Application of miR-30a-5p in preparation of product for treating airway stenosis
By using miR-30a-5p in the treatment of airway stenosis, inhibiting airway fibroblast activation and collagen gel contraction, the shortcomings of traditional treatment methods are solved, and the effect of effectively stabilizing tracheal tissue and preventing recurrence is achieved.
Patent Information
- Application Number
- CN202510116573.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-24
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-01-24
AI Technical Summary
The prior art is difficult to effectively treat airway stenosis, traditional surgery has high risk and high possibility of recurrence, and drug treatment effects are limited and accompanied by side effects.
By using miR-30a-5p and/or its mimics, in the preparation of products for treating airway stenosis, the activation of airway fibroblasts is inhibited, the collagen gel contraction capacity is reduced, and extracellular matrix remodeling is improved.
Effectively stabilize the tracheal granulation tissue, prevent airway stenosis and recurrence, improve respiratory function, and improve quality of life.
Smart Images

Figure CN120093775A_ABST
Abstract
Description
[0001] The present invention relates to the field of biotechnology, and in particular to application of miR-30a-5p in preparing products for treating airway stenosis. Background Art
[0002] Airway stenosis is a common respiratory disease that may be caused by a variety of factors, such as inflammation, tumors, trauma or congenital abnormalities, which seriously affect the patient's respiratory function and quality of life. Traditional surgical treatment is suitable for severe stenosis cases, with high risks and the possibility of recurrence. Drug treatments such as bronchodilators and steroid hormones can relieve the symptoms of airway stenosis in the short term, but the long-term effect is limited and accompanied by side effects. New treatments for airway stenosis need to be explored.
[0003] It is currently believed that airway stenosis includes three overlapping stages of development: inflammatory phase, proliferative phase and maturation phase. Initially, airway mucosal damage caused by infection or non-infectious factors releases inflammatory mediators; then, airway fibroblasts (AFs) activate and proliferate to form fresh granulation tissue; finally, airway remodeling and collagen deposition form scar stenosis. AFs are located in the airway wall and are usually in a dormant state, but they will be activated when exposed to inflammatory factors or other stimuli. Activated AFs will rapidly transform into more active myofibroblasts with higher contractile ability. In addition, AFs can synthesize and secrete extracellular matrix proteins such as collagen and elastin, which are essential for maintaining the integrity of airway structure. After airway injury, fibroblasts will migrate to the damaged area and participate in the repair process of tissue. However, abnormal activation of fibroblasts may lead to airway fibrosis, which is an important factor in airway stenosis. Airway stenosis may be caused by chronic inflammation, infection or excessive activity of fibroblasts after injury. This excessive fibrosis process will lead to thickening and hardening of the airway wall, eventually causing airway stenosis, manifested as symptoms such as dyspnea.
[0004] miRNA is a type of small non-coding RNA with a length of about 20 to 25 nucleotides. It inhibits gene expression by complementary pairing with target mRNA at the post-transcriptional level. Studies have found that changes in miRNA expression are closely related to physiological processes such as proliferation, differentiation, apoptosis, and ECM synthesis. However, there are few reports on the functional mechanism of miRNA in airway fibroblasts. Summary of the invention
[0005] In order to solve the above problems existing in the prior art, the present invention provides the use of miR-30a-5p in preparing a product for treating airway stenosis.
[0006] The first object of the present invention is to provide the use of miR-30a-5p and / or its mimetics in the preparation of products for treating airway stenosis.
[0007] The second object of the present invention is to provide the use of miR-30a-5p and / or its mimetics in the preparation of products for inhibiting the activation of airway fibroblasts.
[0008] The third object of the present invention is to provide the use of miR-30a-5p and / or its mimetics in the preparation of a product for reducing the collagen gel contraction ability of airway fibroblasts.
[0009] The fourth object of the present invention is to provide the use of miR-30a-5p and / or its mimetics in the preparation of products for improving the extracellular matrix remodeling of airway fibroblasts.
[0010] The fifth object of the present invention is to provide the use of miR-30a-5p and / or its mimetics in the preparation of an agent for inhibiting the expression of FAP gene and / or FAP protein.
[0011] A sixth object of the present invention is to provide use of an agent for inhibiting the expression of FAP gene and / or FAP protein in the preparation of a product for treating airway stenosis.
[0012] The seventh object of the present invention is to provide an agent for inhibiting the expression of FAP gene and / or FAP protein for use in the preparation of any one or more products for inhibiting the activation of airway fibroblasts, reducing the collagen gel contraction ability of airway fibroblasts, or improving the extracellular matrix remodeling of airway fibroblasts.
[0013] The eighth object of the present invention is to provide the use of extracellular vesicles containing miR-30a-5p and / or its mimetics in the preparation of products for treating airway stenosis.
[0014] The ninth objective of the present invention is to provide the use of extracellular vesicles containing miR-30a-5p and / or its mimics in the preparation of any one or more products for inhibiting airway fibroblast activation, reducing the collagen gel contraction ability of airway fibroblasts, or improving the extracellular matrix remodeling of airway fibroblasts.
[0015] In order to achieve the above object, the present invention is implemented by the following scheme:
[0016] The present invention discovered that miR-30a-5p is highly enriched in extracellular vesicles derived from airway basal cells. This miRNA is transmitted to airway fibroblasts via extracellular vesicles to play multiple regulatory roles, inhibit the activation of airway fibroblasts and improve extracellular matrix remodeling. It is an important bioactive molecule for the treatment of airway stenosis.
[0017] Therefore, the present invention requests protection for the following:
[0018] Use of miR-30a-5p and / or its mimetics in preparing products for treating airway stenosis.
[0019] Use of miR-30a-5p and / or its mimics in preparing products for inhibiting airway fibroblast activation.
[0020] Use of miR-30a-5p and / or its mimics in preparing products for reducing the collagen gel contraction ability of airway fibroblasts.
[0021] Use of miR-30a-5p and / or its mimics in preparing products for improving extracellular matrix remodeling of airway fibroblasts.
[0022] Use of miR-30a-5p and / or its mimics in preparing reagents for inhibiting the expression of FAP gene and / or FAP protein.
[0023] The present invention also found that miR-30a-5p targetedly regulates the transcription and protein expression of the FAP gene. Therefore, the present invention also requests protection for the following:
[0024] Use of an agent for inhibiting the expression of FAP gene and / or FAP protein in the preparation of a product for treating airway stenosis, wherein the agent for inhibiting the expression of FAP gene and / or FAP protein comprises miR-30a-5p and / or its mimics.
[0025] The use of an agent that inhibits the expression of the FAP gene and / or FAP protein in the preparation of any one or more products for inhibiting the activation of airway fibroblasts, reducing the collagen gel contraction ability of airway fibroblasts, or improving the extracellular matrix remodeling of airway fibroblasts, wherein the agent that inhibits the expression of the FAP gene and / or FAP protein includes miR-30a-5p and / or its mimics.
[0026] Use of extracellular vesicles containing miR-30a-5p and / or its mimics in preparing products for treating airway stenosis.
[0027] Use of extracellular vesicles containing miR-30a-5p and / or its mimics in the preparation of any one or more products for inhibiting airway fibroblast activation, reducing the collagen gel contraction ability of airway fibroblasts, or improving the extracellular matrix remodeling of airway fibroblasts.
[0028] As a preferred embodiment, the nucleotide sequence of miR-30a-5p is shown in SEQ ID NO:4.
[0029] As a preferred embodiment, the nucleotide sequence of the miR-30a-5p mimic is shown in SEQ ID NO: 7-8.
[0030] As a preferred embodiment, the extracellular vesicles are extracellular vesicles derived from airway basal cells.
[0031] As a more preferred embodiment, the method for preparing extracellular vesicles comprises the following steps: collecting the cell supernatant of cultured airway basal stem cells, and isolating the extracellular vesicles.
[0032] As a preferred embodiment, the airway stenosis is benign airway stenosis.
[0033] Compared with the prior art, the present invention has the following beneficial effects:
[0034] The present invention discovered the important regulatory role of miR-30a-5p between airway basal stem cells and airway fibroblasts. Through the transport of extracellular vesicles, miR-30a-5p is transferred from airway basal stem cells to airway fibroblasts, and the expression of the key gene FAP is targeted and regulated, thereby inhibiting the activation of airway fibroblasts, reducing the collagen gel contraction ability of airway fibroblasts, and improving the extracellular matrix remodeling of airway fibroblasts. It can effectively stabilize tracheal granulation tissue and prevent the recurrence of airway stenosis, and has application value for the treatment of airway stenosis. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 HE and fluorescence in situ hybridization were used to detect the localization of miR-30a-5p in human airway tissues. Normal refers to normal airway tissue samples, and BTS refers to stenotic airway tissue samples.
[0036] Figure 2 A is the identification result of BSC-EVs; A is the identification result of TEM; B is the identification result of NanoFCM; C is the identification result of WB, BSC represents the total protein sample of BSCs, and N1~N3 represent 3 total protein samples of BSC-EVs prepared in parallel.
[0037] Figure 3 The expression of miR-30a-5p in airway fibroblasts of BTS treated with PBS or BSC-EVs was detected by RT-qPCR, *p<0.05.
[0038] Figure 4 RT-qPCR was used to detect the transfection effect of miR-30a-5p mimics and inhibitors, ***p<0.001.
[0039] Figure 5 Relative luciferase activity analysis results of the control group, FAP 3'UTR WT group and FAP 3'UTR MUT group, **p<0.01, ns indicates p≥0.05.
[0040] Figure 6The results of immunofluorescence identification of primary airway fibroblasts.
[0041] Figure 7 This is the treatment flow chart of the BSC-EVs+NC inhibitors group and the BSC-EVs+miR-30a-5p inhibitors group.
[0042] Figure 8 Figure 3 FAP cell immunofluorescence detection and collagen contraction experiment results of airway fibroblasts in BSC-EVs group, Blank group, BSC-EVs+NC inhibitors group and BSC-EVs+miR-30a-5 inhibitors group; A is the fluorescence staining image and gel image; B is the statistical result of FAP positive cell rate in A; C is the statistical result of gel area in A.
[0043] Fig. 9 Schematic diagram of the process for constructing a co-culture system of airway basal stem cells (BSCs) and airway fibroblasts (AFs).
[0044] Fig.10 The expression levels of miR-30a-5p in airway fibroblasts of NC inhibitors+DMSO group, NC inhibitors+GW4869 group, miR-30a-5p inhibitors+DMSO group, and miR-30a-5p inhibitors+GW4869 group were detected by qRT-PCR. *p<0.05, ns indicates p≥0.05.
[0045] Fig.11 The relative mRNA expression levels of FAP in airway fibroblasts of NC inhibitors+DMSO group, NC inhibitors+GW4869 group, miR-30a-5p inhibitors+DMSO group, and miR-30a-5p inhibitors+GW4869 group were detected by qRT-PCR. *p<0.05, ns indicates p≥0.05.
[0046] Fig.12 These are the results of FAP cell immunofluorescence detection and collagen contraction experiment of airway fibroblasts in the NC inhibitors+DMSO group, NC inhibitors+GW4869 group, miR-30a-5p inhibitors+DMSO group, and miR-30a-5p inhibitors+GW4869 group.
[0047] Fig.13The transcription levels of related genes in airway fibroblasts of NC inhibitors+DMSO group, NC inhibitors+GW4869 group, miR-30a-5p inhibitors+DMSO group and miR-30a-5p inhibitors+GW4869 group were detected by qRT-PCR. A to F are MMP1, MMP2, MMP3, MMP7, MMP9 and COL1A2, **p<0.01, ***p<0.001, ns means p≥0.05.
[0048] Fig.14 WB was used to detect the protein levels of cell activation-related proteins (FAP, α-SMA and Collagen I) and extracellular matrix remodeling-related proteins (MMP2, MMP7, MMP9, TIMP1, TIMP2 and TIMP3) in airway fibroblasts in the NC inhibitors+DMSO group, NC inhibitors+GW4869 group, miR-30a-5p inhibitors+DMSO group and miR-30a-5p inhibitors+GW4869 group.
[0049] Fig.15 These are the survival analysis results of BSC-EVs intervention in the animal model of benign airway stenosis.
[0050] Fig.16 This is the evaluation of the efficacy of BSC-EVs intervention in the animal model of benign airway stenosis; from left to right: bronchoscopic manifestations, HE staining and MASSON staining results.
[0051] Fig.17 These are the WB detection results of airway tissue in the animal model of benign airway stenosis treated with BSC-EVs. A is the WB band graph, and B is the statistical results of the protein expression of Collagen I, FAP, MMP2, MMP3, MMP9, TIMP1 and TIMP2. DETAILED DESCRIPTION
[0052] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.
[0053] Example 1 Localization and expression of miR-30a-5p in normal and narrow airway epithelial tissues of humans
[0054] 1. Preparation of paraffin sections of airway tissue
[0055] With the informed consent of the subjects, normal airway tissue samples (Normal) and stenotic airway tissue samples (BTS) were collected from the clinic, embedded in paraffin, and sliced to obtain paraffin sections of normal airway tissue samples (referred to as normal tissue sections) and paraffin sections of stenotic airway tissue samples (referred to as stenotic tissue sections).
[0056] 2. Dewaxing and hydration
[0057] Place normal tissue sections and stenotic tissue sections in a 65°C oven for 2 hours, take them out while hot, and dewax and hydrate them according to the following conditions: TO, 10 min × 2 times; 100% ethanol, 5 min × 2 times; 95% ethanol, 5 min × 1 time; 80% ethanol, 5 min × 1 time; 75% ethanol, 5 min × 1 time; pure water, 5 min × 2 times.
[0058] 2. HE staining
[0059] HE staining was performed on normal tissue sections and stenotic tissue sections after dewaxing and hydration. The specific operation steps are as follows: first, the tissue sections were placed in hematoxylin staining solution (Sevier, China) for staining for 5 minutes; the stained tissue sections were rinsed with running water for 5 minutes; the rinsed tissue sections were placed in hematoxylin color separation solution (Sevier, China) for differentiation for 5 seconds to selectively decolorize over-stained nuclei and tissue components that should not be stained; the differentiated tissue sections were rinsed with running water for 1 minute, then placed in blueing solution (Sevier, China) for blueing for 5 seconds and then rinsed with running water for 1 minute; the sections were placed in eosin (alcohol-soluble) staining solution (Sevier, China) for staining for 5 minutes; and the sections were rinsed with running water for 5 minutes.
[0060] 3. Fluorescence in situ hybridization (FISH)
[0061] Perform digoxigenin fluorescence in situ hybridization on dewaxed and hydrated normal tissue sections and stenotic tissue sections. The specific steps are as follows:
[0062] (1) Digestion: According to the length of tissue fixation time, boil the tissue sections in the repair solution for 10 minutes and cool naturally; then draw circles with a tissue marker, and according to the different characteristics of different tissues, add proteinase K (20ug / ml) to the tissue sections and digest at 37℃ for 30min; rinse with pure water, and then wash with PBS three times, 5min each time.
[0063] (2) Block endogenous peroxidase: Add 3% methanol-H 2 O 2 , incubate at room temperature in the dark for 15 min, place the slides in PBS (PH 7.4) and wash on a decolorizing shaker 3 times, 5 min each time.
[0064] (3) Prehybridization: Add prehybridization solution to the tissue sections and incubate at 37°C for 1 h.
[0065] (4) Hybridization: Pour off the pre-hybridization solution, add the hybridization solution containing the miR-30a-5p probe to the tissue section, and hybridize overnight. The probe sequence is: miR-30a-5p: 5'-CTTCCAGTCGAGGATGTTTACA-3' (SEQ ID NO: 1).
[0066] (5) Post-hybridization washing: Wash away the hybridization solution and wash the tissue sections with 2×SSC at 37°C for 10 min; then wash twice with 1×SSC at 37°C, 5 min each time; finally wash with 0.5×SSC at room temperature for 10 min.
[0067] (6) Blocking: Add normal rabbit serum to the tissue sections and block at room temperature for 30 min.
[0068] (7) Add mouse anti-digoxigenin-labeled peroxidase (anti-DIG-HRP): Pour off the blocking solution and add anti-DIG-HRP to the tissue sections; incubate at 37°C for 50 min; wash three times with PBS, 5 min each time.
[0069] (8) Add FITC-TSA: Add FITC-TSA reagent to the tissue sections and react at room temperature in the dark for 5 min; wash with TBST three times, 10 min each time; and wash with PBS for 5 min.
[0070] (9) DAPI counterstaining and sealing: Add DAPI staining solution to the tissue sections, incubate in the dark for 8 min, rinse, and then add anti-fluorescence quenching sealing agent to seal the sections.
[0071] 4. Results Analysis
[0072] The results of HE staining and FISH staining are shown in Figure 1 As shown, miR-30a-5p is more widely expressed in normal airway epithelial tissue than in stenotic airway tissue.
[0073] Example 2 High expression of miR-30a-5p in an animal model after treatment with extracellular vesicles of normal human-derived airway basal layer stem cells
[0074] 1. Sample collection and sequencing
[0075] Airway basal stem cells (BSCs) from 6 healthy individuals were collected for culture, and the extracellular vesicles in the cell culture supernatant were isolated by ultracentrifugation and recorded as BSC-EVs. Figure 2As shown in A to C in Figure 1, BSC-EVs present a typical cup-shaped vesicle structure with an average diameter of about 70 nm, expressing exosome marker proteins CD9, CD63, CD81, HSP70 and TSG101. Transcriptome sequencing analysis of BSC-EVs was then performed (Guangzhou Kidio Company), and it was found that miR-30a-5p was significantly highly expressed in them.
[0076] 2. Construction of the benign airway stenosis rabbit model (BTS)
[0077] New Zealand white rabbits (male or female, weighing about 3±0.2 kg) were given general anesthesia, and lidocaine was sprayed on the epiglottis. A hard nylon brush (0.2 mm bristle diameter, 6 mm outer diameter, 2 cm hair area) was placed through the tracheal tube, and the brush head of the nylon brush was extended outside the tracheal tube. The tracheal inner wall was quickly rotated and scraped 10 times to cause airway injury. The nylon brush was then pulled out and the injury was immediately observed under a bronchoscope. Epinephrine was given after the operation to stop bleeding, and BTS was constructed. The day the above operation was completed was recorded as the first day of modeling.
[0078] 3. Treatment of BTS
[0079] On the 3rd and 5th day of modeling, BTS were given airway secretion and necrosis removal treatment. On the 7th day of modeling, fresh granulation tissue was observed in the airway of BTS under bronchoscope. At this time, 100 μL of 6×10 10 The suspension of particle BSC-EVs was resuspended in 500μL of saline to obtain 600μL of BSC-EVs injection solution, which was injected into the granulation tissue of the inner wall of the BTS airway under bronchoscope for 3 times (i.e. 200μL each time), and a total of three injection points were injected, which were recorded as the BSC-EVs treatment group (i.e. BSC-EVs group). The BTS injected with an equal volume of saline solution under bronchoscope was used as the control group (i.e. PBS group). The two groups of rabbits were then kept until the 42nd day of modeling.
[0080] 4. Real-time quantitative PCR (RT-qPCR)
[0081] After the experiment, the airway tissue miRNA of the PBS group and the BSC-EVs group was extracted using a cell / tissue miRNA extraction kit (Yisheng, China), and reverse transcribed using a tailing kit (miRNA first-strand cDNA synthesis reagent, Bioengineering, China). Then, RT-qPCR was performed using a MicroRNAs qPCR kit (Biogen, China) to detect the relative expression of miR-30a-5p in the two groups of cells. The relative expression of miRNA was standardized using U6 and 2 -ΔΔCtThe sequence of the upstream detection primer of U6 is 5'-CGCTTCGGCAGCACATATAC-3' (SEQ ID NO: 2), the sequence of the upstream detection primer of hsa-miR-30a-5p is 5'-CGCTGTAAACATCCTCGACTGGAAG-3' (SEQ ID NO: 3), and the downstream detection primers of U6 and hsa-miR-30a-5p are the universal downstream primers of the tailing method provided in the kit.
[0082] 5. Results Analysis
[0083] like Figure 3 As shown, compared with the PBS group, the expression of miR-30a-5p in the BSC-EVs group was significantly upregulated, indicating that BSC-EVs rich in miR-30a-5p can deliver miR-30a-5p to the airway tissue of animals, causing high expression of miR-30a-5p in airway tissue samples of BTS after treatment.
[0084] Example 3 Preparation of miR-30a-5p mimics and inhibitors
[0085] 1. Design and synthesis of miR-30a-5p mimics and inhibitors
[0086] Based on the nucleotide sequence of human miR-30a-5p (5'-UGUAAACAUCCUCGACUGGAAG-3' (SEQ ID NO:4)), NC mimics (Sense: 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO:5), Antisense: 5'-ACGUGACACGUUCGGAGAATT (SEQ ID NO:6)), hsa-miR-30a-5p mimics (Sense: 5'-UGUAAACAUCCUCGACUGGAAG-3' (SEQ ID NO:7), Antisense: 5'-UCCAGUCGAGGAUGUUUACAUU-3' (SEQ ID NO:8)), NC inhibitors (5'-CAGUACUUUUGUGUAGUACAA-3' (SEQ ID NO:9)) and hsa-miR-30a-5p were designed and synthesized. inhibitors (5'-CUUCCAGUCGAGGAUGUUUACA-3' (SEQ ID NO: 10)).
[0087] Regarding the description of SEQ ID NOs: 1 to 10 in the sequence listing of the specification: According to the editing rules of the WIPO Sequence software, the nucleotide sequence must only contain the symbols listed in "Part 1 of Annex I to WIPOST.26", and the base "t" is "u" in the RNA sequence, so SEQ ID NOs: 1 to 10 in the specification of the present invention are substantially the same as SEQ ID NOs: 1 to 10 in the sequence listing.
[0088] 2. Identification of transfection effect
[0089] BSCs from healthy subjects were obtained according to the method of Example 1. When the BSCs grew to a confluency of 70%, NC mimics, hsa-miR-30a-5p mimics, NC inhibitors and hsa-miR-30a-5p inhibitors were transfected into BSCs using the lipo 3000 kit, respectively. 24 h after transfection, the relative expression level of miR-30a-5p in BSCs was detected according to the RT-qPCR method in Example 1.
[0090] like Figure 4 As shown, compared with BSCs transfected with NC mimics, the expression of miR-30a-5p in BSCs transfected with miR-30a-5p mimics was significantly increased; compared with BSCs transfected with NC inhibitors, the expression of miR-30a-5p in BSCs transfected with miR-30a-5p inhibitors was significantly decreased, indicating that transfection with hsa-miR-30a-5p mimics successfully overexpressed miR-30a-5p, and transfection with hsa-miR-30a-5 inhibitors successfully inhibited the expression of miR-30a-5p.
[0091] Example 4: Targeted regulation of airway fibroblast activation protein (FAP) by miR-30a-5p
[0092] 1. Construction of dual luciferase reporter vector
[0093] pmirGLO Dual-Luciferase miRNA Target Expression Vector (denoted as pmirGLOVector) simultaneously expresses Firefly Luciferase and Renilla Luciferase. The miRNA target gene is constructed into the 3' end of the Firefly Luciferase gene. The effective miRNA sequence binds to the 3'-UTR seed region of the target gene through incomplete base complementarity, thereby causing target gene mRNA degradation or directly inhibiting protein expression and translation, which is detected as the weakening of the fluorescence of the Firefly Luciferase substrate.
[0094] Using pmirGLO Vector as the backbone vector, the 3'-UTR sequence of the FAP gene (5'-ttttattttttatgttgtaaaatgctagtataaacaaacaaattaatgttgttctaaaggctgttaaaaaaaagatgaggactcagaagttcaagctaaat atTGTTTACAttttctggtactctgtgaaagaagagaaaagggagtcatgcattttgctttggacacagtgttttatcacctgttcatttgaagaaaaata ataaa-3' (SEQ ID NO:11)) was connected to pmirGLO Vector to construct the h-FAP-miR-30a-5p-wt vector; the 3'-UTR mutant sequence of the FAP gene (5'-ttttatttttatgttgtaaaatgctagtataaacaaacaaattaatgttgttctaaaggctgttaaaaaaaagatgaggactcagaagttcaagctaaatatAC AAATGTttttctggtactctgtgaaagaagagaaaagggagtcatgcattttgctttggacacagtgttttatcacctgttcatttgaagaaaaataataaa-3' (SEQ ID NO:12)) was connected to pmirGLO Vector to construct the h-FAP-miR-30a-5p-mut vector.
[0095] 2. Cell transfection
[0096] 293T cells were cultured, and when the cells were in good growth state and the growth density reached 70%, transient transfection was performed using the lipo 3000 kit. NC mimics or hsa-miR-30a-5p mimics in Example 3 were co-transfected with pmirGLO Vector into 293T cells, and the resulting cells were recorded as the control group. NC mimics or hsa-miR-30a-5p mimics were co-transfected with h-FAP-miR-30a-5p-wt vector into 293T cells, and the resulting cells were recorded as the FAP 3'UTR WT group. NC mimics or hsa-miR-30a-5p mimics were co-transfected with h-FAP-miR-30a-5p-mut vector into 293T cells, and the resulting cells were recorded as the FAP 3'UTR MUT group.
[0097] 3. Detection and analysis
[0098] The transfected cells were detected using the Dual-Luciferase Reporter Gene Assay Kit (Yisheng, China).
[0099] like Figure 5 As shown, miR-30a-5p can downregulate the relative luciferase activity of h-FAP-miR-30a-5p-wt vector, but has no effect on the relative luciferase activity of h-FAP-miR-30a-5p-mut vector. The results showed that miR-30a-5p can target the 3'UTR region of FAP, FAP is a downstream target gene of miR-30a-5p, and miR-30a-5p can inhibit the expression of FAP.
[0100] Example 5 Functional verification of miR-30a-5p on primary airway fibroblasts in airway stenosis
[0101] 1. Isolation of airway fibroblasts (AFs)
[0102] Airway epithelium of patients with airway stenosis was brushed and airway fibroblasts (AFs) were isolated by differential centrifugation. They were cultured with DMEM complete medium until the growth density reached 70%. Immunofluorescence identification was performed using the primary antibodies: a-SMA antibody (ab7817, 1:200) and Ki67 antibody (1:200, Abcam, ab15580). The results are as follows: Figure 6 As shown, a-SMA protein is abundantly expressed in the cytoplasm and Ki67 protein is abundantly expressed in the nucleus, which is consistent with the typical characteristics of airway fibroblasts, indicating that the airway fibroblasts were successfully isolated.
[0103] 2. Treatment of AFs
[0104] When the growth density of AFs reached 70%, 2×10 4 BSC-EVs with a density of 70% were added to the AFs, which were marked as the Blank group and cultured for 30 h before subsequent testing.
[0105] like Figure 7 As shown, 2×10 4 BSC-EVs with a concentration of particles / cell were cultured for 6 h, and then NC inhibitors or miR-30a-5p inhibitors were added. The obtained cells were respectively recorded as BSC-EVs+NC inhibitors group and BSC-EVs+miR-30a-5p inhibitors group; after 24 h of culture, subsequent detection was carried out.
[0106] 3. FAP cell immunofluorescence and collagen contraction assay
[0107] (1) Immunofluorescence
[0108] Immunofluorescence detection of AFs in the BSC-EVs group, Blank group, BSC-EVs+NC inhibitors group, and BSC-EVs+miR-30a-5 inhibitors group was performed. The specific steps were as follows: wash the cells with PBS three times; fully cover the cells with 4% paraformaldehyde, fix at room temperature for 15 minutes, wash with PBST three times, each time for 5 minutes; cover the cells with 0.1% Triton X-100 and incubate at room temperature for 20 minutes, wash with PBST three times, each time for 5 minutes; the slices should be placed in a humidified box, completely cover the samples with 5% BSA, and incubate at room temperature for 60 minutes; Dilute the primary antibody (FAP antibody, CST66562, dilution ratio 1:50) with BSA blocking solution, cover the sample after mixing, and incubate at 4°C overnight; after rewarming at room temperature the next day, wash 3 times with PBST, 5 minutes each time; use anti-rabbit fluorescent secondary antibody (ab150077), incubate at room temperature in the dark for 1 hour, wash 3 times with PBST, 5 minutes each time; use absorbent paper to dry the residual liquid, add DAPI / anti-fading agent two-in-one sealing solution, cover with coverslip to avoid bubbles. Observe the staining results under a fluorescence microscope and take pictures for record.
[0109] (2) Collagen contraction test
[0110] AFs in the BSC-EVs group, Blank group, BSC-EVs+NC inhibitors group, and BSC-EVs+miR-30a-5 inhibitors group were digested, suspended in DMEM medium, and mixed with 3 mg / mL rat tail type I collagen (Corning, USA) at a volume ratio of 2:1. Then solidified at 37°C for 2 hours. Subsequently, 1 mL of DMEM complete medium was added to the wells and cultured for 8 hours. The collagen gel formation of airway fibroblasts in each group was observed and photographed, measured with Image J software, and the area of collagen gel in each group was calculated using the formula: gel area (%) = x / n*100% (x = area of each group containing cells, n = area of the well).
[0111] (3) Results analysis
[0112] like Figure 8 As shown in A to C in Figure 1, compared with the Blank group, the expression of FAP in AFs of the BSC-EVs or BSC-EVs+NC inhibitors groups was reduced, and the collagen area was increased; this effect could be reversed by miR-30a-5p inhibitors. This indicates that BSCs can inhibit the activation of airway fibroblasts, and miR-30a-5p plays an important role in this anti-fibrotic effect.
[0113] Based on the above results of this example, it is shown that miR-30a-5p can regulate the activation of airway fibroblasts, collagen gel contraction and extracellular matrix remodeling, and play this regulatory function in the anti-fibrosis effect mediated by BSC-EVs.
[0114] Example 6 Functional evaluation of human airway basal stem cell extracellular vesicles containing miR-30a-5p on primary airway fibroblasts in airway stenosis
[0115] 1. Construction of co-culture system
[0116] In this example, a co-culture system of airway basal stem cells (BSCs) and airway fibroblasts (AFs) was constructed. The process is as follows: Fig. 9 As shown, the specific steps are as follows:
[0117] (1) BSCs isolation, culture and transfection
[0118] BSCs from healthy people were obtained according to the method of Example 5 and inoculated into the upper chamber of a Transwell culture plate (Cat. No. 3470, Corning). When the BSCs grew to a confluency of 70%, the NC inhibitors or hsa-miR-30a-5p inhibitors in Example 3 were transfected into the BSCs using a lipo 3000 kit, and the obtained cells were recorded as the NC inhibitor group and the hsa-miR-30a-5p inhibitor group, respectively. The culture was continued for 24 h.
[0119] (2) Isolation and culture of AFs
[0120] AFs from the airway stenosis of patients with airway stenosis were obtained according to the method of Example 1 and inoculated into the lower chamber of a Transwell culture plate. The culture was continued for 6 hours.
[0121] (3) Co-culture
[0122] GW4869 (an extracellular vesicle secretion inhibitor) was added to the upper chamber of the NC inhibitors group at a final concentration of 10 μM, and then it was combined with the lower chamber of the AFs for co-culture. The resulting cells were recorded as the NC inhibitors + GW4869 group. DMSO with an equal volume of GW4869 was added to the upper chamber of the NC inhibitors group, and then it was combined with the lower chamber of the AFs for co-culture. The resulting cells were recorded as the NC inhibitors + DMSO group. GW4869 was added to the upper chamber of the miR-30a-5 inhibitors group at a final concentration of 10 μM, and then it was combined with the lower chamber of the AFs for co-culture. The resulting cells were recorded as the miR-30a-5p inhibitors + GW4869 group. An equal volume of DMSO was added to the upper chamber of the miR-30a-5p inhibitors group, and then combined with the lower chamber of the AFs group for co-culture. The resulting cells were recorded as the miR-30a-5p inhibitors+DMSO group.
[0123] Subsequent detection was performed after the four groups of cells were co-cultured for 24 hours.
[0124] 2. Determination of relative expression of miR-30a-5p
[0125] The relative expression of miR-30a-5p in the lower chamber AFs of each group was detected by RT-qPCR method in Example 1. The results are as follows Fig.10As shown, compared with the NC inhibitors+DMSO group, the expression level of miR-30a-5p in AFs of the miR-30a-5p inhibitors+DMSO group was significantly downregulated, indicating that the expression of miR-30a-5p in BSCs was successfully inhibited; compared with the NC inhibitors+GW4869 group, the expression level of miR-30a-5p in AFs of the miR-30a-5p inhibitors+GW4869 group was significantly downregulated, and was equivalent to the expression level of miR-30a-5p in AFs of the miR-30a-5p inhibitors+DMSO group, indicating that inhibiting the release of extracellular vesicles from BSCs can inhibit the transmission of miR-30a-5p from BSCs to AFs.
[0126] 3. Determination of FAP transcription level
[0127] The total RNA of AFs in the lower chamber of each group was extracted using the TransZol Up Plus RNA Kit (Quanshijin, China). Ⅲ The first-strand cDNA synthesis supermix kit was used for reverse transcription to obtain a cDNA template. The relative expression of FAP mRNA was detected according to the RT-qPCR method in Example 1, and GAPDH was used for standardization. The upstream detection primer sequence of GAPDH is: 5'-GTGGACCTGACCTGCCGTCTAG-3' (SEQ ID NO: 13), and the downstream detection primer sequence is: 5'-GAGTGGGTGTCGCTGTTGAAGTC-3' (SEQ ID NO: 14); the upstream detection primer sequence of FAP is: 5'-CAAAGGCTGGAGCTAAGAATCC-3' (SEQ ID NO: 15), and the downstream detection primer sequence is: 5'-ACTGCAAACATACTCGTTCATCA-3' (SEQ ID NO: 16).
[0128] The results are as follows Fig.11 As shown in the figure, compared with the NC inhibitors+DMSO group, the transcription level of FAP in the lower chamber AFs of the miR-30a-5p inhibitors+DMSO group was significantly increased; compared with the NC inhibitors+GW4869 group, the transcription level of FAP in the AFs of the miR-30a-5p inhibitors+GW4869 group was significantly increased, and was equivalent to the transcription level of FAP in the AFs of the miR-30a-5p inhibitors+DMSO group. This indicates that miR-30a-5p in BSCs is transferred to AFs through extracellular vesicles to inhibit the transcriptional expression of FAP.
[0129] 4. FAP cell immunofluorescence and collagen contraction assay
[0130] According to the method in Example 5, FAP immunofluorescence and collagen contraction in the lower chamber AFs of each group were detected.
[0131] Fig.12 As shown in the figure, compared with the NC inhibitors+DMSO group, the expression of FAP in AFs of the miR-30a-5p inhibitors+DMSO group increased, and the contraction ability of collagen gel was enhanced; compared with the NC inhibitors+GW4869 group, the expression level of FAP in AFs of the miR-30a-5p inhibitors+GW4869 group increased significantly, and the contraction ability of collagen gel was enhanced, which was comparable to the contraction ability of AFs of the miR-30a-5p inhibitors+DMSO group. This indicates that miR-30a-5p in BSCs is transferred to AFs through extracellular vesicles to inhibit the expression of FAP protein, inhibit the activation of AFs, and weaken the contraction ability of collagen gel of AFs.
[0132] 5. Determination of the transcriptional levels of matrix metalloproteinases (MMPs) and type Ⅰ collagen (COL1A2)
[0133] According to the method of this example, total RNA of AFs in the lower chamber of each group was extracted, and cDNA template was obtained by reverse transcription. The relative expression levels of mRNA of MMPs (MMP1, MMP2, MMP3, MMP7, MMP9) and COL1A2 were detected by RT-qPCR method, and GAPDH was used for standardization. The upstream detection primer sequence of MMP1 is: 5'-ACTGCTGCTGCTGCTGTTCTG-3' (SEQ ID NO: 17), and the downstream detection primer sequence is: 5'-TGCCTCCCATCATTCTTCAGGTTG-3' (SEQ ID NO: 18); the upstream detection primer sequence of MMP2 is: 5'-CACTGTTGGTGGGAACTCAGAAGG-3' (SEQ ID NO: 19), and the downstream detection primer sequence is: 5'-GGTCATCATCGTAGTTGGCTGTGG-3' (SEQ ID NO: 20); the upstream detection primer sequence of MMP3 is: 5'-GCATCCCGAAGTGGAGGAAAACC-3' (SEQ ID NO: 21), and the downstream detection primer sequence is: 5'-AGCCTGGAGAATGTGAGTGGAGTC-3' (SEQ ID NO: 22); the upstream detection primer sequence of MMP7 is: 5'-ACCGTGCTGTGTGCTGTGTG-3' (SEQ ID NO:23), the downstream detection primer sequence is: 5'-TCCTGAGCCTGTTCCCACTGTAG-3' (SEQ ID NO:24); the upstream detection primer sequence of MMP9 is: 5'-CCCTGGTCCTGGTGCTCCTG-3' (SEQ ID NO:25), the downstream detection primer sequence is: 5'-CTGCCTGTCGGTGAGATTGGTTC-3' (SEQ ID NO:26); the upstream detection primer sequence of COL1A2 is: 5'-CCGTGGCAGTGATGGAAGTGTG-3' (SEQ ID NO:27), the downstream detection primer sequence is: 5'-GCAGGACCAGCGTTACCAACAG-3' (SEQ ID NO:28).
[0134] like Fig.13As shown in A to F, compared with the NC inhibitors+DMSO group, the transcription levels of MMP1 and MMP9 in AFs of the miR-30a-5p inhibitors+DMSO group were significantly downregulated, and compared with the NC inhibitors+GW4869 group, the transcription levels of MMP1 and MMP9 in AFs of the miR-30a-5pinhibitors+GW4869 group were significantly downregulated, and were equivalent to the transcription levels of MMP1 and MMP9 in AFs of the miR-30a-5pinhibitors+DMSO group; compared with the NC inhibitors+DMSO group, the transcription levels of MMP2 and MMP3 in AFs of the NCinhibitors+GW4869 group were significantly downregulated, while there were no significant differences in the transcription levels of MMP2 and MMP3 in AFs between the miR-30a-5p inhibitors+DMSO group and the miR-30a-5pinhibitors+GW4869 group; there were no significant differences in the transcription levels of MMP7 and COL1A2 in AFs of the four groups.
[0135] 6. Western blot analysis (WB) to detect protein expression
[0136] The lower chamber AFs of each group were washed once with 4°C precooled PBS, and then the protein samples of each group of AFs were extracted with protein lysis buffer (RIPA with protease phosphatase inhibitors), mixed with 5× loading buffer, placed at 100°C for 10 minutes, and quickly cooled in an ice bath. The protein concentration was determined using a BCA kit, and then 20 μg of protein was loaded per well, electrophoresed using a 10% SDS-PAGE gel, transferred to the membrane, blocked, and incubated overnight at 4°C with primary antibodies: Collagen I (ab21286, 1:1000), α-SMA (ab7817, 1:1000), FAP (CST66562, 1:1000) and Matrix Remodeling Antibody Sampler Kit (CST, 1:1000), washed with TBST, incubated with secondary antibodies, washed with TBST, placed in a chemiluminescence imager, and ECL luminescent solution was evenly added. The instrument was operated for luminescence development and photographed for recording.
[0137] like Fig.14As shown in the figure, compared with the NC inhibitors+DMSO group, the protein expression levels of FAP and Collagen I in AFs of the miR-30a-5p inhibitors+DMSO group increased, while the protein expression levels of MMP2, MMP7, MMP9, TIMP1, TIMP2, and TIMP3 decreased; compared with the miR-30a-5p inhibitors+DMSO group, the protein expression levels of FAP, Collagen I, α-SMA, MMP7, and TIMP2 in AFs of the miR-30a-5p inhibitors+GW4869 group increased, while the protein expression level of TIMP1 decreased. This indicates that miR-30a-5p in BSCs is transferred to AFs through extracellular vesicles to inhibit their activation and regulate the remodeling process of extracellular matrix (ECM).
[0138] Based on the above results of this example, it is shown that miR-30a-5p can regulate the activation of airway fibroblasts, collagen gel contraction and extracellular matrix remodeling, and miR-30a-5p is delivered to airway fibroblasts through the extracellular vesicles of BSCs to exert this regulatory function.
[0139] Example 7 BSC-EVs for the treatment of benign airway stenosis
[0140] 1. Construction and treatment of BTS
[0141] The BTS model was constructed according to the method of Example 2 and BSC-EVs treatment was performed.
[0142] 2. Survival analysis
[0143] From the first day of modeling, the survival of the rabbits was monitored daily, and the deaths were recorded in a timely manner until the end of the experiment. The survival rates of the BSC-EVs treatment group and the control group were calculated and the survival curves were drawn. Fig.15 As shown in the figure, the survival rate of rabbits in the control group was only 20% on the 14th day of modeling, and all rabbits in this group died on the 29th day of modeling; while the survival rate of rabbits in the BSC-EVs treatment group was still as high as 75% on the 14th day of modeling, and one rabbit survived until the end of the experiment. This shows that BSC-EVs treatment significantly prolongs the survival of BTS.
[0144] 3. Bronchoscopy
[0145] The airway stenosis of rabbits in each group was examined under bronchoscopy on the 14th, 21st and 28th day of modeling, and photographs were taken for record. Fig.16 As shown, at day 14, the treatment group had reduced granulation and improved lumen patency compared with the control group, and after treatment, the degree of stenosis slowly progressed over time.
[0146] 4. Histological analysis and evaluation of treatment effects
[0147] According to the construction and treatment method of BTS in this embodiment, a batch of New Zealand white rabbits were treated in parallel. One rabbit was randomly selected from each group on the 14th, 21st and 28th day of modeling to separate airway tissue, prepare paraffin sections, and then put them in a 65°C oven for 2h, take them out while hot, dewax and hydrate them with TO and gradient ethanol in turn, and then perform HE staining and MASSON staining respectively. HE staining was performed according to the method of Example 1. The specific operation steps of MASSON staining are as follows: fix the dewaxed sections with Bouin solution for 1 hour, then rinse with running water for 5 minutes; then stain with iron-containing hematoxylin solution for 5 minutes, and then rinse with deionized water; add alkaline fuchsin solution for staining for 5 minutes, and rinse with deionized water; treat with a mixed solution of phosphotungstic acid and phosphomolybdic acid for 5 minutes, avoid rinsing; add aniline blue solution for staining for 5 minutes, and then rinse with deionized water; dehydrate with alcohol gradient, and finally seal with xylene and neutral gum.
[0148] The stenosis index was calculated based on the HE-stained images using the following formula: stenosis index = [1-(d1+d2) / (D1+D2)] × 100%, where d1 and d2 are the long and short axis measurements of the stenotic site, and D1 and D2 are the long and short axis measurements of the adjacent non-stenotic site.
[0149] like Fig.16 As shown in the figure, HE staining results showed that a large amount of proliferative granulation tissue was observed in the stenotic part of the control group, and these granulation tissues were mainly composed of new capillaries, fibroblasts and inflammatory cells; MASSON staining results showed that a large amount of proliferative collagen fibers were observed in the control group, forming thick fiber bundles, which was in contrast to the less and orderly fiber distribution in the treatment group; the stenosis index analysis results showed that the inner diameter of the stenotic airway lumen in the treatment group was significantly larger than that in the control group. This indicates that compared with the control group, the granulation tissue at the airway stenosis of the rabbits in the BSC-EVs treatment group was significantly reduced, the lumen was more unobstructed, and there was less collagen in the granulation tissue.
[0150] 5. Western blot analysis (WB) evaluation of therapeutic effects
[0151] For the BTS in the previous step, 5 rabbits were randomly selected from each group on the 14th day of modeling to isolate airway tissues, and WB detection was performed according to the method in Example 2. The primary antibodies used included: Collagen I antibody (ab21286, 1:1000), FAP antibody (CST66562, 1:1000), β-actin antibody (CST4967, 1:1000) and Matrix Remodeling Antibody Sampler Kit (CST73959, 1:1000).
[0152] like Fig.17 As shown in the figure, compared with the control group, the expression of Collagen I and FAP in the BSC-EVs treatment group was significantly decreased, and the expression of MMP2 and MMP9 was significantly increased. This indicates that the degree of fibrosis in the treatment group was reduced, and the remodeling of the extracellular matrix and tissue repair were improved. These changes may promote the healing process after airway injury, make tissue repair more effective and orderly, help alleviate airway stenosis, and improve airway patency.
[0153] The above results of this embodiment show that BSC-EVs rich in miR-30a-5p have excellent therapeutic effects on airway stenosis, with less airway wall collagen, improved airway wall remodeling, and inhibited granulation tissue proliferation, thereby expanding the airway lumen, significantly alleviating stenosis symptoms, and prolonging the survival period.
[0154] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.
Claims
1. Use of miR-30a-5p and / or its mimetics in the preparation of products for treating airway stenosis.
2. Use of miR-30a-5p and / or its mimics in the preparation of products for inhibiting airway fibroblast activation.
3. Use of miR-30a-5p and / or its mimics in the preparation of products that reduce the collagen gel contractility of airway fibroblasts.
4. Use of miR-30a-5p and / or its mimics in the preparation of products that improve extracellular matrix remodeling of airway fibroblasts.
5. Use of miR-30a-5p and / or its mimics in the preparation of reagents for inhibiting the expression of FAP gene and / or FAP protein.
6. Use of an agent for inhibiting the expression of FAP gene and / or FAP protein in the preparation of a product for treating airway stenosis, characterized in that: The agent for inhibiting the expression of FAP gene and / or FAP protein includes miR-30a-5p and / or its mimics.
7. Use of an agent for inhibiting the expression of FAP gene and / or FAP protein in the preparation of any one or more products for inhibiting the activation of airway fibroblasts, reducing the collagen gel contraction ability of airway fibroblasts, or improving the extracellular matrix remodeling of airway fibroblasts, characterized in that: The agent for inhibiting the expression of FAP gene and / or FAP protein includes miR-30a-5p and / or its mimics.
8. Use of extracellular vesicles containing miR-30a-5p and / or its mimics in the preparation of products for treating airway stenosis.
9. Use of extracellular vesicles containing miR-30a-5p and / or its mimics in the preparation of any one or more products for inhibiting airway fibroblast activation, reducing the collagen gel contraction ability of airway fibroblasts, or improving the extracellular matrix remodeling of airway fibroblasts.
10. The use according to any one of claims 1 to 9, characterized in that: The nucleotide sequence of the miR-30a-5p is shown in SEQ ID NO:4.
Citation Information
Patent Citations
Microrna-based therapy targeted against LCP-1 positive cancers
CN112567034A
microRNA-30a inhibitor for treating pulmonary arterial hypertension and application of microRNA-30a inhibitor
CN113332306A
Antigen stabilizer, application thereof and kit
CN116008527A