Composition and kit for identifying new coronavirus JN.1 strain and sub-branch XDV thereof

Abstract

The invention relates to the technical field of biology, and discloses a composition and a kit for identifying a new coronavirus JN.1 strain and a sub-branch XDV of the new coronavirus JN.1 strain. The composition provided by the invention can efficiently and accurately identify the JN.1 strain and the XDV strain, and provides a new detection means for medical treatment and scientific research work.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a composition and a kit for identifying SARS-CoV-2 JN.1 strain and its sub-branch XDV. Background Art

[0002] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the pathogen causing a global pandemic. Since its first identification, the virus has undergone multiple mutations, generating multiple different variants. As a sub-branch of the SARS-CoV-2 Omicron BA.2.86 variant, JN.1 was first detected in a sample collected in Luxembourg on August 25, 2023, and has since spread widely. JN.1 contains a signature mutation L455S (T22926C) in the spike protein. The XDV variant is a new branch evolved from the JN.1 variant.

[0003] For the detection of SARS-CoV-2 variants, sequencing methods can provide detailed viral genome information to help identify variant situations. However, sequencing is time-consuming and costly, and cannot be widely used on a large scale in medical and research work. ARMS-PCR (Amplification Refractory Mutation System-PCR), also known as ASA (Allele Specific Amplification), provides a more efficient, simple, and economical solution for detecting known gene mutations. When detecting SARS-CoV-2 variants, especially under the requirement of high-throughput screening and identification, ARMS-PCR shows significant advantages compared with sequencing methods. For the detection of homozygous mutation cases, only one of the primers targeting the wild type and the mutant, respectively, is used in combination with a common 3'-end primer for parallel PCR reactions. Only when the primer completely matches the target DNA can successful extension occur and a PCR amplification product be generated; if there is a mismatch at the 3'-end, the PCR reaction will be effectively blocked. This mechanism ensures that ARMS-PCR achieves a faster, simpler, and more economical detection process while maintaining high accuracy, and is very suitable for the high-throughput screening and identification of SARS-CoV-2 variants.

[0004] Currently, although there are many kinds of detection reagents for SARS-CoV-2 mutations on the market, there are no related detection products that can simultaneously detect the new variants JN.1 and XDV, which limits the effective detection ability of JN.1 and XDV variants in clinical and research work. To address the above challenges, there is an urgent need in the market for an in vitro detection product that can efficiently and accurately identify JN.1 and XDV variants. Summary of the Invention

[0005] The object of the present invention is to overcome the above problems existing in the prior art, and to provide a composition and a kit for identifying the SARS-CoV-2 JN.1 strain and its sub-branch XDV.

[0006] To achieve the above object, on the one hand, the present invention provides a composition for identifying the SARS-CoV-2 JN.1 strain and its sub-branch XDV, and the composition includes primers and probes with the function of detecting the T22926C and G15451A mutations.

[0007] On the second aspect, the present invention provides a kit for identifying the SARS-CoV-2 JN.1 strain and its sub-branch XDV, and the kit includes the composition described in the first aspect.

[0008] On the third aspect, the present invention provides a method for identifying the SARS-CoV-2 JN.1 strain and its sub-branch XDV, and the method includes using the composition described in the first aspect or the kit described in the second aspect to detect a sample.

[0009] Through the above technical solutions, the present invention can at least achieve the following beneficial effects:

[0010] (1) By using the ARMS-PCR technology to detect specific target sequences, the present invention can detect the JN.1 strain and the XDV strain with high stability and high accuracy. Compared with the sequencing method, the detection cost and time consumption are greatly reduced.

[0011] (2) When the composition provided by the present invention detects the T22926C mutation, the G15451A mutation and the corresponding wild type, the Ct difference is large, and the mutant strain and the wild type can be clearly identified. Combined with a specific identification method, it can efficiently and accurately determine whether the sample contains the JN.1 strain and the XDV strain. Description of the Drawings

[0012] Figure 1 It is a detection result diagram of the kit for the SARS-CoV-2 JN.1 strain sample in Example 2.

[0013] Figure 2 It is a detection result diagram of the kit for the SARS-CoV-2 XDV strain sample in Example 2.

[0014] Figure 3 It is a detection comparison diagram of the kit for the T22926C mutation and the wild type target sequence in Example 2.

[0015] Figure 4 It is a detection comparison diagram of the kit for the G15451A mutation and the wild type target sequence in Example 2.

[0016] Figure 5 It is the sensitivity detection result of the T22956C mutation target sequence in Example 2.

[0017] Figure 6 It is the sensitivity detection result of the G15451A mutant target sequence in Example 2.

[0018] Figure 7 It is the sensitivity detection result of the N gene target sequence in Example 2.

[0019] Figure 8 It is the stability and precision detection result of the T22956C mutant target sequence in Example 2.

[0020] Figure 9 It is the stability and precision detection result of the G15451A mutant target sequence in Example 2.

[0021] Figure 10 It is the stability and precision detection result of the N gene target sequence in Example 2.

[0022] Figure 11 It is the detection comparison chart of the T22956C and G15451A mutant target sequences and the corresponding wild-type target sequences using kit D1 in Comparative Example 1.

[0023] Figure 12 It is the detection comparison chart of the T22956C and G15451A mutant target sequences and the corresponding wild-type target sequences using kit D2 in Comparative Example 1. Detailed implementation manners

[0024] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0025] In the research, the inventors of the present invention can efficiently and accurately identify the SARS-CoV-2 JN.1 strain and XDV strain by selecting specific detection target sequences and designing specific primer and probe combinations for the target sequences.

[0026] It should be noted that in the present invention, for the convenience of description, the SARS-CoV-2 genome and target sequences derived from SARS-CoV-2 strains (such as the target sequence with T22926C mutation, the target sequence with G15451A mutation, the target sequence of the N gene, etc.) are all described and provided in the form of cDNA sequences. Those skilled in the art can obtain their corresponding RNA sequences (i.e., the corresponding target sequences in the SARS-CoV-2 genome) according to the base complementary pairing principle.

[0027] In the first aspect of the present invention, a composition for identifying the SARS-CoV-2 JN.1 strain and its sub-branch XDV is provided, and the composition includes primers and probes with the function of detecting the T22926C and G15451A mutations.

[0028] The T22926C mutation refers to the mutation in which the nucleotide at position 22926 of the SARS-CoV-2 genome (cDNA) is mutated from T to C, and the G15451A mutation refers to the mutation in which the nucleotide at position 15451 of the SARS-CoV-2 genome (cDNA) is mutated from G to A.

[0029] According to a preferred embodiment of the present invention, the difference in Ct values between the SARS-CoV-2 strains with the T22926C or G15451A mutation detected by the primers and probes and the SARS-CoV-2 strains without the T22926C and G15451A mutations is not less than 10, preferably not less than 12.

[0030] For example, the difference in Ct values between the SARS-CoV-2 strains with the T22926C or G15451A mutation detected by the primers and probes and the SARS-CoV-2 strains without the T22926C and G15451A mutations can be 10 - 20. For example, it can be 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, or it can also be the range formed by any two of the above values, or any intermediate value within this range.

[0031] Preferably, the primers and probes detect the target region of SEQ ID NO: 17 - 18.

[0032] GTAATTATGATTACTGGTATAGATCGTTAAGGAAGTCTAAACTCA AACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAACA AACCTTGTAAAGGTAAAGGTCCTAATTGTT (SEQ ID NO: 17, target sequence for T22956C mutation)

[0033] TGAAATGGTCATGTGTGGCAGTTCACTATATGTTAAACCAGGTGG AACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAA CATTTGTCAAGCTGTCAC (SEQ ID NO: 18, target sequence for G15451A mutation)

[0034] According to a preferred embodiment of the present invention, the composition comprises the following primer pairs and probes:

[0035] (1) Primer pair and probe for detecting the T22926C mutation: the primer pair of SEQ ID NO: 1-2 and the probe of SEQ ID NO: 3;

[0036] (2) Primer pair and probe for detecting the G15451A mutation: the primer pair of SEQ ID NO: 4-5 and the probe of SEQ ID NO: 6.

[0037] To further improve the detection accuracy, according to a preferred embodiment of the present invention, the composition further comprises primers and probes for detecting an internal control gene and / or a reference gene.

[0038] Preferably, the internal control gene is selected from at least one of the conserved genes or fragments thereof in the genome of the novel coronavirus.

[0039] Any conserved gene or fragment thereof in the genome of the novel coronavirus can be used as the internal control gene in the present invention. According to a preferred embodiment of the present invention, the internal control gene is the N gene or a fragment thereof in the genome of the novel coronavirus.

[0040] Preferably, the nucleotide sequence of the internal control gene is as shown in SEQ ID NO: 19.

[0041] AAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGG GTTGTAACTGAGGGAGCCTTGAATACACCAAAAGATCAC (SEQ ID NO: 19, N gene target sequence)

[0042] Preferably, the reference gene is selected from at least one of the conserved genes or fragments thereof in the human genome.

[0043] Any conserved gene or fragment thereof in the human genome can be used as the reference gene in the present invention. According to a preferred embodiment of the present invention, the reference gene is the endogenous Rnase P gene or a fragment thereof.

[0044] Preferably, the nucleotide sequence of the reference gene is as shown in SEQ ID NO: 20.

[0045] AGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCG GACTTGTGGAGACAGCCGCTC (SEQ ID NO: 20, reference gene target sequence)

[0046] According to a preferred embodiment of the present invention, the composition comprises at least one set of the following primer pairs and probes:

[0047] (3) Primer pair and probe for detecting the internal control gene: primer pair of SEQ ID NO:7-8 and probe of SEQ ID NO:9;

[0048] (4) Primer pair and probe for detecting the reference gene: primer pair of SEQ ID NO:10-11 and probe of SEQ ID NO:12.

[0049] According to a preferred embodiment of the present invention, a reporter group is modified on the (5'-end) of the probe, preferably a fluorescent reporter group. Any fluorescent reporter group commonly used in the art can be applicable to the present invention, for example, it can be at least one of ATTO 425, HEX, FAM, ROX, CY5 and Quasar705.

[0050] Preferably, different reporter genes are modified on the probes for detecting different genes. Preferably, the fluorescent reporter groups modified on the probes for different genes can be detected simultaneously through different channels.

[0051] Preferably, a fluorescent quenching group is further modified on the (3'-end) of the probe. Preferably, the fluorescent quenching group is selected from BHQ1 and / or BHQ2. Those skilled in the art can select the corresponding fluorescent quenching group according to the selected fluorescent reporter group, which will not be elaborated herein.

[0052] According to a preferred embodiment of the present invention, the reagent composition further comprises a negative control reagent and / or a positive control reagent.

[0053] The present invention has no particular limitation on the specific selection of the reagents as the positive control and the negative control, and can be selected according to the conventional techniques in the art. For example, reagents such as physiological saline and buffer solution without the target sequence can be used as the negative control, and internal standard gene pseudovirus, plasmid containing the internal standard gene, etc. can also be used as the negative control. Again, for example, a mixed plasmid containing the corresponding specific gene target sequence, DNA or RNA of the target gene fragment, pseudovirus, etc. can be used as the positive control.

[0054] The second aspect of the present invention provides a kit for identifying the SARS-CoV-2 JN.1 strain and its sub-branch XDV, and the kit comprises the composition described in the first aspect.

[0055] According to a preferred embodiment of the present invention, the kit further includes at least one of an enzyme, a buffer, a magnesium source, and dNTPs(U). dNTPs(U) is a deoxyribonucleoside triphosphate composition formed by further adding deoxyuridine triphosphate (dUTP) on the basis of deoxyribonucleoside triphosphates (dNTPs commonly used in PCR reactions, including deoxyadenosine triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxycytidine triphosphate (dCTP), and deoxyguanosine triphosphate (dGTP)). The present invention has no limitation on the specific source of dNTPs(U), which can be prepared according to the prior art by oneself, or directly purchased or customized through commercial channels.

[0056] Preferably, the enzyme includes DNA polymerase, reverse transcriptase, and UDG enzyme.

[0057] Preferably, the magnesium source includes water-soluble inorganic Mg salts. Any water-soluble inorganic Mg salt can be applicable to the present invention. For example, it can be MgCl 2 .

[0058] More preferably, the kit further includes reagents for nucleic acid extraction and / or purification, and RNase inhibitors.

[0059] In the present invention, the above-mentioned enzyme, buffer, magnesium source, dNTPs(U), etc. can all be obtained by any conventional means in the art. For example, relevant commercial products can be obtained through commercial purchase or customization channels.

[0060] The third aspect of the present invention provides a method for identifying the SARS-CoV-2 JN.1 strain and its sub-branch XDV, the method comprising detecting a sample using the composition described in the first aspect or the kit described in the second aspect.

[0061] The method provided by the present invention can be a diagnostic or non-diagnostic method. For example, the diagnostic method can be to detect a sample using the composition or kit of the present invention to determine whether a patient is infected with the JN.1 or XDV strain. Another example, the non-diagnostic method can be to detect a sample using the composition or kit of the present invention to complete non-diagnostic work such as related research, identification, and detection.

[0062] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain or illustrate the content of the present invention by way of example, and are not used to limit the present invention.

[0063] In the following examples, unless otherwise specified, the reagents and materials used are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and the reagents are all of analytical grade.

[0064] Example 1

[0065] This example is used to illustrate the preparation of the kit provided by the present invention.

[0066] 1. Prepare primers and probes

[0067] Synthesize primers and probes according to the sequences in Table 1.

[0068] Table 1

[0069]

[0070] 2. Prepare the unit reaction reagent set for PCR reaction

[0071] Prepare the corresponding reagents according to the required reagent amounts of the unit reaction reagent set in Table 2 (i.e., the reagent set for detecting 1 sample in 1 PCR reaction).

[0072] Table 2

[0073]

[0074]

[0075] * In Table 2, dNTPs (U) and PCR buffer are both purchased from Hunan Kangde Biotechnology Co., Ltd.; the usage amounts of the upstream primer, downstream primer, and probe are the usage amounts of one sequence respectively.

[0076] 3. Prepare negative control reagent and positive control reagent

[0077] Negative control: Sterile normal saline.

[0078] Positive control: Target sequence mixed plasmid, which is made by inserting the target sequence into the pUC57 vector, and the target sequence is shown in Table 1.

[0079] 4. Prepare the kit

[0080] Match and package the reagents prepared in steps 1 - 3 according to the target detection amount of a single kit.

[0081] Example 2

[0082] This example is used to illustrate the discrimination effect of the kit provided by the present invention on the SARS-CoV-2 JN.1 strain and its sub-branch XDV in samples.

[0083] (I) PCR detection

[0084] The following experiments were tested using samples of the SARS-CoV-2 JN.1 strain and its sub-branch XDV that have been verified by whole-genome sequencing. The samples were sourced from Shengweier Medical Testing Center, and this research has obtained the informed consent of relevant personnel.

[0085] Take 300 μL each of the sample to be tested, negative control, and positive control, and use the nucleic acid extraction and purification reagents of Shengxiang Biotech Co., Ltd. to perform nucleic acid extraction and purification according to the instructions.

[0086] Take 20 μL of the treated sample to be tested, 20 μL of the treated negative control, and 20 μL of the treated positive control and add them to PCR reaction tubes respectively. Add 30 μL of the unit PCR reaction reagent set (for specific components, refer to Table 2) to each tube. After mixing, place them in a fully automatic medical PCR analyzer (Hongshi Medical Technology Co., Ltd., SLAN-96P) and perform PCR reaction according to the reaction conditions in Table 4.

[0087] Table 4

[0088]

[0089] First, refer to the criteria in Table 5 to determine whether the sample contains SARS-CoV-2. When the result shows positive, then refer to the criteria in Table 6 to determine whether the SARS-CoV-2 contained in the sample is strain JN.1 or its branch XDV. In Table 5 and Table 6, "not to be considered" means that when judging the sample, regardless of the detection result of this target, the detection results of other targets can be referred to for judgment.

[0090] Table 5

[0091] N gene Internal control gene Result interpretation Ct ≤ 38 Not to be considered SARS-CoV-2 positive No Ct or Ct > 38 Ct ≤ 35 SARS-CoV-2 negative No Ct or Ct > 38 Ct > 35 The test is invalid and re-sampling is required for testing

[0092] Table 6

[0093]

[0094] The detection results of the samples of SARS-CoV-2 strain JN.1 and XDV samples are respectively as Figure 1 and 2 shown. Referring to the judgment criteria in Table 5 and Table 6, it can be judged that the samples are strain JN.1 and strain XDV respectively. The detection results are consistent with the sequencing results, indicating that the kit containing the primers and probes of the present invention can detect strain JN.1 and strain XDV.

[0095] The detection result of the positive control is consistent with Figure 1-2 that, and no amplification curve is generated for the negative control.

[0096] (2) Detection and comparison between mutant strains and wild types

[0097] Use the target sequences in Table 7 to insert into the pUC57 vector to make simulated samples, and configure the sample detection solution with a copy number of E6 / mL. Detect the sample detection solution according to the method in Experiment (1).

[0098] Table 7

[0099] Target name Target sequence T22926C mutation SEQ ID NO:17 Wild type corresponding to T22926C mutation The 25th nucleotide in SEQ ID NO:17 is replaced by T from C G15451A mutation SEQ ID NO:18 Wild type corresponding to G15451A mutation The 20th nucleotide in SEQ ID NO:18 is replaced by G from A

[0100] The results are as Figure 3 and Figure 4 shown. It can be seen from the figure that when the kit of the present invention is used to detect mutant targets and wild-type targets, there are significant differences in Ct values. The difference in Ct values between the T22926C mutation and the wild-type detection is 13.11, and the difference in Ct values between the G15451A mutation and the wild-type detection is 14.01. Thus, it can be seen that the kit of the present invention can be used to distinguish between the JN.1 strain and the XDV strain.

[0101] (III) Sensitivity test

[0102] The sensitivity (LOD) of each target was detected, and the specific method was as follows:

[0103] Plasmids containing the T22926C mutation, G15451A mutation, and N gene of the target sequence were respectively prepared into concentration gradient dilution solutions, and the concentration gradients were: 50, 200, 500, 5000, 50000 copies / mL. Then, the gradient dilution solutions of each target sequence were respectively detected by the method in experiment (I) to determine the detection limit of each target sequence.

[0104] The detection results of the T22926C mutation, G15451A mutation, and N gene are respectively as Figures 5-7 shown. It can be seen from the figure that each target sequence can be detected at a concentration of 500 copies / mL.

[0105] (IV) Specificity test

[0106] The method in experiment (I) was used to detect other variants of the novel coronavirus (HV.1, HK.3, XDQ.1), coronaviruses (NL63, HKU1, 229E, OC43), influenza A virus, influenza B virus, respiratory syncytial virus, adenovirus, parainfluenza virus, Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Legionella pneumophila, Bordetella pertussis, Staphylococcus aureus, Mycoplasma pneumoniae, and Chlamydia pneumoniae specimens. The specimens were simulated samples prepared by mixing the above pathogens and human blood.

[0107] The results showed that except for the internal reference gene, no amplification curves were generated for other target genes. Thus, it can be seen that the kit of the present invention showed obvious negative detection results for these pathogens.

[0108] (V) Stability and precision test

[0109] Plasmids containing the T22926C mutation, G15451A mutation, and N gene of the target sequence were respectively formulated into strongly positive and weakly positive samples. The strongly positive sample contained 10,000 copies / mL of the target sequence, and the weakly positive sample contained 1,000 copies / mL of the target sequence.

[0110] Using the method in Experiment (III), each sample was detected, and each sample was detected 10 times repeatedly. The detection results of the T22926C mutation, G15451A mutation, and N gene are respectively as Figures 8-10 shown. It can be seen from the figure that the detection rates of the strongly positive and weakly positive samples of each target sequence are both 100%, and the coefficient of variation (CV) of the detection Ct values within and between batches is less than 5%. This shows that the kit containing the primers and probes of the present invention has extremely high stability and precision.

[0111] Comparative Example 1

[0112] The kit was prepared in the same manner as in Example 1, except that the primer-probes for the T22926C mutation and G15451A mutation were replaced with the primers and probes in Table 8 below.

[0113] Table 8

[0114]

[0115] Using the method in Experiment (II) of Example 2, the above kit was used for detection. The detection results of kits D1 and D2 are respectively as Figure 11 and 12 shown.

[0116] It can be seen from the figure that although kit D1 of this comparative example can also detect the T22926C and G16451A mutations, the difference in Ct values between it and the wild type is small, and non-specific amplification results are likely to occur, resulting in a decrease in detection accuracy. Kit D2 has low sensitivity and it is difficult to achieve the high-sensitivity detection target of JN.1 and XDV.

[0117] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A composition for identifying the novel coronavirus JN.1 strain and its subclade XDV, characterized in that: The composition comprises primers and probes capable of detecting T22926C and G15451A mutations.

2. The composition according to claim 1, wherein The difference in Ct value between the primers and probes for detecting a novel coronavirus strain having a T22926C or G15451A mutation and a novel coronavirus strain not having the T22926C and G15451A mutations is not less than 10, preferably not less than 12; Preferably, the primers and probes are directed to the target segment of SEQ ID NO: 17-18 for detection.

3. The composition according to claim 1 or 2, wherein The composition includes the following primer pairs and probes: (1) Primer pair and probe for detecting T22926C mutation: primer pair of SEQ ID NO: 1-2 and probe of SEQ ID NO: 3; (2) Primer pair and probe for detecting the G15451A mutation: primer pair of SEQ ID NO: 4-5 and probe of SEQ ID NO:

6.

4. The composition according to claim 1, wherein The composition also includes primers and probes for detecting internal control genes and / or internal reference genes; Preferably, the internal control gene is selected from at least one of the conserved genes or fragments thereof in the novel coronavirus genome; More preferably, the internal control gene is the N gene or a fragment thereof in the novel coronavirus genome, and preferably the nucleotide sequence of the internal control gene is shown in SEQ ID NO: 19; Preferably, the reference gene is selected from at least one of the conserved genes or fragments thereof in the human genome; More preferably, the internal reference gene is an endogenous RNase P gene or a fragment thereof, and preferably the nucleotide sequence of the internal reference gene is shown in SEQ ID NO:

20.

5. The composition according to claim 4, wherein The composition comprises at least one of the following primer pairs and probes: (3) Primer pairs and probes for detecting the internal control gene: primer pairs of SEQ ID NOs: 7-8 and probes of SEQ ID NO: 9; (4) Primer pair and probe for detecting the internal reference gene: primer pair of SEQ ID NO: 10-11 and probe of SEQ ID NO:

12.

6. The composition according to any one of claims 1 to 5, wherein The probe is modified with a reporter group, preferably a fluorescent reporter group; Preferably, different reporter genes are modified on the probes for detecting different genes.

7. The reagent composition according to any one of claims 1 to 6, wherein The reagent composition also includes a negative control reagent and / or a positive control reagent.

8. A kit for identifying the novel coronavirus JN.1 strain and its subclade XDV, characterized in that: The kit comprises the composition of any one of claims 1-7.

9. The kit according to claim 8, wherein The kit further comprises at least one of an enzyme, a buffer, a magnesium source and dNTPs (U); Preferably, the enzymes include DNA polymerase, reverse transcriptase and UDG enzyme; Preferably, the magnesium source comprises a water-soluble inorganic Mg salt; More preferably, the kit further comprises reagents for nucleic acid extraction and / or purification, and RNase inhibitors.

10. A method for identifying the novel coronavirus JN.1 strain and its subclade XDV, characterized in that: The method comprises using the composition described in any one of claims 1 to 7, or the kit described in claim 8 or 9 to detect the sample.

Images