the ligand-inducible proteolytic cleavage site and release of a transcriptional regulator. Connectors

[0096] The chimeric polypeptides disclosed herein and the various domains of the STMD receptor can be directly fused to each other, or can be operably connected to each other through a joint. In some embodiments, at least two of the polypeptide segments are directly connected to each other via at least one covalent bond. In some embodiments, at least two of the polypeptide segments are directly connected to each other via at least one peptide bond. In some embodiments, at least two of the polypeptide segments are operably connected to each other via a joint. There are no particular restrictions on the joints that can be used in the chimeric polypeptides described herein. In some embodiments, the joint is a synthetic compound joint, such as a chemical cross-linking agent. Non-limiting examples of suitable cross-linking agents available on the market include N-hydroxysuccinimide (NHS), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl) suberate (BS3), disulfide bis(succinimidyl propionate) (DSP), disulfide bis(sulfosuccinimidyl propionate) (DTSSP), ethylene glycol bis(succinimidyl succinate) (EGS), ethylene glycol bis(sulfosuccinimidyl succinate) (sulfo-EGS), disuccinimidyl tartrate (DST), bissulfosuccinimidyl tartrate (sulfo-DST), bis[2-(succinimidyloxycarbonyloxy)ethyl]sulfone (BSOCOES), and bis[2-(sulfosuccinimidyloxycarbonyloxy)ethyl]sulfone (sulfo-BSOCOES).

[0097] The joint can also be a joint peptide sequence. Therefore, in some embodiments, at least two of the polypeptide segments are operably connected to each other via a joint peptide sequence. In principle, there are no particular restrictions on the length and / or amino acid composition of the joint peptide sequence. In some embodiments, any single-stranded peptide comprising about 1 to 100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 amino acid residues, etc.) can be used as a peptide joint. In some embodiments, the joint peptide sequence comprises about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 80, about 70 to 100, about 30 to 60, about 20 to 80, about 30 to 90 amino acid residues. In some embodiments, the linker peptide sequence comprises about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25, about 20 to 40, about 30 to 50, about 40 to 60, about 50 to 70 amino acid residues. In some embodiments, the linker peptide sequence comprises about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90 or about 80 to 100 amino acid residues. In some embodiments, the linker peptide sequence comprises about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25 amino acid residues. Juxtamembrane domain

[0098] In some embodiments, the chimeric polypeptide and STMD receptor of the present disclosure include a juxtamembrane domain (JMD). In these examples, the term "juxtamembrane domain" generally refers to a flexible polypeptide connection region between the STMD domain and the intracellular domain (ICD) in the chimeric polypeptide and STMD receptor disclosed herein. In some embodiments, the JMD is operably connected to the downstream of the STMD domain and the upstream of the ICD domain. In principle, there are no particular restrictions on the length and / or amino acid composition of the JMD. In some embodiments, any single-chain peptide (such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 amino acid residues, etc.) comprising about 1 to about 300 amino acid residues can be used as a JMD. In some embodiments, the JMD comprises about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 120, about 70 to 150, about 100 to 200, about 150 to 250, about 200 to 300, about 30 to 60, about 20 to 80, about 30 to 90 amino acid residues. In some embodiments, the JMD comprises about 1 to 10, about 50 to 100, about 100 to 150, about 150 to 200, about 200 to 300, about 20 to 80, about 40 to 120, about 200 to 250 amino acid residues. In some embodiments, the JMD comprises about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90, or about 80 to 100 amino acid residues. In some embodiments, the JMD comprises about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25 amino acid residues. In some embodiments, the JMD comprises about 220, 225, 230, 235 or 240 amino acid residues. In some embodiments, the JMD comprises 229 amino acid residues. In some embodiments, the length and amino acid composition of the JMD can be optimized to change the orientation and / or proximity of the STMD domain and the ICD domain to each other to achieve the desired activity of the chimeric polypeptide and the STMD receptor. In some embodiments, the orientation and / or proximity of the JMD domain and the ICD domain to each other can be changed and / or optimized as an "adjustable" tool or effect that will increase or decrease the efficacy of the chimeric polypeptide and the STMD receptor.

[0099] In some embodiments, the JMD is Notch 2 JMD. In some embodiments, the JMD includes an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 28 in the sequence list. In some embodiments, the transmembrane domain includes an amino acid sequence having 100% sequence identity with SEQ ID NO: 28 in the sequence list. In some embodiments, the JMD is a polybasic domain similar to Notch 2 JMD. In some embodiments, the polybasic domain includes an amino acid sequence in which most of the residues (i.e., at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) are lysine and / or arginine and / or histidine and / or any combination thereof. Hinge domain

[0100] In some embodiments, the chimeric polypeptide or STMD receptor of the present disclosure may include a hinge domain. In these examples, the term "hinge domain" generally refers to a flexible polypeptide connection region between a targeting portion and a transmembrane domain. These sequences are generally derived from IgG subclasses (such as IgG1 and IgG4), IgD, and CD8 domains, of which IgG1 has been widely used. In some embodiments, the hinge domain provides structural flexibility for the flanking polypeptide region. The hinge domain may be composed of natural or synthetic polypeptides. It will be appreciated by those skilled in the art that the hinge domain can improve the function of the chimeric polypeptide or STMD receptor by promoting the optimal positioning of the antigen-binding portion and the antigen portion recognized by it. It will be appreciated that, in some embodiments, the hinge domain may not be necessary for the optimal chimeric polypeptide or STMD receptor activity. In some embodiments, a useful hinge domain comprising a short sequence of amino acids promotes the activity of the chimeric polypeptide or STMD receptor by promoting antigen binding (e.g., by otherwise alleviating any spatial restrictions that can change antibody binding kinetics). The sequence encoding the hinge domain may be located between the antigen recognition portion and the transmembrane domain. In some embodiments, the hinge domain operably connects the downstream of the antigen binding portion and the upstream of the transmembrane domain.

[0101] In some embodiments, the hinge domain is a CD8α hinge domain. In some embodiments, the hinge domain is a truncated CD8α transmembrane domain. In some embodiments, the CD8α hinge domain includes an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO:56 in the sequence list. In some embodiments, the transmembrane domain includes an amino acid sequence having 100% sequence identity with SEQ ID NO:56 in the sequence list. In some embodiments, the truncated CD8α hinge domain is encoded by a nucleotide sequence or a functional variant thereof having a sequence identity of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% or any value therebetween with SEQ ID NO:55. Intracellular domain

[0102] In some embodiments, the chimeric polypeptide or STMD receptor of the present disclosure includes an intracellular domain (ICD). The intracellular domain may have intracellular biological activity. The ICD may include a transcriptional regulatory factor. The transcriptional regulatory factor of the present disclosure is a polypeptide element, which is used to activate or inhibit the transcription of a promoter-driven DNA sequence. The transcriptional regulatory factor suitable for the compositions and methods of the present disclosure may be a naturally occurring transcriptional regulatory factor or may be engineered, designed or modified to provide desired and / or improved properties, for example, to regulate transcription. As discussed above, the advantage of the engineered receptors of the present disclosure is that they can provide the ability to induce a customized transcriptional program in an engineered cell. In some embodiments, the transcriptional regulatory factor of the present disclosure is a customized transcriptional regulatory factor that drives the transcription of a specific sequence that only appears once in an engineered cell.

[0103] In some embodiments, the transcriptional regulatory factor directly regulates the differentiation of cells. In some embodiments, the transcriptional regulatory factor indirectly regulates (e.g., regulates) the differentiation of cells by regulating the expression of a second transcription factor. It will be understood by those of ordinary skill in the art that a transcriptional regulatory factor can be a transcriptional activator or a transcriptional repressor. In some embodiments, the transcriptional regulatory factor is a transcriptional repressor. In some embodiments, the transcriptional regulatory factor is a transcriptional activator. In some embodiments, the transcriptional regulatory factor may further include a nuclear localization signal. In some embodiments, the transcriptional regulatory factor is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB and HAP1-VP16. In some embodiments, the transcriptional regulatory factor is Gal4-VP64.

[0104] The chimeric polypeptides and STMD receptors of the present disclosure can be chimeric polypeptides of any length, including chimeric polypeptides of a length generally between about 100 amino acids (aa) to about 1000 aa, for example, from about 100 aa to about 200 aa, from about 150 aa to about 250 aa, from about 200 aa to about 300 aa, from about 250 aa to about 350 aa, from about 300 aa to about 400 aa, from about 350 aa to about 450 aa, from about 400 aa to about 500 aa. In some embodiments, the length of the disclosed chimeric polypeptide is generally between about 400 aa to about 450 aa, from about 450 aa to about 500 aa, from about 500 aa to about 550 aa, from about 550 aa to about 600 aa, from about 600 aa to about 650 aa, from about 650 aa to about 700 aa, from about 700 aa to about 750 aa, from about 750 aa to about 800 aa, from about 800 aa to about 850 aa, from about 850 aa to about 900 aa, from about 900 aa to about 950 aa, or from about 950 aa to about 1000 aa. In some cases, the length of the chimeric polypeptide of the present disclosure is about 300 aa to about 400 aa. In some cases, the length of the chimeric polypeptide of the present disclosure is about 300 aa to about 350 aa. In some cases, the length of the chimeric polypeptide of the present disclosure is about 300 aa to about 325 aa. In some cases, the length of the chimeric polypeptide of the present disclosure is about 350 aa to about 400 aa. In some cases, the length of the chimeric polypeptide of the present disclosure is 750 aa to 850 aa. In some embodiments, the length of the chimeric polypeptide of the present disclosure is about 525 aa, about 538 aa, about 539 aa, about 542 aa, about 550 aa, about 556 aa, or about 697 aa. Nucleic Acids

[0105] In one aspect, some embodiments disclosed herein relate to nucleic acid molecules comprising nucleotide sequences encoding the chimeric polypeptides of the present disclosure and STMD receptors, including expression cassettes and expression vectors containing these nucleic acid molecules, which are operably linked to a heterologous nucleic acid sequence.

[0106] The present disclosure includes compositions and methods for introducing components of chimeric polypeptide systems into cells. Introducing nucleic acids into cells can be achieved in many ways, including methods described in many standard laboratory manuals, such as Davis et al., Basic methods in molecular biology, (1986); Sambrook et al., Molecular Cloning: A Laboratory Manual (4th edition). Cold Spring Harbor, New York: Cold Spring Harbor Laboratory (1989); and Kim and Eberwine, Mammalian cell transfection: the present and the future (2010), such as calcium phosphate transfection, DEAE-dextran-mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scratch loading (scrape loading), ballistic introduction, nuclear perforation, hydrodynamic impact and infection.

[0107] The present disclosure includes methods in which different chimeric polypeptides or receptor components are introduced into cells by different means, as well as compositions of matter for performing such methods. For example, nucleic acids encoding components of the chimeric polypeptide system can be introduced by transfection using lentiviral vectors.

[0108] In most cases, the chimeric polypeptide or receptor component will be introduced into the cell in a manner that allows the cell to produce the chimeric polypeptide. Thus, in the case of a cell expressing a chimeric polypeptide protein, the cell has been transfected with a nucleic acid encoding the chimeric polypeptide operably linked to a promoter, which has subsequently been, for example, chromosomally integrated.

[0109] Transfection agents suitable for use in the present disclosure include transfection agents that facilitate the introduction of RNA, DNA, and proteins into cells. Exemplary transfection reagents include TurboFect transfection reagent (Thermo Fisher Scientific), Pro-Ject reagent (ThermoFisher Scientific), TRANSPASS TM P protein transfection reagent (New England Biolabs), CHARIOT TM Protein delivery reagents (Active Motif), PROTEOJUICE TM Protein transfection reagent (EMD Millipore), 293fectin, LcIPOFECTAMINE TM 2000、LIPOFECTAMINE TM3000 (Thermo Fisher Scientific), LIPOFECTAMINE TM (Thermo Fisher Scientific), LIPOFECTIN TM (Thermo Fisher Scientific), DMRIE-C, CELLFECTIN TM (Thermo Fisher Scientific), OLIGOFECTAMINE TM (Thermo Fisher Scientific), LIPOFECTACE TM , FUGENE TM (Roche, Basel, Switzerland), FUGENE TM HD (Roche), TRANSFECTAM TM (Transfectam, Promega, Madison, Wis.), TFX-10 TM (Promega), TFX-20 TM (Promega), TFX-50 TM (Promega), TRANSFECTIN TM (BioRad, Hercules, Calif.), SILENTFECT TM (Bio-Rad), Effectene TM (Qiagen, Valencia, Calif.), DC-chol (Avanti Polar Lipids), GENEPORTER TM (Gene Therapy Systems, San Diego, Calif.), DHARMAFECT 1 TM (Dharmacon, Lafayette, Colo.), DHARMAFECT 2 TM (Dharmacon), DHARMAFECT3 TM (Dharmacon), DHARMAFECT 4 TM (Dharmacon), ESCORT TM III (Sigma, St. Louis, Mo.) and ESCORT TM IV (Sigma Chemical Co.).

[0110] The present disclosure further includes methods of introducing one molecule into a cell and subsequently introducing another molecule into the cell. Thus, more than one chimeric polypeptide or receptor component can be introduced into a cell simultaneously or at different times. As an example, the present disclosure includes methods of introducing a nucleic acid encoding a chimeric polypeptide or STMD receptor into a cell, while contacting the cell with a transfection reagent (such as TurboFect transfection reagent) designed to facilitate the introduction of nucleic acid into the cell, then washing the cell, and then introducing another chimeric polypeptide component into the cell, while the cell is contacted with, for example, LIPOFECTAMINE. TM 2000 contacts.

[0111] In addition and / or alternatively, the introduction of nucleic acid into cells can be achieved using viral transduction methods. Transduction does not require physical contact between cells donating DNA and cells receiving DNA, and has DNase resistance. Adeno-associated virus (AAV) is a non-enveloped virus that can be engineered to deliver nucleic acid to target cells via viral transduction. So far, the ability to generate AAV particles that do not contain any viral genes but contain various nucleic acid sequences of interest for therapeutic applications has been shown to be one of the safest strategies for gene therapy. Several AAV serotypes have been described, and all known serotypes can infect cells from a variety of different tissue types. AAV is able to transduce a wide range of species and tissues in vivo, with no evidence of toxicity, and it produces relatively mild innate and adaptive immune responses.

[0112] Lentiviral systems are also suitable for nucleic acid delivery and gene therapy via viral transduction. Lentiviral vectors offer several attractive properties as gene delivery vehicles, including: (i) sustained gene delivery through stable vector integration into the host genome; (ii) the ability to infect both dividing and non-dividing cells; (iii) a broad tissue tropism, including important gene and cell therapy target cell types; (iv) no expression of viral proteins after vector transduction; (v) the ability to deliver complex genetic elements, such as polycistronic sequences or sequences containing introns; (vi) potentially safer integration site characteristics; and (vii) a relatively easy system for vector manipulation and production.

[0113] As an example, the present disclosure includes methods for introducing a nucleic acid encoding a chimeric polypeptide into a cell using an expression cassette or an expression vector (such as a viral vector). The viral vector can be produced according to methods existing in the art, such as the methods in Watson and Wolfe et al. In a suitable culture medium, the target cells are transduced for about 2 hours with the desired number of cells and the multiplicity of infection (MOI) of the vector. The cells can be prepared so that they grow exponentially and the cell confluence does not exceed 70-80% before transduction. The cells can be added to the wells of a 96-well plate containing fresh culture medium and then incubated at 37°C in a humidified incubator. The lentiviral vector can be added to the appropriate wells, gently mixed and incubated at 37°C in a humidified incubator. Due to the toxicity of the lentiviral vector, the cells can be incubated for 2 to 4 hours (Nasri et al.) before replacing the culture medium containing the lentiviral vector.

[0114] Disclosed herein are nucleic acid molecules encoding components of the chimeric polypeptide system of the present disclosure, expression cassettes and expression vectors containing these nucleic acid molecules, which are operably linked to regulatory sequences so that the chimeric polypeptide system components are expressed in a host cell or in vitro cell-free expression system.

[0115] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein and refer to both RNA and DNA molecules, including nucleic acid molecules containing cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. Nucleic acid molecules can be double-stranded or single-stranded (e.g., sense strand or antisense strand). Nucleic acid molecules can contain unconventional or modified nucleotides. As used herein, the terms "polynucleotide sequence" and "nucleic acid sequence" refer interchangeably to the sequence of a polynucleotide molecule. The nucleotide base nomenclature shown in 37 CFR § 1.822 is used herein.

[0116] The nucleic acid molecules of the present disclosure can be of any length, and are typically between about 1.5 Kb and about 50 Kb, such as between about 5 Kb and about 40 Kb, between about 5 Kb and about 30 Kb, between about 5 Kb and about 20 Kb, or between about 10 Kb and about 50 Kb, between about 15 Kb and 30 Kb, about 20 Kb to about 50 Kb, about 20 Kb to about 40 Kb, about 5 Kb to about 25 Kb, or about 30 Kb to about 50 Kb.

[0117] In some embodiments, the nucleic acid molecule encodes a polypeptide having an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the first or second polypeptide chain of a chimeric polypeptide as disclosed herein. In some embodiments, the nucleic acid molecule encodes a single-chain polypeptide having an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any amino acid sequence identified in the sequence list. In some embodiments, the nucleic acid molecule encodes a polypeptide having an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any chimeric polypeptide amino acid sequence identified in the sequence list. In some embodiments, the nucleic acid molecules of the present disclosure encode a single-chain polypeptide having an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO:59 to SEQ ID NO:79.

[0118] Some embodiments disclosed herein relate to vectors or expression cassettes, which include recombinant nucleic acid molecules encoding chimeric polypeptides disclosed herein. Expression cassettes typically contain coding sequences and sufficient regulatory information to guide the correct transcription and / or translation of coding sequences in vivo and / or in vitro recipient cells. The expression cassette can be inserted into a vector for targeting a desired host cell and / or in a subject. The expression cassette can be inserted into a plasmid, a cosmid, a virus, an autonomously replicating polynucleotide molecule, a bacteriophage, as a linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotide molecule, derived from any source, which is capable of genome integration or autonomous replication, including such nucleic acid molecules, wherein one or more nucleic acid sequences have been connected in a functionally operable manner, i.e., operably connected.

[0119] Also provided herein are vectors, plasmids or viruses, which contain one or more nucleic acid molecules encoding any chimeric polypeptide disclosed herein. The nucleic acid molecule may be contained in a vector, which can guide the nucleic acid molecule to be expressed in cells, such as cells transformed / transduced with the vector. Suitable vectors for eukaryotic cells and prokaryotic cells are known in the art, and are commercially available or easily prepared by those skilled in the art. Additional vectors may also be found, for example, in Ausubel, FM et al., Current Protocols in Molecular Biology, New York, NY: Wiley (including supplements through 2014), and Sambrook, J., & Russell, DW (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, DW (2001).

[0120] In some embodiments, the chimeric polypeptide component is expressed by a vector (such as an expression vector). The vector is useful for autonomous replication in a host cell, or can be integrated into the genome of the host cell so as to be replicated together with the host genome (e.g., a non-episomal mammalian vector). An expression vector can direct the expression of a coding sequence operably connected thereto. Typically, an expression vector is typically in the form of a plasmid. However, other forms of expression vectors are also included, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses). Exemplary recombinant expression vectors may include one or more regulatory sequences selected based on the host cell to be used for expression and operably connected to the nucleic acid sequence to be expressed.

[0121] DNA vectors can be introduced into eukaryotic cells via conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (2012, supra) and other standard molecular biology laboratory manuals.

[0122] The nucleic acid sequence encoding the chimeric polypeptide can be optimized for expression in the host cell of interest. For example, the GC content of the sequence can be regulated to the average level for a given cellular host, as calculated with reference to known genes expressed in the host cell. Methods for codon optimization are known in the art. Codon usage within the coding sequence of the chimeric receptor disclosed herein can be optimized to enhance expression in the host cell such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons within the coding sequence have been optimized for expression in a particular host cell.

[0123] Vectors suitable for use include T7-based vectors for use in bacteria, pMSXND expression vectors for use in mammalian cells, and baculovirus-derived vectors for use in insect cells.

[0124] Viral vectors that can be used in the present disclosure include, for example, retroviral vectors, adenoviral vectors and adeno-associated viral vectors, lentiviral vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, e.g., Gluzman (ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, ny).

[0125] Viral vectors may include a modified pHR'SIN:CSW vector (SEQ ID NO: 1) for lentiviral transduction and receptor expression.The chimeric polypeptides of the present disclosure may be inserted into the BamHI (GGATCC) site downstream of the PGK promoter sequence by In-fusion cloning (Clontech).

[0126] The precise components of the expression system are not important. For example, a chimeric receptor as disclosed herein can be produced in a prokaryotic host such as the bacterium Escherichia coli or a eukaryotic host such as an insect cell (e.g., Sf21 cells) or a mammalian cell (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells can be obtained from many sources, including the American Type Culture Collection (Manassas, Virginia). In selecting an expression system, care should be taken to ensure that the components are compatible with each other. A person skilled in the art or of ordinary skill will be able to make such a determination. In addition, if guidance is needed in selecting an expression system, the skilled person can consult Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY, 1993) and Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987).

[0127] The expressed antibodies can be purified from the expression system using conventional biochemical procedures, and can be used, for example, as therapeutic agents, as described herein.

[0128] In some embodiments, the chimeric polypeptide or STMD receptor obtained will be glycosylated or unglycosylated, depending on the host organism used to produce the chimeric polypeptide. If bacteria are selected as the host, the chimeric polypeptide produced will be unglycosylated. On the other hand, eukaryotic cells will glycosylate the chimeric polypeptide, although it may be in a glycosylated manner different from the native polypeptide. The recombinant antibodies produced by the transformed host can be purified according to any suitable method known in the art. The recombinant antibodies produced can be isolated from the inclusion bodies produced in bacteria such as Escherichia coli or from the conditioned medium of mammalian or yeast cultures using cation exchange, gel filtration and / or reversed phase liquid chromatography, and the mammalian or yeast cultures produce the chimeric polypeptide of the present disclosure.

[0129] In addition or alternatively, another exemplary method for constructing a DNA sequence encoding a chimeric polypeptide of the present disclosure is by chemical synthesis. This includes direct synthesis of peptides by chemical means encoding an amino acid sequence of a chimeric polypeptide exhibiting the properties. This method can incorporate natural and non-natural amino acids at positions that affect the binding affinity of the chimeric polypeptide to the target protein. Alternatively, the gene encoding the desired chimeric polypeptide can be synthesized chemically using an oligonucleotide synthesizer. Such oligonucleotides are designed based on the amino acid sequence of the desired chimeric polypeptide, and preferably those codons that are favorable in the host cell that will produce the chimeric polypeptide of the present disclosure are selected. In this regard, it is recognized in the art that the genetic code is degenerate, so that an amino acid can be encoded by more than one codon. For example, Phe (F) is encoded by two codons TIC or TTT, Tyr (Y) is encoded by TAC or TAT, and His (H) is encoded by CAC or CAT. Trp (W) is encoded by a single codon TGG. Therefore, it will be understood by those skilled in the art that for a given DNA sequence encoding a particular chimeric polypeptide, there are many degenerate DNA sequences that will encode the chimeric polypeptide. For example, it should be understood that in addition to the DNA sequences for chimeric polypeptides provided herein, there are many degenerate DNA sequences encoding the chimeric polypeptides disclosed herein. These degenerate DNA sequences are considered to be within the scope of the present disclosure. Therefore, in the context of the present disclosure, "degenerate variants thereof" refers to all DNA sequences that encode a specific chimeric polypeptide and thereby enable its expression.

[0130] The DNA sequence encoding the subject chimeric polypeptide, whether prepared by site-directed mutagenesis, chemical synthesis or other methods, may also include a DNA sequence encoding a signal sequence. Such a signal sequence, if present, should be a signal sequence recognized by the cell selected for expressing the chimeric polypeptide. It can be prokaryotic, eukaryotic or a combination of the two. Generally, the addition of a signal sequence depends on whether it is desired to secrete the chimeric polypeptide disclosed herein from the recombinant cell that produces it. If the selected cell is prokaryotic, it is generally preferred that the DNA sequence does not encode a signal sequence. If the selected cell is eukaryotic, it is generally preferred to include a signal sequence.

[0131] The nucleic acid molecules provided may contain naturally occurring sequences, or sequences that are different from naturally occurring sequences but encode the same polypeptide (e.g., antibody) due to the degeneracy of the genetic code. These nucleic acid molecules may be composed of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, such as DNA produced by phosphoramidite-based synthesis) or combinations or modifications of nucleotides within these types of nucleic acids. In addition, the nucleic acid molecules may be double-stranded or single-stranded (e.g., sense strand or antisense strand).

[0132] The nucleic acid molecules are not limited to sequences encoding polypeptides (e.g., antibodies); they may also include some or all non-coding sequences encoding sequences upstream or downstream of a coding sequence (e.g., a coding sequence of a chimeric polypeptide). Those of ordinary skill in the field of molecular biology are familiar with conventional procedures for isolating nucleic acid molecules. For example, they can be produced by treating genomic DNA with restriction endonucleases or by polymerase chain reaction (PCR). In the case where the nucleic acid molecule is a ribonucleic acid (RNA), the molecule can be produced, for example, by in vitro transcription.

[0133] Exemplary isolated nucleic acid molecules of the present disclosure may include fragments that are not found in nature. Thus, the present disclosure encompasses recombinant molecules, such as recombinant molecules that incorporate nucleic acid sequences (e.g., sequences encoding chimeric polypeptides disclosed herein) into vectors (e.g., plasmids or viral vectors) or the genome of heterologous cells (or homologous cell genomes, in locations other than the natural chromosomal location).

[0134] Provided herein is a method for incorporating one or more nucleic acids encoding one or more chimeric polypeptides of the present disclosure into the genome of a heterologous cell. Such methods preferably use homology directed recombination (HDR), which requires the use of a specifically designed endonuclease or nickase to introduce a double-strand break (DSB) into the target genome position. Then, by HDR, a "donor" nucleic acid comprising one or more chimeric polypeptides is introduced into the genome of the cell.

[0135] As used herein, "donor" nucleic acid is used interchangeably and refers to a nucleic acid corresponding to an endogenous targeted gene fragment (in some embodiments, the entire target gene) of a cell, but the nucleic acid includes one or more chimeric polypeptides and other sequences required for expression of the chimeric polypeptide (such as, but not limited to, promoters and / or enhancers). The donor nucleic acid must be of sufficient size and similarity to allow homologous recombination with the targeted gene. The donor nucleic acid can be provided as a single-stranded oligonucleotide (ssODN), as a PCR product (amplicon), or in a vector. Preferably, the donor nucleic acid includes modifications related to the endogenous gene that i) prevent it from being cut off by the gRNA once it is incorporated into the genome of the cell, and / or facilitate the detection of the introduction of the donor nucleic acid by homologous recombination.

[0136] The CRISPR / Cas system is an effective system for inducing targeted genetic changes. The Cas9 protein requires a "seed" sequence within the guide RNA (gRNA) and a conserved dinucleotide sequence located upstream of the gRNA binding region and containing a pre-spacer adjacent motif (PAM). By redesigning gRNA in cell lines (such as 293T cells), primary cells, and T cells, the CRISPR / Cas system can be engineered to cut almost any DNA sequence. The CRISPR / Cas system can target multiple genomic sites simultaneously by co-expressing a single Cas9 protein with two or more gRNAs, which makes the system suitable for HDR when a donor sequence is provided.

[0137] The present disclosure provides a method for generating a cell expressing one or more chimeric polypeptides by introducing a Cas expression vector and a gene-specific guide nucleic acid sequence into a cell. In another embodiment, the Cas expression vector induces the expression of a Cas9 endonuclease. Other endonucleases may also be used, including but not limited to T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, Cpf1 (or Cas12a), other nucleases known in the art, and any combination thereof.

[0138] In one embodiment, inducing the Cas expression vector includes exposing the cell to an agent that activates an inducible promoter in the Cas expression vector. In such embodiments, the Cas expression vector includes an inducible promoter, such as an inducible promoter by exposure to an antibiotic (e.g., tetracycline or a derivative of tetracycline, such as doxycycline). However, it should be understood that other inducible promoters can be used. The inducing agent can be a selective condition that causes the induction of an inducible promoter (e.g., exposure to an agent, such as an antibiotic). This results in expression of the Cas expression vector.

[0139] The guide nucleic acid sequence is specific to a certain gene and targets the gene for double-strand breaks induced by Cas endonucleases. The sequence of the guide nucleic acid sequence can be within the locus of the gene. In one embodiment, the length of the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides. The guide nucleic acid sequence can be specific to any genomic site in the cell.

[0140] The guide nucleic acid sequence comprises an RNA sequence, a DNA sequence, a combination thereof (RNA-DNA combination sequence) or a sequence with synthetic nucleotides. The guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA.

[0141] Provided herein is a method for introducing one or more nucleic acids encoding one or more chimeric polypeptides of the present disclosure into the genome of a heterologous cell by HDR using various other types of endonucleases or nickases. Non-limiting examples of endonucleases and nickases include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) (Gaj T, Gersbach CA, & Barbas CF, 3rd (2013) ZFN, TALEN, and CRISPR / Cas-based methods for genome engineering. Trends Biotechnol 31 (7): 397-405; Arnould S, et al. (2011) The 1-CreI meganuclease and its engineered derivatives: applications from cell modification to gene therapy. Protein engineering, design & selection: PEDS 24 (1-2): 27-31). According to the present invention, these endonucleases and nickases can be used to introduce a nucleic acid encoding one or more chimeric polypeptides within a target genomic sequence by HDR when a donor sequence comprising an expression cassette for said one or more chimeric polypeptides is provided. Host cells

[0142] One aspect of the present disclosure is a cell containing a chimeric polypeptide and / or containing a nucleic acid encoding any chimeric polypeptide disclosed herein. One embodiment is a recombinant cell comprising a chimeric polypeptide as disclosed herein and an STMD receptor and progeny thereof. In some embodiments, the recombinant cell comprises a recombinant nucleic acid as disclosed herein.

[0143] Cell cultures containing at least one recombinant cell as disclosed herein are also within the scope of the present disclosure. It should be understood that not all progeny are identical to the parental cells (due to intentional or unintentional mutations or environmental differences); however, as long as such altered progeny cells retain the same functions as the initially transformed cells, these progeny cells are included within these terms.

[0144] The nucleic acid of the present disclosure can be introduced into a host cell such as a human T lymphocyte to produce a recombinant cell containing the nucleic acid molecule. Therefore, some embodiments of the present disclosure relate to a method for preparing a recombinant cell, which includes (a) providing a cell capable of expressing a protein, and (b) contacting the provided cell with a recombinant nucleic acid of the present disclosure.

[0145] Introducing the nucleic acid molecules of the present disclosure into cells can be performed by methods known to those skilled in the art, such as viral infection, transfection, conjugation, protoplast fusion, liposome transfection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0146] Therefore, in some embodiments, nucleic acid molecules can be delivered by viral or non-viral delivery means and methods known in the art.For example, nucleic acid molecules can be stably integrated into the host genome, or can be replicated as episomes, or exist in recombinant host cells as mini-ring expression vectors for transient expression.Therefore, in some embodiments, the nucleic acid molecules are maintained and replicated as episomal units in the recombinant host cells.In some embodiments, the nucleic acid molecules are stably integrated into the genome of the recombinant cells.Stable integration can be achieved using classical random genome recombination techniques or with more precise techniques, such as CRISPR / Cas9 genome editing guided by guiding RNA, DNA-guided nuclease genome editing or TALEN genome editing (transcription activator-like effector nuclease) using NgAgo (Natronobacterium gregoryi Argonaute).In some embodiments, nucleic acid molecules are present in recombinant host cells as mini-ring expression vectors for transient expression.

[0147] The nucleic acid molecule can be encapsulated in a viral capsid or lipid nanoparticle, or can be delivered by viral or non-viral delivery means and methods (such as electroporation) as known in the art. For example, the introduction of nucleic acid into a cell can be achieved by viral transduction. In a non-limiting example, adeno-associated virus (AAV) can be engineered to deliver nucleic acid to a target cell via viral transduction. Several AAV serotypes have been described, and all known serotypes can infect cells from a variety of different tissue types. AAV can transduce a wide range of species and tissues in vivo, without evidence of toxicity, and it produces a relatively mild inherent and adaptive immune response.

[0148] Lentiviral-derived vector systems can also be used for nucleic acid delivery and gene therapy via viral transduction. Lentiviral vectors have a variety of attractive properties as gene delivery vehicles, including (i) sustained gene delivery through stable integration of the vector into the host genome; (ii) the ability to infect both dividing and non-dividing cells; (iii) a broad tissue tropism, including important gene and cell therapy target cell types; (iv) no expression of viral proteins after vector transduction; (v) the ability to deliver complex genetic elements, such as polycistronic sequences or sequences containing introns; (vi) potentially safer integration site characteristics; and (vii) a relatively easy system for vector manipulation and production.

[0149] In some embodiments, host cells can be genetically engineered (e.g., transduced or transformed or transfected) using, for example, a vector construct of the present application, which can be, for example, a viral vector or a vector for homologous recombination (comprising a nucleic acid sequence homologous to a portion of the host cell genome), or an expression vector for expressing a polypeptide of interest. The host cell can be an untransformed cell or a cell that has been transfected with at least one nucleic acid molecule.

[0150] In some embodiments, the cell recombinant is a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is in vivo. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vitro. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell. In some embodiments, the mammalian cell is an immune cell, a neural cell, an epithelial cell, an endothelial cell or a stem cell. In some embodiments, the recombinant cell is an immune system cell, such as a lymphocyte (such as a T cell or a NK cell) or a dendritic cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer (NK) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (Tx), a cytotoxic T cell (Tcm) or other T cells. In some embodiments, the immune system cell is a T lymphocyte.

[0151] In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments of cells, the cell is a lymphocyte. In some embodiments, the cell is a precursor T cell or a T regulatory (Treg) cell. In some embodiments, the cell is a CD34+CD8+ or CD4+ cell. In some embodiments, the cell is a CD8+T cytotoxic lymphocyte selected from immature CD8+T cells, central memory CD8+T cells, effector memory CD8+T cells and a large number of (bulk) CD8+T cells. In some embodiments of the cell, the cell is a CD4+T helper lymphocyte selected from immature CD4+T cells, central memory CD4+T cells, effector memory CD4+T cells and a large number of CD4+T cells. In some embodiments, the cell can be obtained by leukocytosis performed on a sample obtained from a subject. In some embodiments, the subject is a human patient.

[0152] In some embodiments, the recombinant cell further comprises a first and a second nucleic acid molecule as disclosed herein, wherein the first nucleic acid molecule and the second nucleic acid molecule do not have the same sequence. In some embodiments, the recombinant cell further comprises a first and a second chimeric polypeptide or STMD receptor disclosed herein, wherein the first chimeric polypeptide or STMD receptor and the second chimeric polypeptide or STMD receptor do not have the same sequence. In some embodiments, the first chimeric polypeptide or STMD receptor regulates the expression and / or activity of the second chimeric polypeptide or STMD receptor.

[0153] In some embodiments, the recombinant cell further includes an expression cassette encoding a protein of interest, the protein of interest being operably connected to a promoter, wherein the expression of the protein of interest is regulated by a chimeric receptor transcriptional regulatory factor. In some embodiments, the protein of interest is heterologous to the recombinant cell. Heterologous protein refers to a protein that is not normally present in the cell, such as a protein that is not normally produced by the cell. In principle, there are no particular restrictions on suitable proteins that can be regulated to express by chimeric receptor transcriptional regulatory factors. Exemplary types of proteins suitable for use in the compositions and methods disclosed herein include cytokines, cytotoxins, chemokines, immunomodulators, pro-apoptotic factors, anti-apoptotic factors, hormones, differentiation factors, dedifferentiation factors, immune cell receptors or reporters. In some embodiments, immune cell receptors include T cell receptors (TCRs).

[0154] In some embodiments, the immune cell receptor is a chimeric antigen receptor (CAR). In some embodiments, the expression cassette encoding the protein of interest is incorporated into the same nucleic acid molecule encoding the chimeric receptor disclosed herein. In some embodiments, the expression cassette encoding the protein of interest is incorporated into a second expression vector separated from the nucleic acid molecule encoding the chimeric receptor disclosed herein. On the other hand, cell cultures and cell culture media including at least one recombinant cell as disclosed herein are provided herein. In general, the culture medium can be any culture medium suitable for culturing the cells described herein. The techniques for transforming the various host cells and species mentioned above are known in the art and are described in the technical and scientific literature. Therefore, a cell culture comprising at least one recombinant cell as disclosed herein is also within the scope of the present application. Methods and systems suitable for producing and maintaining cell cultures are known in the art. Pharmaceutical composition

[0155] In some embodiments, the chimeric polypeptides, STMD receptors, nucleic acids and recombinant cells of the present disclosure can be incorporated into compositions (including pharmaceutical compositions). Such compositions generally include chimeric polypeptides, STMD receptors, nucleic acids and / or recombinant cells, and pharmaceutically acceptable excipients, such as carriers.

[0156] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL TM(BASF, Parsippany, New Jersey) or phosphate buffered saline (PBS). In all cases, the composition should be sterile and should be fluid to the extent that it is easy to inject. It should be stable under manufacturing and storage conditions and must be preserved against the contaminating effects of microorganisms (such as bacteria and fungi). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof. For example, appropriate fluidity can be maintained by using a coating such as lecithin, by maintaining the desired particle size in the case of a dispersion, and by using a surfactant (e.g., sodium lauryl sulfate). Preventing the effects of microorganisms can be achieved by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc.). In many cases, isotonic agents such as sugars, polyols (such as mannitol, sorbitol) and sodium chloride are typically included in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0157] Sterile injectable solutions can be prepared in the following manner: the active compound is incorporated in the desired amount into a suitable solvent optionally having one or a combination of the above-listed components, followed by filtration sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other desired components from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred preparation methods are vacuum drying and freeze drying, which can harvest active ingredient powders and any additional desired components from their previously sterile filtered solutions.

[0158] Oral compositions, if used, typically include an inert diluent or edible carrier. For the purpose of oral therapeutic administration, the active compound (such as the chimeric polypeptide, STMD receptor, nucleic acid and / or recombinant cell of the present disclosure) can be combined with an excipient and used in the form of tablets, lozenges or capsules (such as gelatin capsules). Oral compositions can also be prepared using liquid carriers for use as mouthwashes. Pharmaceutically compatible binders and / or auxiliary materials may be included as part of the composition. The tablets, pills, capsules, lozenges, etc. may contain any of the following ingredients or compounds of similar properties: binders, such as microcrystalline cellulose, tragacanth gum or gelatin; excipients, such as starch or lactose; disintegrants, such as alginic acid, Primogel TM or corn starch; Lubricants such as magnesium stearate or Sterotes TM ; a glidant such as colloidal silicon dioxide; a sweetener such as sucrose or saccharin; or a flavoring such as peppermint, methyl salicylate, or orange flavoring.

[0159] In the event of administration by inhalation, the subject chimeric polypeptides and STMD receptors of the present disclosure are sprayed in the form of an aerosol spray from a pressurized container or dispenser or nebulizer containing a suitable propellant (eg, a gas such as carbon dioxide). Such methods include those described in U.S. Pat. No. 6,468,798.

[0160] Systemic administration of the subject chimeric polypeptides and STMD receptors of the present disclosure can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants compatible with the barrier to be penetrated are used in the formulation. Such penetrants are well known in the art and include, for example, for transmucosal administration, detergents, bile salts and fusidic acid derivatives. Transmucosal administration can be accomplished by using nasal sprays or suppositories. For transdermal administration, the active compound is formulated into an ointment, salves, gel or cream as generally known in the art.

[0161] In some embodiments, the chimeric polypeptides and STMD receptors of the present disclosure may also be prepared in the form of suppositories (eg, using traditional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0162] In some embodiments, the chimeric polypeptides and Notch receptors of the present disclosure can also be administered by transfection or infection using methods known in the art, including but not limited to the methods described in McCaffrey et al. (Nature 418:6893, 2002); Xia et al. (Nature Biotechnol. 20:1006-10, 2002); or Putnam (Am. J. Health Syst. Pharm. 53:151-60, 1996, errata in Am. J. Health Syst. Pharm. 53:325, 1996).

[0163] In some embodiments, the subject chimeric polypeptides and STMD receptors of the present disclosure are prepared with a carrier that will protect the recombinant polypeptide from rapid excretion from the body, such as a controlled release formulation, including implants and microcapsule delivery systems. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Such formulations can be prepared using standard techniques. These materials can also be obtained from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeting infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. As described in more detail below, the chimeric polypeptides and STMD receptors of the present disclosure can also be modified to achieve extended duration of action, such as by PEGylation, acylation, Fc fusion, connection to molecules (such as albumin), etc. In some embodiments, the recombinant polypeptide can be further modified to extend its half-life in vivo and / or in vitro. Non-limiting examples of known strategies and methods suitable for modifying the recombinant polypeptides of the present disclosure include: (1) chemically modifying the recombinant polypeptides described herein with highly soluble macromolecules such as polyethylene glycol ("PEG"), which can prevent the recombinant polypeptides from contacting with proteases; and (2) covalently linking or conjugating the recombinant polypeptides described herein to stable proteins such as, for example, albumin. Therefore, in some embodiments, the chimeric polypeptides and STMD receptors of the present disclosure can be fused to stable proteins such as albumin. For example, human albumin is one of the most effective proteins known to enhance the stability of polypeptides fused thereto, and there have been many reports of such fusion proteins.

[0164] In some embodiments, pharmaceutical compositions of the present disclosure include one or more pegylation agents. As used herein, the term "PEGylation" refers to modifying the protein by covalently connecting polyethylene glycol (PEG) to the protein, and "PEGylation" refers to the protein connected with PEG. Various chemical methods can be used to connect a certain range of PEG or PEG derivatives (optionally ranging from about 10,000 daltons to about 40,000 daltons) to the recombinant polypeptide of the present disclosure. In some embodiments, the mean molecular weight of the PEG or PEG derivative is about 1kD to about 200kD, such as about 10kD to about 150kD, about 50kD to about 100kD, about 5kD to about 100kD, about 20kD to about 80kD, about 30kD to about 70kD, about 40kD to about 60kD, about 50kD to about 100kD, about 100kD to about 200kD or about 150kD to about 200kD. In some embodiments, the average molecular weight of the PEG or PEG derivative is about 5kD, about 10kD, about 20kD, about 30kD, about 40kD, about 50kD, about 60kD, about 70kD, or about 80kD. In some embodiments, the average molecular weight of the PEG or PEG derivative is about 40kD. In some embodiments, the PEGylation agent is selected from: methoxypolyethylene glycol-succinyl propionic acid (mPEG-SPA), mPEG-succinimidyl succinate (mPEG-SBA), mPEG-succinimidyl succinate (mPEG-SS), mPEG-succinimidyl carbonate (mPEG-SC), mPEG-succinimidyl glutarate (mPEG-SG), mPEG-N-hydroxysuccinimide (mPEG-NHS), mPEG-toluenesulfonate and mPEG-formaldehyde. In some embodiments, the pegylation agent is polyethylene glycol; for example, the pegylation agent is polyethylene glycol covalently bound to the N-terminal methionine residue of the recombinant polypeptide of the present disclosure with an average molecular weight of 20,000 daltons. In some embodiments, the pegylation agent is polyethylene glycol covalently bound to the N-terminal methionine residue of the STMD receptor and recombinant polypeptide of the present disclosure with an average molecular weight of about 5kD, about 10kD, about 20kD, about 30kD, about 40kD, about 50kD, about 60kD, about 70kD or about 80kD. In some embodiments, the pegylation agent is polyethylene glycol covalently bound to the N-terminal methionine residue of the recombinant polypeptide and STMD receptor of the present disclosure with an average molecular weight of about 40kD.

[0165] Thus, in some embodiments, the recombinant polypeptides and STMD receptors of the present disclosure are chemically modified with one or more polyethylene glycol moieties, such as PEGylation; or similarly modified, such as PASylation. In some embodiments, PEG molecules or PAS molecules are conjugated to one or more amino acid side chains of the disclosed recombinant polypeptides. In some embodiments, the PEGylated or PASylated polypeptides contain PEG or PAS moieties on only one amino acid. In other embodiments, the PEGylated or PASylated polypeptides contain PEG or PAS moieties on two or more amino acids, for example, connected to two or more, five or more, ten or more, fifteen or more, or twenty or more different amino acid residues. In some embodiments, the PEG or PAS chain is 2000, greater than 2000, 5000, greater than 5,000, 10,000, greater than 10,000, greater than 10,000, 20,000, greater than 20,000, and 30,000 Da. The PASylated polypeptide can be directly coupled to PEG or PAS through an amino group, a sulfhydryl group, a hydroxyl group or a carboxyl group (e.g., without a linker). In some embodiments, the recombinant polypeptide of the present disclosure is covalently bound to a polyethylene glycol having an average molecular weight of 20,000 daltons. In some embodiments, the recombinant polypeptide of the present disclosure is covalently bound to a polyethylene glycol having an average molecular weight of about 1kD to about 200kD, such as about 10kD to about 150kD, about 50kD to about 100kD, about 5kD to about 100kD, about 20kD to about 80kD, about 30kD to about 70kD, about 40kD to about 60kD, about 50kD to about 100kD, about 100kD to about 200kD, or about 1150kD to about 200kD. In some embodiments, the recombinant polypeptides of the present disclosure are covalently bound to polyethylene glycol having an average molecular weight of about 5 kD, about 10 kD, about 20 kD, about 30 kD, about 40 kD, about 50 kD, about 60 kD, about 70 kD, or about 80 kD. In some embodiments, the recombinant polypeptides of the present disclosure are covalently bound to polyethylene glycol having an average molecular weight of about 40 kD. Methods of the present disclosure Methods for treating a health condition in an individual in need thereof

[0166] Provided herein are methods for treating the health conditions of individuals in need thereof. Administration of any of the therapeutic compositions described herein (such as chimeric polypeptides, STMD receptors, nucleic acids, recombinant cells, and pharmaceutical compositions) can be used to treat patients' related diseases, such as cancer and chronic infections. In some embodiments, the chimeric polypeptides, STMD receptors, nucleic acids, recombinant cells, and pharmaceutical compositions described herein may be incorporated into therapeutic agents for the treatment of patients with, suspected of having, or having a high risk of having one or more autoimmune diseases or health diseases associated with checkpoint inhibition. Exemplary autoimmune disorders and health diseases may include, but are not limited to, cancer and chronic infections.

[0167] In some embodiments, the method includes administering an effective number of recombinant cells disclosed herein to an individual, wherein the recombinant cell inhibits the activity of a target cell in the individual. Generally, the target cell of the disclosed method can be any cell type of the individual, and can be, for example, acute myeloma leukemia cells, anaplastic lymphoma cells, astrocytoma cells, B cell cancer cells, breast cancer cells, colon cancer cells, ependymoma cells, esophageal cancer cells, glioblastoma cells, glioma cells, leiomyosarcoma cells, liposarcoma cells, hepatoma cells, lung cancer cells, mantle cell lymphoma cells, melanoma cells, multiple myeloma cells, neuroblastoma cells, non-small cell lung cancer cells, oligodendroglioma cells, ovarian cancer cells, pancreatic cancer cells, peripheral T cell lymphoma cells, renal cancer cells, sarcoma cells, gastric cancer cells, cancer cells, mesothelioma cells or sarcoma cells. In some embodiments, the target cell is a pathogenic cell.

[0168] In some embodiments, the methods of the present disclosure involve administering an effective amount of the recombinant cells of the present disclosure to an individual in need of such treatment. This administration step can be accomplished using any transplant delivery method known in the art. For example, the recombinant cells of the present disclosure can be directly infused into the bloodstream of an individual or administered to an individual in other ways.

[0169] In some embodiments, the methods disclosed herein include administering (the term is used interchangeably with the terms "introducing", "implanting" and "transplanting") recombinant cells to an individual by a method or approach that results in at least a portion of the introduced cells being positioned at a desired site to produce one or more desired effects. The recombinant cells or their differentiated progeny can be administered by any appropriate approach that results in delivery to the desired location of the individual, where at least a portion of the administered cells or cell components remain viable. After administration to an individual, the cell's viability period can be as short as a few hours (e.g., twenty-four hours), to a few days, to as long as several years, or even the life span of the individual, i.e., long-term transplantation.

[0170] When provided prophylactically, the recombinant cells described herein can be administered to an individual prior to the onset of any symptoms of the disease or disorder to be treated. Thus, in some embodiments, prophylactic administration of a recombinant cell population prevents the onset of symptoms of a disease or disorder.

[0171] When provided therapeutically, in some embodiments, the recombinant cells are provided at the onset of (or after) symptoms or indications of a disease or disorder, such as at the onset of the disease or disorder.

[0172] For use in the various embodiments described herein, an effective amount of a recombinant cell as disclosed herein may be at least 10 2 cells, at least 5×10 2 cells, at least 10 3 cells, at least 5×10 3 cells, at least 10 4 cells, at least 5×10 4 cells, at least 10 5 cells, at least 2×10 5 cells, at least 3×10 5 cells, at least 4×10 5 cells, at least 5×10 5 cells, at least 6×10 5 cells, at least 7×10 5 cells, at least 8×10 5 cells, at least 9×10 5 cells, at least 1×10 6 cells, at least 2×10 6 cells, at least 3×10 6 cells, at least 4×10 6 cells, at least 5×10 6 cells, at least 6×10 6 cells, at least 7×10 6 cells, at least 8×10 6 cells, at least 9×10 6 Cells, or multiples thereof. The recombinant cells may be derived from one or more donors or may be obtained from an autologous source. In some embodiments, the recombinant cells are expanded in culture before being administered to an individual in need thereof.

[0173] In some embodiments, a recombinant cell composition (e.g., a composition comprising a plurality of recombinant cells according to any of the cells described herein) is delivered to an individual by a method or route that results in the cell composition being at least partially localized at a desired site. The composition comprising the recombinant cells can be administered by any appropriate route that results in effective treatment of the individual, for example, administration results in delivery to a desired location in the body of the individual, wherein at least a portion of the delivered composition (e.g., at least 1×10 4 Cells) are delivered to the desired site for a period of time. Modes of administration include injection, infusion, and infusion. "Injection" includes but is not limited to intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. For the delivery of cells, delivery by injection or infusion is a preferred mode of administration.

[0174] In some embodiments, the recombinant cells are administered systemically, for example, via infusion or injection. For example, the recombinant cell population is not administered directly to a target site, tissue, or organ so that it enters the circulatory system of an individual and thereby undergoes metabolism and other similar biological processes.

[0175] The efficacy of treatments including any of the compositions provided herein for treating a disease or condition can be determined by a skilled clinician. However, it will be appreciated by those skilled in the art that treatment is considered effective if any or all of the signs or symptoms or markers of the disease are improved or ameliorated. Therapeutic efficacy can also be measured by failure of individual deterioration as assessed by reduced hospitalization or the need for medical intervention (e.g., disease progression stops or at least slows down). Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment of a disease in an individual or animal (some non-limiting examples include humans or mammals) and includes: (1) inhibiting the disease, e.g., stopping or slowing the progression of symptoms; or (2) alleviating the disease, e.g., causing symptoms to subside; and (3) preventing or reducing the likelihood of symptom development.

[0176] As discussed above, a therapeutically effective amount includes an amount of a therapeutic composition sufficient to promote a specific beneficial effect when administered to an individual, such as an individual suffering from, suspected of suffering from, or at risk of suffering from a disease. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the development of symptoms of a disease, to alter the course of symptoms of a disease (e.g., but not limited to, to slow the progression of symptoms of a disease), or to reverse symptoms of a disease. It should be understood that for any given case, a person skilled in the art can determine an appropriate effective amount using routine experimentation.

[0177] In some embodiments of the disclosed methods, the individual is a mammal. In some embodiments, the mammal is a human. In some embodiments, the individual suffers from or is suspected of suffering from a disease associated with inhibition of cell signaling mediated by a cell surface ligand or antigen. Diseases suitable for treatment by the compositions and methods of the present disclosure include, but are not limited to, cancer, autoimmune diseases, inflammatory diseases, and infectious diseases. In some embodiments, the disease is cancer or a chronic infection. Additional treatments

[0178] As discussed above, recombinant cells and pharmaceutical compositions described herein can be administered in combination with one or more additional therapeutic agents (e.g., chemotherapeutic agents or anticancer agents or anticancer therapies). "Combination" administration with one or more additional therapeutic agents includes simultaneous (concurrent) administration and continuous administration in any order. In some embodiments, the one or more additional therapeutic agents, chemotherapeutic agents, anticancer agents or anticancer therapies are selected from chemotherapy, radiotherapy, immunotherapy, hormone therapy, toxin therapy and surgery. "Chemistry" and "anticancer agents" are used interchangeably herein. Various types of anticancer agents can be used. Non-limiting examples include: alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxin, antibodies (e.g., monoclonal or polyclonal), tyrosine kinase inhibitors (e.g., imatinib mesylate (GleevecRTM or Glivec RTM)), hormone therapy, soluble receptors and other antitumor drugs.

[0179] In some embodiments, the first therapy and the additional therapy (such as the second therapy) are performed concomitantly. In some embodiments, the first therapy and the additional therapy are administered separately or sequentially. The therapies can be administered in the same or different compositions. Methods for regulating the activity of cells

[0180] In one aspect, some embodiments of the present disclosure relate to a method for regulating the activity of a target cell in an individual, the method comprising providing a recombinant cell of the present disclosure, and contacting the recombinant cell with a selected ligand, wherein the binding of the selected ligand to the extracellular binding domain of the chimeric polypeptide of the STMD receptor of the present disclosure induces the cleavage of the ligand-inducible proteolytic cleavage site and releases a transcriptional regulatory factor, whereby the released transcriptional regulatory factor regulates the activity of the recombinant cell. In some embodiments, the released transcriptional regulatory factor regulates the differentiation of the cell, and wherein the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

[0181] In some embodiments, the released transcriptional regulatory factors regulate the expression of the gene products of the cells. In some embodiments, the released transcriptional regulatory factors regulate the expression of endogenous gene products. In some embodiments, the released transcriptional regulatory factors regulate the expression of heterologous gene products. In some embodiments, the gene products of the cells are chemokines, chemokine receptors, chimeric antigen receptors, cytokines, cytokine receptors, differentiation factors, growth factors, growth factor receptors, hormones, metabolic enzymes, pathogen-derived proteins, proliferation-inducing factors, receptors, RNA-guided nucleases, site-specific nucleases, T cell receptors, toxins, proteins derived from toxins, transcription activators, transcription repressors, transcriptional regulatory factors, translation activators, translation repressors, activating immune receptors, antibodies, apoptosis inhibitors, apoptosis inducing factors, engineered T cell receptors, immune activators, immune suppressors, and inhibitory immune receptors.

[0182] Some embodiments of the present disclosure relate to methods for inhibiting the activity of target cells in an individual, the method comprising administering to the individual a first therapy comprising one or more of a nucleic acid, a recombinant cell, and a pharmaceutical composition as disclosed herein, wherein the first therapy inhibits the target cell. For example, if the proliferation of the target cell is reduced, if the pathology or pathogenic behavior of the target cell is reduced, if the target cell is destroyed or killed, etc., the target cell may be inhibited. Inhibition includes a measured reduction in pathology or pathogenic behavior of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90% or about 95%. In some embodiments, the method comprises administering to an individual an effective amount of a recombinant cell disclosed herein, wherein the recombinant cell inhibits the activity of a target cell in an individual. In general, the target cell of the disclosed method can be any cell type in the individual, and can be, for example, an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B cell cancer cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a hepatoma cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a multiple melanoma cell, a neuroblastoma cell, a non-small cell lung cancer cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T cell lymphoma cell, a renal cancer cell, a sarcoma cell, a gastric cancer cell, a cancer cell, a mesothelioma cell, a hematological malignancy cell, a solid tumor cell or a sarcoma cell. In some embodiments, the target cell is a pathogenic cell.

[0183] The target cell may be inhibited if proliferation of the target cell is reduced, if pathological or pathogenic behavior of the target cell is reduced, if the target cell is destroyed or killed, etc. Inhibition includes a measured reduction in pathological or pathogenic behavior of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. In some embodiments, contacting the cell is performed in vivo, ex vivo, or in vitro.

[0184] For example, the activity of a cell can be: expression of a selected gene of a cell, proliferation of a cell, apoptosis of a cell, non-apoptotic death of a cell, differentiation of a cell, dedifferentiation of a cell, migration of a cell, secretion of a molecule from a cell, adhesion of a cell, and cytolytic activity of a cell. Methods for inducing T cell signaling and gene regulation in T cells

[0185] The present disclosure also provides a method for inducing T cell signaling and gene regulation in T cells, comprising providing a vector comprising the chimeric polypeptide of the present disclosure, and transducing T cells with the vector, wherein binding of a selected ligand to the extracellular ligand binding domain of the chimeric polypeptide induces the release of intracellular signaling and transcriptional regulatory factors. Methods of making the recombinant cells of the present disclosure

[0186] The present disclosure also provides a method for making a recombinant cell of the present disclosure. In some embodiments, the method for making the recombinant cell includes providing a cell capable of expressing a protein; and contacting the provided cell with a recombinant nucleic acid molecule of the present disclosure. Contacting may include transducing the cell with the recombinant nucleic acid molecule by any method known to those skilled in the art. Some of the methods are described above.

[0187] The present disclosure also provides the use of the compositions of the present disclosure for the treatment of diseases. In some embodiments, the use is of the chimeric polypeptides of the present disclosure. In some embodiments, the use is of the recombinant nucleic acid molecules of the present disclosure. In some embodiments, the use is of the recombinant cells of the present disclosure. In some embodiments, the use is of the STMDs of the present disclosure.

[0188] The present disclosure also provides for the use of any of the compositions, methods, kits and systems herein in treating a disease or for the preparation of a medicament for treating a disease. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor or a hematological malignancy. In some embodiments, the hematological malignancy is multiple myeloma. Systems and Kits

[0189] The system or kit of the present disclosure includes one or more of any chimeric polypeptide, STMD receptor, recombinant nucleic acid, recombinant cell or pharmaceutical composition disclosed herein, and a syringe (including a pre-filled syringe) and / or a catheter (including a pre-filled syringe) for administering any of the chimeric polypeptide, STMD receptor, recombinant nucleic acid, recombinant cell or pharmaceutical composition to an individual. The kit also includes written instructions for using any chimeric polypeptide, STMD receptor, recombinant nucleic acid, recombinant cell or pharmaceutical composition disclosed herein and a syringe and / or catheter for their administration.

[0190] Therefore, the present invention provides a system for regulating the activity of cells, killing target cancer cells, or treating a disease in an individual in need thereof, wherein the system comprises one or more of the following: a) a chimeric polypeptide according to any one of claims 1 to 34; b) a recombinant nucleic acid molecule according to any one of claims 40 to 41; c) a recombinant cell according to any one of claims 46 to 52; and / or d) a pharmaceutical composition of the present disclosure.

[0191] Any of the above systems and kits may further comprise one or more additional reagents, wherein such additional reagents may be selected from: a dilution buffer, a reconstitution solution, a wash buffer, a control reagent, a control expression vector, a negative control polypeptide, a positive control polypeptide, a reagent for in vitro production of a chimeric receptor polypeptide.

[0192] In some embodiments, the components of the system or kit can be in separate containers. In some other embodiments, the components of the system or kit can be combined in a single container.

[0193] In some embodiments, system or test kit can also include the use of the components of the test kit to practice the instructions of the method. The instructions for practicing the method are usually recorded on a suitable recording medium. For example, the instructions can be printed on a substrate such as paper or plastic, etc. The instructions can be present in the test kit as a packaging insert, in the label of the container of the test kit or its components (that is, associated with packaging or sub-packaging), etc. The instructions can exist as an electronic storage data file present in a suitable computer-readable storage medium (for example, CD-ROM, floppy disk, flash drive, etc.). In some instances, the actual instructions are not present in the test kit, but can provide the means for obtaining the instructions from a remote source (for example, via the Internet). The example of this embodiment is a test kit including a website, in which the instructions can be viewed and / or the instructions can be downloaded therefrom. Like the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

[0194] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0195] No admission is made that any reference cited herein constitutes prior art. The discussion of the references states what their authors assert, and the inventors reserve the right to challenge the accuracy and relevance of the cited documents. It should be clearly understood that although a number of information sources are referred to herein, including scientific journal articles, patent documents and textbooks; this reference does not constitute an admission that any of these documents constitutes part of the common general knowledge in the field.

[0196] The discussion of the general methods given herein is intended for illustrative purposes only. Other alternatives and substitutions will be apparent to those skilled in the art after reviewing this disclosure and are to be included within the spirit and scope of the present application. Example

[0197] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those skilled in the art. These techniques are explained fully in the literature, such as Sambrook, J., & Russell, DW (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, DW (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as "Sambrook"); Ausubel, FM (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (including supplements through 2014); Bollag, DM et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press. Press; Kaplitt, MG et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, KB, Ferré, F. & Gibbs, R. (1994).PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, EA (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, SL et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements through 2014); and Makrides, SC (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences B.V., the disclosures of which are incorporated herein by reference. .

[0198] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration only and are not intended to limit the scope of the disclosure or the claims in any way. Example 1 Design and construction of chimeric polypeptide and response element constructs

[0199] This example describes the design and construction of receptors with STMDs.

[0200] The chimeric polypeptides described herein were constructed by fusing CD19 scFv (Porter et al., 2011) to the corresponding receptor scaffold and Gal4 DBD VP64. All receptors contain an N-terminal CD8α signal peptide (MALPVTALLLPLALLLHAARP) (SEQ ID NO: 31) for membrane targeting and a fluorescent dye (α-myc The myc tag (EQKLISEEDL) (SEQ ID NO: 32) of a suitable assay for surface expression of an antibody conjugated to ELISA Kit (Genentech Cell Signaling Technology, Cat# 2233) was used.

[0201] The transcriptional regulator GAL4-VP64 used in these experiments contains the DNA domain from the yeast GAL4 transcription factor fused to the activation domain VP64, which consists of tetrameric repeats of the minimal activation domain (amino acids 437-447) of the herpes simplex protein VP16. For all primary T cell experiments, the receptor was cloned into a modified pHR'SIN:CSW vector containing the PGK promoter (SEQ ID NO: 1).

[0202] pHR'SIN:CSW vector is also modified to make response element plasmid.Five copies of GAL4 DBD binding domain target sequence (GGAGCACTGTCCTCCGAACG) (SEQ ID NO:33) are cloned to the 5' side of the minimum pybTATA promoter.The response element plasmid also includes a PGK promoter, which constitutively drives the expression of mCitrine to easily identify transduced T cells.For all inducible BFP vectors, BFP is cloned via the BamHI site in the multiple cloning site at the 3' side of the GAL4 response element.For all inducible CAR vectors, CAR is labeled with GFP at the C-terminus and cloned via the BamHI site in the multiple cloning site at the 3' side of the GAL4 response element.All constructs are cloned via Infusion cloning (Clontech#ST0345).

[0203] BamHI homology sites were added to the following receptor sequences (provided as nucleotide sequences) and inserted into the above lentiviral transduction vectors. The description of the individual components follows the consecutive sequence. The following chimeric polypeptides listed in Table 1 were constructed. Table 1 Example 2 Primary human T cell isolation and culture

[0204] This example describes the isolation and culture of primary human T cells, which were subsequently used in various cell transduction experiments described in Example 3 below.

[0205] After apheresis, primary CD4+ and CD8+ T cells were isolated from anonymous donor blood by negative selection (STEMCELL Technologies#15062&15063). Blood was obtained from the Blood Center of the Pacific (Blood Centers of thePacific) (San Francisco, California), as approved by the University Institutional Review Board (UniversityInstitutionalReviewBoard). T cells were cryopreserved in RPMI-1640 (UCSF Cell Culture Core) containing 20% ​​human AB serum (ValleyBiomedical Inc., #HP1022) and 10% DMSO. After thawing, for all experiments, T cells were cultured in human T cell culture medium composed of X-VIVOTM 15 (Lonza#04-418Q), 5% human AB serum and 10mM neutralized N-acetyl L-cysteine ​​(Sigma-Aldrich#A9165) supplemented with 30 units / mL IL-2 (NCI BRB preclinical repository). Example 3 Lentiviral transduction of human T cells

[0206] This example describes a general protocol for lentiviral transduction of human T cells using pantropic VSV-G pseudotyped lentivirus.

[0207] Lentivirus pseudotyped with pantropic VSV-G was generated by using pHR′SIN:CSW transgene expression vector and viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus (Mirus, #MIR 6606) transfected with Lenti-X TM 293T cells (Clontech #11131D) were produced. Primary T cells were thawed on the same day and stimulated with human T activator CD3 / CD28 Dynabeads (Life Technologies #11131D) at a cell: bead ratio of 1:3 after 24 hours of culture. At 48 hours, viral supernatant was harvested and primary T cells were exposed to the virus for 24 hours. On the 5th day after T cell stimulation, Dynabeads were removed, T cells were sorted with Beckton Dickinson (BD) FACs ARIA II, and amplified for use in the assay. Example 4 Cancer cell lines

[0208] This example describes the generation of myeloid leukemia cells that express CD19 at levels equivalent to those of Daudi tumors.

[0209] The cancer cell line used was K562 myeloid leukemia cells (ATCC # CCL-243). K562 was lentivirally transduced to stably express human CD19 at levels equivalent to Daudi tumors. CD19 levels were determined by staining cells with α-CD19 APC (Biolegend # 302212). All cell lines were sorted for expression of transgenes. Example 5 In vitro stimulation of primary T cells

[0210] This example describes the in vitro stimulation of primary T cells.

[0211] For all in vitro T cell stimulations, 1 × 10 5 T cells were co-cultured with target cells at a 1:1 ratio in U-bottom 96-well tissue culture plates. Cultures were analyzed for reporter activation and / or target cell killing using a BD Fortessa X-50 at 24 hours or as indicated. All flow cytometric analyses were performed in FlowJo software (TreeStar). Example 6 Testing of synthetic polyvaline TMD-based receptors

[0212] Primary human CD3+T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with a lentiviral construct expressing a multi-chain receptor construct and another lentiviral construct containing a transcriptional reporter construct. Receptor expression was measured using an AlexaFluor647-labeled anti-myc antibody (Cell Signaling) for the myc tag on the chain containing the binder (CD19scFv). Reporter expression was measured by the constitutive mCitrine gene found on the reporter plasmid. On the 5th day after initial T cell stimulation, double positive cells were sorted and further amplified for activation testing. To measure receptor activity, 1E5 double positive T cells expressing anti-CD19 receptors were co-cultured with the following cells for 48 hours: no addition (red), 1E5K562 cells (blue) or 1E5 CD19+K562 cells (yellow). Transcriptional activation of the inducible BFP reporter gene was subsequently measured using a Fortessa X-50 (BD). Figure 2B ). Example 7 Testing of synthetic polyvaline TMD-based receptors with destabilizing residues

[0213] Primary human CD3+T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with a lentiviral construct expressing a multi-chain receptor construct and another lentiviral construct containing a transcriptional reporter construct. Receptor expression was measured using an AlexaFluor647-labeled anti-myc antibody (Cell Signaling) for the myc tag on the chain containing the binder (CD19scFv). Report expression was measured by the constitutive mCitrine gene on the reporter plasmid. On the 5th day after initial T cell stimulation, double positive cells were sorted and further used for activation testing after amplification. In order to measure receptor activity, 1E5 double positive T cells expressing anti-CD19 receptors were co-cultured with the following cells for 48 hours: no addition (red), 1E5 K562 cells (blue) or 1E5 CD19+K562 cells (yellow). Fortessa X-50 (BD) was subsequently used to measure the transcriptional activation of the inducible BFP reporter gene. Here, with no destabilizing residues ( Figure 3A ) compared to the destabilizing residues at positions 18-19 of the polyvaline TMD (GG18, Figure 3B ) increases transcriptional activation. Example 8 Testing for destabilizing residues within the first N-terminal residue of synthetic polyvaline TMD receptors

[0214] Primary human CD3+T cells are activated with anti-CD3 / anti-CD28 Dynabeads (Gibco), and transduced with a lentiviral construct expressing a multi-chain receptor construct and another lentiviral construct containing a reporter construct of transcription. Receptor expression is measured using the anti-myc antibody (CellSignaling) labeled for the myc tag on the chain containing binding substances (CD19scFv). Report subexpression is measured by the constitutive mCitrine gene measurement found on the reporter plasmid. On the 5th day after initial T cell stimulation, double positive cells are sorted, and further used for activation test through amplification. In order to measure receptor activity, 1E5 double positive T cells expressing anti-CD19 receptors and 1E5 CD19+K562 cells (yellow) are co-cultured for 48 hours. Fortessa X-50 (BD) is subsequently used to measure the transcriptional activation of inducible BFP reporter gene. At this time, the destabilizing residues at positions 1-2 (GG1) to 12-13 (GG12) showed roughly equivalent or higher activity compared to the original polyvaline TMD (PV TMD) ( Figure 5 ). Example 9 Test for destabilizing residues in the last C-terminal residue of synthetic polyvaline TMD receptors

[0215] Primary human CD3+T cells are activated with anti-CD3 / anti-CD28 Dynabeads (Gibco), and transduced with a lentiviral construct expressing a multi-chain receptor construct and another lentiviral construct containing a reporter construct of transcription. Receptor expression is measured using the anti-myc antibody (CellSignaling) labeled for the myc tag on the chain containing binding substance (CD19scFv). Reporter expression is measured by the constitutive mCitrine gene found on the reporter plasmid. On the 5th day after initial T cell stimulation, double positive cells are sorted, and further used for activation test through amplification. In order to measure receptor activity, 1E5 double positive T cells expressing anti-CD19 receptors and 1E5 CD19+K562 cells (yellow) are co-cultured for 48 hours. Fortessa X-50 (BD) is subsequently used to measure the transcriptional activation of inducible BFP reporter gene. Here, destabilizing residues at positions 13-14 (GG13) to 20-21 (GG20) showed a monotonic increase in receptor activation, suggesting that the activity was higher as the GG mutations moved closer to the C-terminus ( Figure 6 ).

[0216] Although specific alternatives of the present disclosure have been disclosed, it should be understood that various modifications and combinations are possible and contemplated within the true meaning and scope of the appended claims. Therefore, there is no intention to limit the specific abstract and disclosure presented herein. Informal Sequence Listing *Acceptors GG1 to GG20 (GGX) are identical to GG0 but have GG substitutions at numbered positions X and X+1 within the polyvaline TMD. References David L.Porter,M.D.,Bruce L.Levine,Ph.D.,Michael Kalos,Ph.D.,AdamBagg,M.D.,and Carl H.June,M.D.Chimeric Antigen Receptor-Modified T Cells inChronic Lymphoid Leukemia.N.Engl J Med.(2011)Aug 25;365(8):725-33. Gordon WR et al.,The molecular logic of Notch signaling-a structuraland biochemical perspective.J.Cell Sci.(2008)121:3109-19. Gordon WR et al.,Mechanical Allostery:Evidence for a ForceRequirement in the Proteolytic Activation of Notch.Dev Cell(2015)33:729-36. Haapasalo A1,Kovacs DM.The many substrates of presenilin / γ-secretase.J Alzheimers Dis.(2011);25(1):3-28. Rosmalen M.,Krom M.,and Merkx M.Tuning the Flexibility of Glycine-Serine Linkers To Allow Rational.Biochemistry(2017)56:6565-6574. Morsut L,Roybal KT,Xiong X,Gordley RM,Coyle SM,Thomson M,and LimWA.Engineering Customized Cell Sensing and Response Behaviors Using SyntheticNotch Receptors.Cell.(2016)February 11;164(4):780-91. Naso MF,Tomkowicz B,Perry WL 3rd,Strohl WR.Adeno-Associated Virus(AAV)as a Vector for Gene Therapy.BioDrugs.(2017);31(4):317-34. Nasri M,Karimi A,Allahbakhshian Farsani M.Production,purification andtitration of a lentivirus-based vector for gene deliverypurposes.Cytotechnology.(2014);66(6):1031-38. Porter DL,Levine BL,Kalos M.,Bagg A and June CH.Chimeric AntigenReceptor-Modified T Cells in Chronic Lymphoid Leukemia.August 25,2011.N.Engl.J.Med.(2011);365:725-733. Roybal KT,Jasper Z.Williams,Leonardo Morsut,Levi J.Rupp,IsabelKolinko,Joseph H.Choe,Whitney J.Walker,Krista A.McNally,and WendellA.Lim.Engineering T cells with Customized Therapeutic Response Programs UsingSynthetic Notch Receptors.Cell.(2016)Oct 6;167(2):419-32. Samulski and Muzyczka.AAV-Mediated Gene Therapy for Research andTherapeutic Purposes.Annu.Rev.Virol.(2014)1:427. Sakuma,et al.(2012).Lentiviral vectors:basic totranslational.Biochem.J.443:603. Watson D.J.,Wolfe J.H.Viral vectors for gene therapy:methods andprotocols.Totowa,NJ,USA:Humana Press;(2003).pp.383-404. Vidarsson G.et al.,IgG subclasses and allotypes:from structure toeffector functions.Frontiers Immunol.(2014)Oct 20;5:520. Zhang et al.,Theγ-secretase complex:from structure tofunction.Frontiers in Cellular Neuroscience.(2014)December 8:427.

Claims

1. A chimeric polypeptide, comprising: (a) an extracellular ligand-binding domain (ECD) that has binding affinity for a selected ligand; (b) a synthetic transmembrane domain (STMD) that contains one or more ligand-inducible proteolytic cleavage sites; and (c) an intracellular domain (ICD) that contains a transcriptional regulatory factor (TR), wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcriptional regulatory factor.

2. The chimeric polypeptide according to claim 1, wherein the chimeric polypeptide further comprises a hinge domain incorporated between the extracellular ligand-binding domain and the STMD.

3. The chimeric polypeptide according to claim 1, wherein the chimeric polypeptide comprises the ECD, the STMD, and the ICD in sequence from the N-terminus to the C-terminus of a first polypeptide.

4. The chimeric polypeptide according to claim 2, wherein the chimeric polypeptide comprises the ECD, the hinge domain, the STMD, and the ICD in sequence from the N-terminus to the C-terminus of a first polypeptide.

5. The chimeric polypeptide according to any one of claims 1 to 4, wherein the STMD contains one or more valine residues.

6. The chimeric polypeptide according to any one of claims 1 to 5, wherein the STMD contains a series of at least 5 valine residues.

7. The chimeric polypeptide according to any one of claims 1 to 6, wherein the STMD contains 5 to 30 valine residues.

8. The chimeric polypeptide according to any one of claims 1 to 7, wherein the STMD further contains two consecutive glycine residues.

9. The chimeric polypeptide according to claim 8, wherein the two consecutive glycine residues are located anywhere in positions 5 to 30 of the STMD, where position 30 is closer to the C-terminus of the chimeric polypeptide than position 5.

10. The chimeric polypeptide according to any one of claims 1 to 9, wherein the STMD consists of valine residues.

11. The chimeric polypeptide according to any one of claims 1 to 10, wherein the ligand comprises a protein or a carbohydrate.

12. The chimeric polypeptide according to any one of claims 1 to 11, wherein the ligand is selected from cell surface receptors, adhesion proteins, integrins, mucins, lectins, tumor-associated antigens, and tumor-specific antigens.

13. The chimeric polypeptide according to any one of claims 1 to 12, wherein the ligand is selected from the group consisting of: CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placental-like 2 (ALPPL2), B cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), and signal regulatory protein alpha (SIRPα).

14. The chimeric polypeptide according to any one of claims 11 to 13, wherein the extracellular binding domain comprises the ligand-binding portion of a receptor.

15. The chimeric polypeptide according to any one of claims 1 to 14, wherein the ECD comprises an antigen-binding portion capable of binding to a ligand on the surface of a cell.

16. The chimeric polypeptide according to claim 15, wherein the antigen-binding portion is selected from the group consisting of: an antibody, a nanobody, a diabody, a triabody or a minibody, an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb) or a functional fragment thereof.

17. The chimeric polypeptide according to claim 16, wherein the antigen-binding portion comprises an scFv.

18. The chimeric polypeptide according to any one of claims 1 to 17, wherein the antigen-binding portion is capable of binding to a tumor-associated antigen selected from the group consisting of: CD19, B7H3 (CD276), BCMA, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, BCMA (CD269), ALPI, citrullinated vimentin, cMet, and Axl.

19. The chimeric polypeptide according to claim 10, wherein the tumor-associated antigen is CD19, CEA, HER2, MUC1, CD20, or EGFR.

20. The chimeric polypeptide according to claim 11, wherein the tumor-associated antigen is CD19.

21. The chimeric polypeptide according to claim 15, wherein the cell is a pathogen.

22. The chimeric polypeptide according to any one of claims 8 to 13, wherein the ligand-inducible proteolytic cleavage site is two consecutive glycine residues.

23. The chimeric polypeptide according to any one of claims 1 to 22, wherein the transcriptional regulatory factor comprises a transcriptional activator, a transcriptional repressor, a site-specific nuclease, an inhibitory immune receptor, or an activating immune receptor.

24. The chimeric polypeptide according to any one of claims 1 to 23, wherein the transcriptional regulatory factor is selected from the group consisting of: Ga14-VP16, Ga14-VP64, tetR-VP64, ZFHD1-VP64, Ga14-KRAB, and HAP1-VP16.

25. The chimeric polypeptide according to any one of claims 1 to 23, which further comprises a combination of a ligand-inducible proteolytic cleavage site, a tumor-specific cleavage site, a disease-specific cleavage site, an autoproteolytic peptide sequence, a nuclear localization signal, a juxtamembrane domain, a signaling domain, or any combination thereof.

26. The chimeric polypeptide according to claim 25, wherein the signaling domain is from DAP12, CD3ζ, TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (ICOS), Fc.ε.RI, DAP10, DAP12 or CD66d.

27. The chimeric polypeptide according to claim 25, wherein the juxtamembrane domain is the Notch 2 juxtamembrane domain or a similar polybasic domain.

28. The chimeric polypeptide according to claim 25, wherein the proteolytic cleavage site is cleavable by γ-secretase.

29. The chimeric polypeptide according to claim 25, wherein the autoproteolytic polypeptide sequence is from porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), Spodoptera litura virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), softening disease virus 2A (BmIFV2A) or a combination thereof.

30. The chimeric polypeptide according to any one of claims 2 to 25, wherein the hinge domain is from CD8α or CD28.

31. The chimeric polypeptide according to claim 30, wherein the hinge domain is a truncated CD8α hinge domain.

32. The chimeric polypeptide according to any one of claims 1 to 31, wherein the STMD comprises an amino acid sequence encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NO: 2 to SEQ ID NO: 22, SEQ ID NO: 27 or SEQ ID NO:

30.

33. The chimeric polypeptide according to any one of claims 1 to 31, wherein the STMD comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54 and SEQ ID NO:

55.

34. The chimeric polypeptide according to any one of claims 1 to 17, wherein the chimeric polypeptide is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO:2 or SEQ ID NO:

3.

35. An STMD for the chimeric polypeptide according to any one of claims 1 to 34, wherein the STMD comprises at least 5 valine residues.

36. The STMD according to claim 35, wherein the STMD comprises at least 10 valine residues.

37. The STMD according to claim 35, wherein the STMD comprises at least 20 valine residues.

38. The STMD according to claim 35, wherein the STMD comprises from 15 to 25 valine residues.

39. The STMD according to any one of claims 35 to 38, wherein the STMD comprises a ligand-inducible proteolytic cleavage site, and wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site and release of the transcriptional regulator.

40. A recombinant nucleic acid molecule comprising a nucleotide sequence encoding the chimeric polypeptide according to any one of claims 1 to 34.

41. The recombinant nucleic acid molecule according to claim 40, wherein the recombinant nucleic acid molecule comprises a sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity with any one of SEQ ID NO:2, SEQ ID NO:22, SEQ ID NO:27 and SEQ ID NO:

30.

42. A vector comprising the recombinant nucleic acid molecule according to claim 40 or 41.

43. The vector according to claim 42, wherein the vector is an expression vector.

44. The vector according to claim 43, wherein the expression vector is a viral vector.

45. The vector according to claim 44, wherein the viral vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a retroviral vector.

46. A recombinant cell comprising: the chimeric polypeptide according to any one of claims 1 to 34; or the recombinant nucleic acid according to any one of claims 40 to 41; or the vector according to any one of claims 42 to 45; or the STMD according to any one of claims 35 to 39.

47. The recombinant cell according to claim 46, wherein the cell is a mammalian cell.

48. The recombinant cell according to claim 54, wherein the mammalian cell is an immune cell, a neuron, an epithelial cell, an endothelial cell or a stem cell.

49. The recombinant cell according to claim 48, wherein the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, a CD4+ T cell, a CD8+ T cell or another T cell.

50. The recombinant cell according to any one of claims 46 to 49, which comprises a chimeric polypeptide according to any one of claims 1 to 34, wherein the recombinant cell further comprises a nucleic acid sequence encoding a protein operably linked to a promoter, wherein the expression of the protein is regulated by a transcriptional regulator of the chimeric polypeptide.

51. The recombinant cell according to claim 50, wherein the protein is heterologous.

52. The recombinant cell according to claim 50 or 51, wherein the protein is a cytokine, a cytotoxin, a chemokine, an immunomodulator, a pro-apoptotic factor, an anti-apoptotic factor, a hormone, a differentiation factor or a dedifferentiation factor.

53. A pharmaceutical composition comprising the recombinant cell according to any one of claims 46 to 52.

54. A method for regulating cell activity, the method comprising: providing a recombinant cell according to any one of claims 46 to 52, the recombinant cell comprising a chimeric polypeptide according to any one of claims 1 to 34; and contacting the recombinant cell with a selected ligand, wherein the binding of the selected ligand to the extracellular binding domain induces cleavage of the ligand-inducible proteolytic cleavage site and releases the transcriptional regulator, wherein the released transcriptional regulator regulates the activity of the recombinant cell.

55. The method according to claim 54, wherein the contacting is carried out in vivo, ex vivo or in vitro.

56. The method according to any one of claims 54 or 55, wherein the activity of the cell is selected from the group consisting of: expression of a selected gene of the cell, proliferation of the cell, apoptosis of the cell, non-apoptotic death of the cell, differentiation of the cell, dedifferentiation of the cell, migration of the cell, secretion of molecules by the cell, cell adhesion of the cell and cytolytic activity of the cell.

57. The method according to any one of claims 54 to 56, wherein the released transcriptional regulator regulates the expression of a gene product of the cell.

58. The method according to claim 57, wherein the released transcriptional regulator regulates the expression of a heterologous gene product.

59. The method according to claim 57 or 58, wherein the gene product of the cell is selected from the group consisting of: chemokines, chemokine receptors, chimeric antigen receptors, cytokines, cytokine receptors, differentiation factors, growth factors, growth factor receptors, hormones, metabolic enzymes, pathogen-derived proteins, proliferation inducers, receptors, RNA-guided nucleases, site-specific nucleases, T cell receptors, toxins, toxin-derived proteins, transcriptional regulatory factors, transcriptional activators, transcriptional repressors, translational regulators, translational activators, translational repressors, activating immune receptors, antibodies, apoptosis inhibitors, apoptosis inducers, engineered T cell receptors, immune activators, immune inhibitors, and inhibitory immune receptors.

60. The method according to any one of claims 54 to 59, wherein the released transcriptional regulatory factor regulates the differentiation of the cell, and wherein the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

61. The method according to any one of claims 54 to 59, wherein the administered recombinant cell regulates the activity of target cells in an individual.

62. The method according to claim 61, wherein the target cell is a cancer cell.

63. The method according to claim 62, wherein the cancer cell is a solid tumor or a hematological malignancy.

64. The method according to claim 63, wherein the hematological malignancy is a multiple myeloma cell.

65. A method for treating a health condition in an individual in need thereof, the method comprising: administering to the individual a first therapy comprising an effective amount of a recombinant cell according to any one of claims 46 to 52, wherein the recombinant cell treats the disease of the individual.

66. The method according to claim 65, wherein the disease is cancer.

67. The method according to claim 66, wherein the cancer is a solid tumor.

68. The method according to claim 66, wherein the cancer is a hematological malignancy.

69. The method according to claim 68, wherein the hematological malignancy is multiple myeloma.

70. The method according to claim 69, further comprising administering to the individual a second therapy.

71. The method according to claim 70, wherein the second therapy is selected from the group consisting of: chemotherapy, radiotherapy, immunotherapy, hormone therapy, and toxin therapy.

72. The method according to any one of claims 65 to 71, wherein the first therapy and the second therapy are administered together, in the same composition or in separate compositions.

73. The method according to claim 72, wherein the first therapy and the second therapy are administered concomitantly.

74. The method according to any one of claims 70 to 73, wherein the first therapy and the second therapy are administered sequentially.

75. The method according to claim 72, wherein the first therapy is administered before the second therapy.

76. A method for inducing T cell signaling and gene regulation in T cells, the method comprising: (a) Provide a vector comprising a chimeric polypeptide according to any one of claims 1-41; and (b) Transduce T cells with the vector, wherein binding of a selected ligand to the extracellular ligand-binding domain of the chimeric polypeptide induces intracellular signal transduction and release of the transcriptional regulator.

77. A system for modulating the activity of a cell, killing target cancer cells, or treating a disease in an individual in need thereof, wherein the system comprises one or more of the following: A chimeric polypeptide according to any one of claims 1 to 34; A recombinant nucleic acid molecule according to any one of claims 40 to 41; A recombinant cell according to any one of claims 46 to 52; and A pharmaceutical composition according to claim 53.

78. A method for producing a recombinant cell according to any one of claims 46 to 52, the method comprising: Providing a cell capable of expressing a protein; and Contacting the provided cell with a recombinant nucleic acid molecule according to any one of claims 40 to 41.

79. Use of one or more of the following for treating a disease: A chimeric polypeptide according to any one of claims 1 to 34; A recombinant nucleic acid molecule according to any one of claims 40 to 41; and A recombinant cell according to any one of claims 46 to 52.

80. The use according to claim 79, wherein the disease is cancer.

81. Use of the invention according to any one of claims 1 to 53 for the preparation of a medicament for treating a disease.

Images