A D-psicose-3-epimerase mutant and its application in the synthesis of psicose

Abstract

The present invention relates to the field of genetic engineering technology, and particularly relates to a D-psicose-3-epimerase mutant and its application in the synthesis of psicose. The present invention simultaneously mutates multiple sites at the 59th, 106th, and 188th positions of the wild-type D-psicose-3-epimerase derived from Brevibacillus thermoruber Brevibacillus thermoruber to obtain a D-psicose-3-epimerase mutant, significantly improving its efficiency in producing D-psicose from fructose. When catalyzing the reaction of 500 g / L fructose to produce D-psicose for 4 h, the conversion rate reaches 36.5%. By coupling with glucose isomerase and constructing a co-expressing conjugate enzyme strain, the intermediate transfer efficiency and the stability of the enzyme are improved. When catalyzing the reaction of 500 g / L glucose to produce D-psicose for 6 h, the conversion rate reaches 30.5%. Moreover, the immobilized enzyme can be reused for 10 batches, and its activity can still be maintained at 80%.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly relates to a D-allulose-3-epimerase mutant and its application in the synthesis of allulose. Background Art

[0002] D-allulose is a naturally occurring rare ketose with the chemical formula C6H 12 O6, and belongs to the C3 epimer of D-fructose. Due to its diverse physiological characteristics, it has become a potential functional component in the pharmaceutical, health care, and food industries. D-allulose has a high sweetness and low energy, and is considered an ideal sweetener and an effective substitute for sucrose. It has 70% of the sweetness of sucrose, but only contains about 0.2 kcal / g of calories. In addition, D-allulose can improve the water holding capacity of food through the Maillard reaction, improve its gelling properties, and produce good flavors during food processing. Therefore, D-allulose has potential commercial uses as a low-calorie sweetener in beverages, baked goods, ice cream, and other typical high-calorie products. As a safe, stable, and low-calorie new functional factor, in addition to its important application value in food, D-allulose also has a variety of unique nutritional and physiological functions: (1) inhibiting blood sugar, and can be used as an adjuvant therapeutic agent, dietary supplement, and sweetener for type II diabetics; (2) reducing blood lipids, reducing the activity of fat synthase, and inhibiting intra-abdominal fat accumulation; (3) antioxidant activity, with strong reactive oxygen species (ROS) scavenging ability and glutathione reductase ability; (4) neuroprotection and anti-inflammatory effects, etc.

[0003] The production methods of D-allulose can be divided into two types: chemical synthesis and biosynthesis. Chemical synthesis methods have many disadvantages, such as difficult separation and purification of products, generation of multiple by-products and chemical wastes. Using the biosynthesis method to produce D-allulose is to use the specific enzymes produced by microorganisms to specifically catalyze the synthesis of D-allulose from substrates. Due to higher substrate specificity and mild reaction conditions providing higher sustainability, enzymatic synthesis of D-allulose has become the first choice. The D-allulose-3-epimerase family is an important biocatalyst for realizing the biological production of D-allulose, which can isomerize D-fructose into D-allulose. So far, at least 20 kinds of D-allulose-3-epimerases have been screened and identified, but most of these enzymes have low catalytic activity for D-fructose and poor thermal stability, and industrial production requires a relatively high temperature for the reaction, which greatly limits the industrial practical application of producing D-allulose by the biological enzyme method. Summary of the Invention

[0004] In order to overcome the above problems, the present invention provides a D-allulose-3-epimerase mutant and its application in the synthesis of allulose.

[0005] To achieve the above technical objectives, the present invention adopts the following technical solutions:

[0006] In a first aspect of the present invention, there is provided a D-allulose-3-epimerase mutant, which is obtained by simultaneous multi-site mutation of methionine at position 59, phenylalanine at position 106, and arginine at position 188 of the wild-type D-allulose-3-epimerase with the amino acid sequence shown in SEQ ID NO.2.

[0007] In one or more embodiments, methionine at position 59 of the wild-type D-allulose-3-epimerase with the amino acid sequence shown in SEQ ID NO.2 is mutated to leucine; phenylalanine at position 106 is mutated to serine; and arginine at position 188 is mutated to proline.

[0008] In a second aspect of the present invention, there is provided a gene encoding the D-allulose-3-epimerase mutant described in the first aspect.

[0009] In a third aspect of the present invention, there is provided an expression cassette comprising the gene described in the second aspect.

[0010] In a fourth aspect of the present invention, there is provided a recombinant expression vector comprising the gene described in the second aspect.

[0011] In a fifth aspect of the present invention, there is provided a recombinant bacterium comprising the gene described in the second aspect.

[0012] In a sixth aspect of the present invention, there is provided a transgenic cell line comprising the gene described in the second aspect.

[0013] In a seventh aspect of the present invention, there is provided the use of the D-allulose-3-epimerase mutant described in the first aspect, or the encoding gene described in the second aspect, or the recombinant bacterium described in the fifth aspect in the catalytic synthesis of D-allulose.

[0014] In an eighth aspect of the present invention, there is provided a method for synthesizing D-allulose, comprising:

[0015] Using the wet cells obtained by induced culture of the genetically engineered bacterium of the D-allulose-3-epimerase mutant, or the crude enzyme solution extracted by ultrasonic disruption of the wet cells, or the immobilized enzyme as a catalyst, using fructose as a substrate and pure water as a reaction medium to form a reaction system, and reacting to obtain D-allulose;

[0016] wherein the genetically engineered bacterium is constructed by introducing the D-allulose-3-epimerase mutant described in the first aspect into a host bacterium.

[0017] In one or more embodiments, the dosage of the catalyst is 5 to 25 g / L based on the total weight of the wet cells or the immobilized enzyme, and the final concentration of the substrate fructose is 450 to 550 g / L, preferably 500 g / L.

[0018] A ninth aspect of the present invention provides a method for synthesizing D - psicose, comprising:

[0019] Using the wet cells obtained by inducing and culturing a genetically engineered bacterium containing a D - psicose - 3 - epimerase mutant and glucose isomerase, or the crude enzyme solution extracted by ultrasonic disruption of the wet cells, or the immobilized enzyme as a catalyst, using glucose as a substrate, and pure water as a reaction medium to form a reaction system, and reacting to obtain D - psicose;

[0020] Wherein, the genetically engineered bacterium is constructed by introducing the co - expression binding enzyme plasmid of the D - psicose - 3 - epimerase mutant and glucose isomerase described in the first aspect into a host bacterium.

[0021] In one or more embodiments, the dosage of the catalyst is 5 to 25 g / L based on the total weight of the wet cells or the immobilized enzyme, and the final concentration of the substrate glucose is 450 to 550 g / L, preferably 500 g / L.

[0022] The beneficial effects of the present invention are as follows:

[0023] By simultaneously mutating multiple sites at positions 59, 106, and 188 of the wild - type D - psicose - 3 - epimerase derived from Brevibacillus thermoruber Brevibacterium thermoruber, the present invention obtains a D - psicose - 3 - epimerase mutant, which significantly improves the efficiency of producing D - psicose using fructose as a raw material. When catalyzing the reaction of producing D - psicose from 500 g / L fructose for 4 h, the conversion rate reaches 36.5%; by coupling with glucose isomerase and constructing a Spytag + BtDAE - GtXI + SpyCatcher co - expression binding enzyme strain, the intermediate transfer efficiency and the stability of the enzyme are improved. When catalyzing the reaction of producing D - psicose from 500 g / L glucose for 6 h, the conversion rate reaches 30.5%. And the immobilized enzyme can be reused 10 batches, and its activity can still be maintained at 80%; therefore, it has great application value in the production field of D - psicose. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0025] Figure 1 For E.coliReaction progress diagram of K12 MG1655 / pET28a-BtDAE-M59L-F106S-R188P catalyzing the synthesis of D-allulose from fructose;

[0026] Figure 2 Plasmid construction map of pETduet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher;

[0027] Figure 3 For E.coli Reaction progress diagram of K12 MG1655 / pETduet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher catalyzing the synthesis of D-allulose from glucose. Detailed implementation manners

[0028] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0029] It should be noted that the terms used herein are only for describing specific implementation manners and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0030] In order to enable those skilled in the art to more clearly understand the technical solutions of the present invention, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.

[0031] The medium formulations used in the following examples are as follows:

[0032] LB medium: Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, solvent is water, pH is 7.4.

[0033] LB plate: Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, 18 g / L agar, solvent is water, pH is 7.4.

[0034] The concentration of the product D-psicose was detected by high performance liquid chromatography (HPLC). The analysis method was as follows: the model of the chromatographic column was a calcium-type cationic chromatographic column; the mobile phase was water, the injection volume was 10 μL, a differential detector was used, the detection time was 25 min, and the flow rate was 0.6 mL / min; the column temperature was 80 °C.

[0035] Sample treatment: Take 100 μL of the sample after the reaction ended, dilute it 10 times with an aqueous solution, filter it through a 0.22 μm filter membrane, and perform HPLC detection.

[0036] Example 1

[0037] Construction of expression vector and engineering bacteria:

[0038] Through library mining, a D-psicose-3-epimerase derived from Brevibacillus thermoruber Brevibacillus thermoruber was screened, and its NCBI accession number was WP_035300654.1. Nanjing Genscript Biotech Co., Ltd. was commissioned for full gene synthesis. The nucleotide sequence was as shown in SEQ ID NO.1, and the amino acid sequence was as shown in SEQ ID NO.2.

[0039] According to the nucleotide sequence shown in SEQ ID NO.1 and the pET-28a vector sequence, primers F1, R1, F2, and R2 were designed (the nucleotide sequence of F1 was as shown in SEQ ID NO.3, the nucleotide sequence of R1 was as shown in SEQ ID NO.4, the nucleotide sequence of F2 was as shown in SEQ ID NO.5, and the nucleotide sequence of R2 was as shown in SEQ ID NO.6).

[0040] F1: 5’-ctttaagaaggagatataccATGAAATGGTCTATGTGCACGACT-3’;

[0041] R1: 5’-tggtggtggtggtgctcgagTTATTCCGTTGGTGCGATCG-3’;

[0042] F2: 5’-CTCGAGCACCACCACCACC-3’;

[0043] R2: 5’-GGTATATCTCCTTCTTAAAGTTAAACAAAAT-3’;

[0044] Using the pET-28a plasmid as the expression vector, Escherichia coli E.coli K12 MG1655 / pET28a-BtDAE was constructed.

[0045] Construction of expression plasmid: Under the priming of primers F1 / R1 and F2 / R2, using the target gene as a template, the D-allulose-3-epimerase gene sequence with homologous arms was amplified by using high-fidelity Pfu DNA polymerase. Using the pET-28a plasmid as a template, the linearized vector sequence was amplified by using high-fidelity Pfu DNA polymerase, and the target gene was homologously recombined with the linearized vector by using a homologous recombinase to construct the plasmid pET28a-BtDAE.

[0046] Preparation of competent cells: Obtain the glycerol stock of K12 MG1655 strain stored in a -80 °C refrigerator, streak it on an antibiotic-free LB plate, and culture it at 37 °C for 10 h to obtain single colonies; pick the single colonies on the LB plate and inoculate them into a test tube containing 5 mL of LB medium, and culture at 37 °C and 180 rpm for 9 h; take 200 μL of the bacterial solution from the test tube and inoculate it into 50 mL of LB medium, and culture at 37 °C and 180 rpm until the OD E.coli reaches 0.4 - 0.6; pre-cool the bacterial solution on ice, transfer the bacterial solution to a sterilized centrifuge tube, place it on ice for 10 min, centrifuge at 4 °C and 5000 rpm for 10 min; pour out the supernatant, being careful to prevent contamination, resuspend the precipitated cells with pre-cooled 0.1 mol / L CaCl2 aqueous solution, and place it on ice for 30 min; centrifuge at 4 °C and 5000 rpm for 10 min, discard the supernatant, resuspend the precipitated cells with pre-cooled 0.1 mol / L CaCl2 aqueous solution containing 15% glycerol, take 100 μL of the resuspended cells and aliquot them into sterilized 1.5 mL centrifuge tubes, store them in a -80 °C refrigerator, and take them out when needed. 600

[0047] Construction of recombinant Escherichia coli: First, place the K12 MG1655 competent cells stored at -80 °C in an ice bath at 0 °C for 10 min, then add 5 μL of the homologous recombination product in a laminar flow hood, ice bath at 0 °C for 30 min, heat shock in a 42 °C water bath for 90 s, ice bath at 0 °C for 2 min, add 600 μL of LB medium, and culture in a shaker at 37 °C and 200 rpm for 1 h; spread it on an LB plate containing 50 μg / mL kanamycin resistance, culture at 37 °C for 8 - 12 h, randomly pick clones to extract plasmids for sequencing identification, and screen to obtain recombinant Escherichia coli containing the expression recombinant plasmid E.coli K12 MG1655 / pET28a-BtDAE. E.coli

[0048] Example 2

[0049] Induced expression of D-allulose-3-epimerase:

[0050] ​​Wet cells containing the D-allulose-3-epimerase gene: The recombinant Escherichia coli E.coli K12 MG1655 / pET28a-BtDAE obtained in Example 1 was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, cultured at 37 °C and 200 rpm for 12 h, and then inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculation amount of 1% (v / v), and cultured at 37 °C and 200 rpm until the cell OD 600 reached 0.6 - 0.8. Isopropyl-β-D-thiogalactopyranoside (IPTG) with a final concentration of 0.1 mM was added, and after induced culture at 25 °C for 16 h, centrifuged at 4 °C and 8000 rpm for 20 min, the supernatant was discarded, and the precipitate was collected to obtain the wet cells of the recombinant strain pET28a-BtDAE containing D-allulose-3-epimerase.

[0051] Example 3

[0052] Establishment of D-allulose-3-epimerase gene mutation library:

[0053] Using K12 MG1655 / pET28a-BtDAE constructed in Example 2 as the starting strain. E.coli K12 MG1655 / pET28a-BtDAE as the starting strain.

[0054] It was transformed by the method of directed evolution theory. Based on the crystal structure of D-allulose-3-epimerase obtained by homology modeling. According to the calculation of protein folding free energy, the sites for stability improvement T14S, T34G, M59L, F106S, L139T, V151T, R188P, D207R and N220Y were selected for site-directed mutagenesis.

[0055] The mutation PCR system (100 μL) was: 25 μL of 2×Phanta Max buffer, 1 μL of dNTPs, 1 μL of each of the mutation upstream and downstream primers, 1 μL of the template (starting strain), 0.5 μL of Pfu DNA polymerase, and ddH2O was added to 50 μL. The PCR conditions were: pre-denaturation at 95 °C for 3 min, followed by 30 cycles: 95 °C for 15 s, 60 °C for 15 s, 72 °C for 7 min 20 s, and finally a final extension at 72 °C for 10 min. The PCR results were respectively verified by DNA agarose gel electrophoresis for positivity. The PCR products were digested with DpnI enzyme for the template, incubated at 37 °C for 1 h, 200 rpm, inactivated at 65 °C for 1 min, the PCR products were heat-shock transformed, and the Escherichia coli E. coliActivate K12 MG1655, place it at 37 °C and 200 rpm, incubate for 1 hour, spread it on an LB plate containing 50 μg / mL kanamycin resistance, and incubate it upside down at 37 °C overnight.

[0056] Table 1 Design of site-directed mutagenesis primers for D-allulose-3-epimerase

[0057]

[0058] After DNA sequencing, the DNA sequencing results of the mutants with site-directed mutations of T14S, T34G, M59L, F106S, L139T, V151T, R188P, D207R, N220Y, M59L+F106S, M59L+R188P, F106S+R188P, and M59L+F106S+R188P were completely consistent with the expected designed mutations.

[0059] Example 4

[0060] Screening of the D-allulose-3-epimerase gene mutation library:

[0061] Pick monoclonal colonies from the plate obtained in Example 3, inoculate them into an LB liquid medium containing 50 μg / mL kanamycin resistance, culture at 37 °C and 200 rpm for 12 h, then inoculate them into a fresh LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculation amount of 1% (v / v), and culture at 37 °C and 200 rpm until the OD of the bacteria 600 reaches 0.6 - 0.8. Add isopropyl-β-D-thiogalactopyranoside (IPTG) with a final concentration of 0.1 mM, induce and culture at 25 °C for 16 h, then centrifuge at 4 °C and 8000 rpm for 20 min, discard the supernatant, and collect the precipitate to obtain the wet bacteria containing the D-allulose-3-epimerase gene mutation library.

[0062] 1. Primary screening:

[0063] Prepare the reaction solution (200 μL): fructose with a final concentration of 300 g / L as the substrate, Mn with a final concentration of 1 mM 2+ , and the catalyst dosage is 5 g / L based on the total weight of the wet bacteria. Use pure water as the reaction medium to form the reaction solution. Reaction conditions: React on a reactor at 65 °C and 500 rpm for 1 hour. After the reaction ends, take 20 μL of the sample at the end of the reaction, dilute it 20 times, filter it through a 0.22 μm filter membrane, and perform HPLC detection. The detection results are shown in Table 2.

[0064] Table 2 Results of the primary screening reaction

[0065]

[0066] 2. Rescreening:

[0067] The strains obtained from the primary screening are subjected to rescreening. The reaction solution (10 mL) for rescreening is prepared as follows: fructose as the substrate with a final concentration of 300 g / L, Mn with a final concentration of 1 mM 2+ , and the catalyst dosage is 5 g / L based on the total weight of the wet cells. Using pure water as the reaction medium to form the reaction solution. Reaction conditions: React on a reactor at 65 °C and 500 rpm for 1 hour. After the reaction ends, take 20 μL of the sample at the end of the reaction, dilute it 20 times, filter it through a 0.22 μm filter membrane, and perform HPLC detection. The detection results are shown in Table 3.

[0068] The detection results are shown in Table 3.

[0069] Table 3 Rescreening reaction results

[0070]

[0071] Example 5

[0072] Application of D-allulose-3-epimerase in the catalytic synthesis of D-allulose:

[0073] The recombinant D-allulose-3-epimerase mutant with the highest activity obtained in Example 4 E.coli K12MG1655 / pET28a-BtDAE-M59L-F106S-R188P is inoculated into LB liquid medium containing kanamycin with a final concentration of 50 μg / mL and cultured at 37 °C for 9 hours as the seed solution. Then, it is inoculated into a 5 L fermenter containing 3 L of fermentation medium at an inoculation volume concentration of 3.5%. Add the prepared medium into it, seal the air outlet and air inlet well, install and seal it well, open the inoculation port, and put it into the autoclave together with the prepared lactose inducer for sterilization at 115 °C for 30 min. Screw on the inoculation port of the sterilized fermenter, install it on the operating system, connect the condensed water and air (a sterilization membrane should be installed on the air inlet pipe), insert the air outlet below the liquid level of the conical flask. When the autoclave cools down to 37 °C, put a fire ring on the inoculation port and inoculate the cultured seed solution into the fermenter. Culture at 37 °C and 500 rpm for about 3 - 4 h. When the cell density OD 600 reaches 6 - 8 to meet the requirements, lower the temperature of the fermenter to 25 °C, add lactose with a final concentration of 16 g / L as the inducer, and then culture at 25 °C and 500 rpm for 12 h. Centrifuge the cultured fermentation broth at 8000 rpm for 10 min to obtain the fermentation broth containing D-allulose-3-epimerase mutant E.coliWet cells of K12MG1655 / pET28a-BtDAE-M59L-F106S-R188P.

[0074] The composition of the fermentation tank medium: 45 g of tryptone, 36 g of yeast extract, 30 g of sodium chloride, 4.08 g of potassium dihydrogen phosphate, 45 g of glycerol (glycerin), 6.84 g of dipotassium hydrogen phosphate trihydrate, 15 g of ammonium sulfate, 1.125 g of magnesium sulfate, 4 g of antifoaming agent, and distilled water was added to make up the volume to 3 L for dissolution.

[0075] The dosage of the catalyst was 15 g / L based on the total weight of the wet cells, the final concentration of the substrate fructose was 500 g / L, and the final concentration of Mn was 1 mM. 2+ Pure water was used as the reaction medium, and the total volume of the reaction solution was 1 L. Reaction conditions: 65 °C, 500 rpm for 4 hours. After the reaction, 20 μL of the reaction sample was taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and subjected to HPLC detection. The reaction progress curve is as Figure 1 shown. After the reaction, the concentration of D-allulose was 182.5 g / L, and the conversion rate was 36.5%.

[0076] Example 6

[0077] Construction of a co-expression strain of D-allulose-3-epimerase and glucose isomerase and its application in the catalytic synthesis of D-allulose:

[0078] By constructing a co-expression strain of the recombinant D-allulose-3-epimerase with the highest activity obtained in Example 4 and glucose isomerase, glucose can be used as a substrate to catalyze the synthesis of D-allulose. In the co-expression of D-allulose-3-epimerase and glucose isomerase, the N-terminus of D-allulose-3-epimerase is linked to the SpyTag tag through a linker, and the C-terminus of glucose isomerase is linked to the SpyCatcher tag through a linker. The SpyTag and SpyCatcher tags will specifically bind. Among them, the nucleotide sequence of SpyTag is shown in SEQ ID NO.7, the nucleotide sequence of SpyCatcher is shown in SEQ ID NO.8, and the amino acid sequence of Linker is GGGGSGGGGSGGGGS. Construct the binding enzyme plasmid pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher (see the plasmid map in Figure 2 ), improve the intermediate transfer efficiency and the stability of the enzyme, and thus improve the synthesis efficiency of D-allulose.

[0079] SEQ ID NO.7: ATGGCTCACATAGTAATGGTTGATGCATATAAGCCGACCAAG;

[0080] SEQ ID NO.8: GTTGATACCCTGAGCGGCCTGTCTAGCGAACAGGGTCAAAGCGGCGACATGACCATTGAAGAGGACAGCGCAACCCATATCAAATTCAGCAAACGTGATGAAGACGGTAAGGAGTTGGCGGGTGCGACGATGGAGTTGCGCGACAGCAGCGGTAAGACCATCTCCACCTGGATTAGCGATGGCCAAGTGAAAGATTTTTATCTGTACCCGGGTAAATACACCTTCGTGGAGACAGCGGCACCGGATGGTTATGAAGTTGCTACTGCGATTACCTTTACGGTGAATGAACAAGGCCAGGTTACCGTCAACGGCAAGGCTACGAAAGGTGACGCCCACATCTGA.

[0081] The glucose isomerase is derived from Bacillus stearothermophilus ( Geobacillus thermoleovorans ), and its NCBI accession number is WP_138187043.1. The full gene synthesis was entrusted to Nanjing Genscript Biotech Co., Ltd. The nucleotide sequence is shown in SEQ ID NO.9, and the amino acid sequence is shown in SEQ ID NO.10.

[0082] Primers were designed according to the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.7 and the pET-Duet vector sequence. Spytag+Lingker+BtDAE-M59L-F106S-R188P was constructed between the NcoI-NotI restriction enzyme sites of the first cloning site of the pET-Duet vector by homologous recombination, and GtXI+Lingker+SpyCatcher was constructed between the NdeI-XhoI restriction enzyme sites of the second cloning site of the pET-Duet vector. The specific construction process refers to Example 1, and finally the co-expression strain E.coli K12 MG1655 / pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher was obtained.

[0083] The fermentation process of the co-expression strain refers to Example 5, and the resistance is ampicillin resistance. The co-expression strain was obtained through fermentation E.coliWet cells of K12 MG1655 / pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher, with a catalyst dosage of 15 g / L based on the total weight of the wet cells, a final concentration of 500 g / L of the substrate glucose, and a final concentration of 1 mM of Mn 2+ and Co 2+ , with purified water as the reaction medium, making the total volume of the reaction solution 1 L. Reaction conditions: React at 65 °C and 500 rpm for 4 hours. After the reaction, take 20 μL of the sample at the end of the reaction, dilute it 50 times, filter it through a 0.22 μm filter membrane, and perform HPLC detection. The reaction progress curve is as Figure 3 shown. After the reaction, the concentration of D-allulose is 152.5 g / L, and the conversion rate is 30.5%.

[0084] Example 6

[0085] Immobilization of D-allulose-3-epimerase and the binding enzyme and its application in the catalytic synthesis of D-allulose:

[0086] Take E.coli K12 MG1655 / pET28a-BtDAE-M59L-F106S-R188P or E.coli K12 MG1655 / pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher wet cells, obtain the crude enzyme solution by ultrasonic disruption. Weigh an appropriate amount of diatomaceous earth and add it (the addition amount is a mass ratio of 5:1 to the wet cells), stir and mix evenly for 10 - 15 min, then add 0.15% polyethyleneimine by volume to flocculate for 20 - 30 min, and finally add 0.5% glutaraldehyde by volume for covalent cross-linking for 1 h. Then wash it 3 - 5 times with purified water to obtain the immobilized BtDAE-M59L-F106S-R188P and Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher.

[0087] The catalyst dosage is 25 g / L based on the total weight of the immobilized enzyme, a final concentration of 500 g / L of the substrate fructose or glucose, and a final concentration of 1 mM of Mn 2+ or 1 mM of Mn 2+ and Co 2+, Purified water was used as the reaction medium to form a reaction solution with a total volume of 1 L. Reaction conditions: React at 70 °C and 500 rpm for 4 to 6 hours. After the reaction, take 20 μL of the sample at the end of the reaction, dilute it 50 times, filter it through a 0.22 μm filter membrane, and perform HPLC detection. The conversion rate of the immobilized BtDAE-M59L-F106S-R188P can reach 35.8% after reacting for 4 h, and after reacting for 10 batches, the enzyme activity can still be maintained above 80%. The conversion rate of the immobilized Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher can reach 29.5% after reacting for 6 h, and after reacting for 10 batches, the enzyme activity can still be maintained above 80%.

[0088] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A D-psicose-3-epimerase mutant, characterized in that, It is a mutant of wild-type D-psicose-3-epimerase with the 59th methionine mutated to leucine, the 106th phenylalanine mutated to serine, and the 188th arginine mutated to proline, as shown in the amino acid sequence SEQ ID NO.

2.

2. A gene encoding the D-psicose-3-epimerase mutant according to claim 1.

3. An expression cassette, characterized in that, Containing the gene according to claim 2.

4. A recombinant expression vector, characterized in that, Containing the gene according to claim 2.

5. A recombinant bacterium, characterized in that, Containing the gene according to claim 2.

6. A transgenic cell line, characterized in that, Containing the gene according to claim 2.

7. Use of the D-psicose-3-epimerase mutant according to claim 1, the encoding gene according to claim 2, or the recombinant bacterium according to claim 5 in the catalytic synthesis of D-psicose.

8. A method for synthesizing D-psicose, characterized in that, Including: Using the wet cells obtained by induced culture of the genetically engineered bacterium of the D-psicose-3-epimerase mutant, or the crude enzyme solution extracted by ultrasonic disruption of the wet cells, or the immobilized enzyme as a catalyst, using fructose as a substrate and pure water as a reaction medium to form a reaction system, and reacting to obtain D-psicose; Wherein, the genetically engineered bacterium is constructed by introducing the D-psicose-3-epimerase mutant according to claim 1 into a host bacterium; The dosage of the catalyst is 5 - 25 g / L based on the total weight of the wet cells or the immobilized enzyme, and the final concentration of the substrate fructose is 450 - 550 g / L.

9. A method for synthesizing D-psicose, characterized in that, Including: Using the wet cells obtained by induced culture of the genetically engineered bacterium containing the D-psicose-3-epimerase mutant and glucose isomerase, or the crude enzyme solution extracted by ultrasonic disruption of the wet cells, or the immobilized enzyme as a catalyst, using glucose as a substrate and pure water as a reaction medium to form a reaction system, and reacting to obtain D-psicose; Wherein, the genetically engineered bacterium is constructed by introducing the co-expression combined enzyme plasmid of the D-psicose-3-epimerase mutant according to claim 1 and glucose isomerase into a host bacterium; The dosage of the catalyst is 5 - 25 g / L based on the total weight of the wet cells or the immobilized enzyme, and the final concentration of the substrate glucose is 450 - 550 g / L.

Images