Method for simultaneously constructing mRNA and nucleoprotein binding RNA sequencing library in trace cells and application
By isolating mRNA in the cytoplasm and nucleoprotein-RNA complexes in the cell nucleus, a high-throughput sequencing library was constructed, which solved the problem of difficult to distinguish and detect mature mRNA and newborn RNA in the prior art, and achieved efficient expression analysis of micro samples.
Patent Information
- Application Number
- CN202510004128.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-02
- Publication Date
- 2025-06-06
AI Technical Summary
It is difficult for the prior art to effectively distinguish and detect mature mRNA from newly grown RNA in microcells, and existing methods usually require a large sample size, low enrichment efficiency, or high technical difficulty and few detection signals.
The mRNA in the cytoplasm and the nucleoprotein-RNA complex in the cell nucleus were physically separated, and the library was constructed and sequenced respectively. This method uses magnetic beads to adsorb cell nuclei, remove genomic DNA and mature mRNA, retain nucleoproteins and their bound RNA complexes, and then perform RNA fragmentation and reverse transcription to construct a high-throughput sequencing library.
It realizes efficient expression analysis of mature mRNA and newly transcribed RNA in the same micro sample, can capture transiently existing RNA, is easy to operate, is suitable for high-throughput sequencing of micro cells, and improves the sensitivity and repetition of detection.
Smart Images
Figure CN120099136A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a method and application of simultaneously constructing an mRNA and a nucleoprotein-bound RNA sequencing library in trace cells. Background Art
[0002] Transcriptomics provides key information at the molecular level for understanding the molecular mechanisms of organisms, disease diagnosis and treatment by comprehensively analyzing gene expression patterns. However, existing transcriptomics technologies, including RNA-seq and single cell RNA-seq (scRNA-seq), mainly detect mature mRNA or total RNA and cannot distinguish between mature mRNA and nascent RNA. Therefore, when we find that the RNA level of a gene has changed, we cannot determine whether the change is due to RNA degradation or changes in the RNA transcription process.
[0003] At present, the high-throughput detection method of nascent RNA generally uses nucleoside analogs such as 4-thiouridine (4sU) to label nascent RNA, and then enriches the labeled RNA by biochemical methods for sequencing, but this method usually requires a large amount of sample and the enrichment efficiency is not high. Although the recently reported scGRO-seq can detect nascent RNA at the single-cell level through click chemistry, this method is technically difficult, detects few single-cell signals, and usually requires the accumulation of signals from hundreds of cells for analysis.
[0004] Another method is to incorporate 4sU into nascent RNA. During reverse transcription, 4sU will be converted into cytosine to identify nascent RNA. Although this method does not require the enrichment of newly labeled RNA, the process of labeling nascent RNA with 4sU takes at least 45 minutes, which makes it difficult to capture those short-lived RNAs. Moreover, the data analysis of this method is more challenging and difficult for non-professionals to complete. The above problems limit our direct detection and identification of mature mRNA and nascent RNA in trace cells. Summary of the invention
[0005] In order to effectively solve the above technical problems, the present invention provides a method for simultaneously detecting mature mRNA and nucleoprotein-bound RNA in trace cells. In the present invention, mRNA in the cytoplasm and nucleoprotein-RNA complexes including Pol Ⅱ in the nucleus are separated by physical methods, and the separated RNAs are library-built and sequenced respectively. Most of the nucleoprotein-bound RNA separated by this method is newly generated RNA. Therefore, the present invention can well analyze the expression of mature mRNA and newly transcribed RNA in the nucleus in the same trace sample.
[0006] In a first aspect, the present invention claims a method for simultaneously constructing a high-throughput sequencing library of mRNA and nuclear protein-bound RNA in trace cells.
[0007] The implementation steps of the high-throughput sequencing library provided by the present invention are as follows: S1. Lyse the cells in a lysis buffer and add magnetic beads to the lysis buffer to absorb the cell nuclei; S2. Separate the cytoplasm and the cell nuclei adsorbed by magnetic beads by centrifugation; S3. The supernatant prepared by separation in step S2 contains mature mRNA, and the library is constructed and sequenced using the conventional SMART-seq2 method.
[0008] S4. The cell nuclei adsorbed to the magnetic beads in step S2 are first treated with DNase I to remove genomic DNA, and then the ribosomal RNA and mature mRNA not bound to the nucleoprotein are removed by elution, while the nucleoprotein and its bound RNA complex are retained on the magnetic beads.
[0009] S5. Add Mg-containing 2+ Buffer solution was added to fragment RNA and release it from nuclear protein under high temperature conditions, and the supernatant containing RNA fragments was collected by centrifugation; S6. The RNA fragment obtained in step S5 is reverse transcribed and subjected to template displacement reaction using random primer oligo dN containing linker sequence Ⅰ (i.e., reverse transcription primer SEQ ID NO: 1) and M-MLV reverse transcriptase. In the template displacement reaction, primer N4TSO containing linker sequence Ⅱ (i.e., template displacement primer SEQ ID NO: 2) is added to the 5' end of the cDNA.
[0010] S7. The cDNA obtained in step S6 was subjected to the first round of PCR pre-amplification using primers P7a (SEQ ID NO: 3) and P5a (SEQ ID NO: 4), and the PCR product was purified using magnetic beads.
[0011] S8. The first-round PCR product obtained in step S7 is subjected to a second-round PCR using primers containing Index (SEQ ID NO: 5-24), and finally a sequencing library of nucleoprotein-bound RNA is obtained.
[0012] Specifically, the primer information is as follows: Reverse transcription primer SEQ ID NO: 1 (oligo dN): 5'-AGACGTGTGCTCTTCCGATCTNNNNNN-3'; Template replacement primer SEQ ID NO: 2 (N4TSO): 5'-CACGACGCTCTTCCGATCTNNNNrGrG+rG-3' (+ indicates locked nucleic acid); First round PCR pre-amplification primer SEQ ID NO: 3 (P5a): CACGACGCTCTTCCGATCT; The first round of PCR pre-amplification primer SEQ ID NO: 4 (P7a): AGACGTGTGCTCTTCCGATCT; The second round of PCR primers containing Index are shown in Appendix 1.
[0013] Preferably, the lysis buffer in step S1 is 1% NP40 lysis buffer, the cells are lysed on ice for 5-10 min, and the magnetic beads are streptavidin C1 magnetic beads.
[0014] The number of cells contained in the micro-cell sample is 1-10000. The micro-cells include all animal cells such as HELA cells, human and mouse embryos.
[0015] Preferably, the reaction system for RNA fragmentation in step S5 is: Template switching buffer (NEB, M0466L) 2 μl, H 2 O 6μl, 94℃ for 5-8 min. You can choose 94℃ for 8 min or 85℃ for 6 min.
[0016] Preferably, the M-MLV reverse transcriptase in step S6 is purchased from New England Biolabs (Cat. No.: M0466L), and can also be replaced by other reverse transcriptases that can add CCC (three cytosines) to the 3' end of the reverse transcription product. The reaction system is: 8μl RNA fragmentation product, 2μl dNTP, 2μl reverse transcription primer oligo dN, 2μl primer N4TSO, 3μl Template Switching buffer, 2μl template replacement reverse transcriptase mixture, and 2μl enzyme-free water.
[0017] The conditions for the reverse transcription and template replacement reactions were 42°C for 90 min and 85°C for 5 min.
[0018] Preferably, the reaction conditions of the first round of PCR pre-amplification in step S7 are: 98°C 40-45 s; 98°C 10-20 s, 62°C 15-25 s, 72°C 2-4 min, 10-16 cycles; 72°C 5-8 min; stored at 4°C. The magnetic beads are 1.2× DNA purification magnetic beads.
[0019] Preferably, the reaction conditions of the second round of PCR pre-amplification in step S8 are: 98°C 40-45 s; 98°C 10-20 s, 62°C 15-25 s, 72°C 2-4 min, 5-12 cycles; 72°C 5-8 min; stored at 4°C. The magnetic beads are 1× DNA purification magnetic beads.
[0020] In a second aspect, the present invention claims a method for isolating mRNA and nucleoprotein-bound RNA from trace amounts of cells.
[0021] The method for separating mRNA and nucleoprotein-bound RNA from trace cells provided by the present invention comprises steps S1-S5 of the method shown in the first aspect above.
[0022] In a third aspect, the present invention claims a primer set as follows: The reverse transcription primer oligo dN in the method of the first aspect described above and the first round PCR pre-amplification primers P5a and P7a.
[0023] In a fourth aspect, the present invention claims the use of the primers and two rounds of PCR in steps S7 and S8 of the method described in the first aspect above in constructing a high-throughput sequencing library of trace nuclear protein-bound RNA.
[0024] Compared with the prior art, the present invention has the following innovative features and beneficial effects: 1. The present invention only requires a trace amount of cells (as low as 1 cell) to simultaneously construct a high-throughput sequencing library of mature mRNA and nucleoprotein-bound RNA. Among them, nucleoprotein-bound RNA can reflect the transcription level of nascent RNA in the cell nucleus, providing an effective tool for revealing cellular RNA transcription and degradation.
[0025] 2. The present invention does not require labeling of nascent RNA, but directly separates RNA bound to nucleoprotein, can capture transiently existing RNA, and is easy to operate, which is conducive to the promotion and popularization of the method.
[0026] 3. The present invention adopts a two-round PCR library amplification method, which can effectively avoid the problem of primer dimers being easily formed during PCR amplification of low starting amount samples. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 This is a schematic diagram of the library construction method of Example 1 and Example 2. In the figure, ucnRNA-seq refers to ultra-low cell nucleoprotein binding RNA sequencing.
[0028] Figure 2a. Western Blotting diagram of some nuclear proteins polled down by streptavidin C1 magnetic beads; b. Distribution diagram of ucnRNA-seq library fragments that were amplified directly with the second round of adapter primers without using primers P5a and P7a for the first round of PCR; c. Distribution diagram of ucnRNA-seq library fragments that were amplified by two rounds of PCR.
[0029] Figure 3 a. The number of genes with nuclear protein-bound RNA fpkm>1 detected in 1-10,000 cells; b. The correlation analysis between biological replicates of ucnRNA-seq.
[0030] Figure 4 a. Display genes for IGV FOXD4L5 a. The nuclear protein-bound RNA (ucnRNA-seq detection) and mRNA (SMART-seq detection) signals; b. The distribution statistics of RNA detected by ucnRNA-seq and SMART-seq in different regions of the gene.
[0031] Figure 5 Changes in the expression of nuclear protein-bound RNA after HELA cells were treated with the RNA polymerase II transcription inhibitor DRB (Benzimidazole).
[0032] Figure 6 a. Schematic diagram of mouse embryos at different stages before implantation used for ucnRNA-seq and SMART-seq; b. Hierarchical clustering diagram of ucnRNA-seq results of mouse embryos at different stages; c. Heat map of nuclear protein-bound RNA expression of mouse embryos at different stages.
[0033] Figure 7 a. Volcano plot of differentially expressed genes in nucleoprotein-bound RNA between mouse fertilized eggs (Zygote) and M II oocytes; b. GO analysis of upregulated genes in nucleoprotein-bound RNA of Zygote compared with mouse M II oocytes.
[0034] Figure 8 a. Correlation analysis of the ucnRNA-seq and SMART-seq results of mouse Zygote, b. The percentage of different types of RNA in mouse Zygote detected by ucnRNA-seq. DETAILED DESCRIPTION
[0035] In order to further illustrate the present invention in detail, the following will be described with reference to the drawings and specific implementation cases in the specification. It should be pointed out that these implementation cases are only used to illustrate the present invention and do not constitute a limitation on the scope of protection of the present invention. In the following implementation cases, unless otherwise explicitly stated, the experimental means adopted are all conventional methods; the materials and reagents used, unless otherwise specified, are all reagents and materials available on the market.
[0036] Example 1 Simultaneous construction of mRNA and nucleoprotein-bound RNA sequencing libraries in HELA cells 1. Experimental methods The schematic diagram of the construction method of the library described in this embodiment is as follows Figure 1 shown.
[0037] (1) Place 1, 10, 100, 1000 or 10000 HELA cells in 10 μl of cell lysis buffer (1×PBS, 1% NP40, 1 U μl −1 SUPERaseIn, 1× protease inhibitor, 1μl streptavidin C1 magnetic beads) and lyse on ice for 10 min.
[0038] (2) Centrifuge at 4°C, 500 g for 5 min, take 8 μl of the supernatant and use the conventional method SMART-seq2 to construct the mRNA library. The precipitate containing the magnetic beads is used to construct the ucnRNA-seq library.
[0039] (3) Add 48 μl PBS, 6 μl 10× DNase I reaction buffer, and 4 μl DNase I to the magnetic bead precipitate obtained in step (2), react at 37 °C for 5 min, and then place on a rotary shaker at 4 °C for 1 h.
[0040] (4) Centrifuge and remove the supernatant, then wash four times with 100 μl of washing buffer (PBS containing 0.05% NP40).
[0041] (5) Adsorb the magnetic beads onto the magnetic rack, remove the washing solution, add 2 μl Template Switching buffer and 6 μl enzyme-free water, and heat at 94°C for 5 min to fragment the RNA.
[0042] (6) Centrifuge at 12,000 g for 5 minutes, collect 8 μl of the supernatant containing RNA fragments, add 2 μl of dNTP, 2 μl of reverse transcription primer oligo dN, 2 μl of primer N4TSO, 3 μl of Template Switching buffer, 2 μl of template replacement reverse transcriptase mixture, and 2 μl of enzyme-free water. Perform reverse transcription and template replacement reactions at 42°C for 90 min and 85°C for 5 min.
[0043] (7) Add 28 μl enzyme-free water, 1 μl P5a, 1 μl P7a, and 50 μl NEBNext High-Fidelity 2× PCR Master Mix (NEB, catalog number M0541L) to perform the first round of PCR reaction. The reaction conditions are: 98°C 45 s; 98°C 10 s, 62°C 15 s, 72°C 2 min, 10-16 cycles; 72°C 5 min; store at 4°C. Then purify the library DNA with 1.2× magnetic beads and elute with 25 μl enzyme-free water.
[0044] (8) The reaction system for the second round of PCR was as follows: 23 μl of the first round of PCR product, 1 μl of primers DM501 and DM701 in Appendix 1, 25 μl of NEBNext High-Fidelity 2×PCR Master Mix, and the reaction conditions were as follows: 98°C 45 s; 98°C 10 s, 62°C 15 s, 72°C 2 min, 5-12 cycles; 72°C 5 min; and stored at 4°C. Purification was performed using 1× DNA purification magnetic beads to obtain the ucnRNA-seq library.
[0045] 2. Library quality control In order to confirm that the nuclear proteins pulled down by streptavidin C1 magnetic beads include proteins directly involved in RNA transcription, we used Western Blotting to detect them. The nuclear proteins detected included RNA polymerase Pol Ⅱ and transcription activation marker histone H3K27ac, but the nuclear protein hnRNPK, which is not directly involved in RNA transcription, was not among them (see Figure 2 a).
[0046] Figure 2 b is the ucnRNA-seq library that was amplified directly with the second-round adapter primers without using primers P5a and P7a for the first-round PCR. The main peak of the library detected by Qsep 400 is located at around 150 bp. This is the primer dimer formed by the adapter primer (the peak marked by the blue dotted box), and the RNA fragment to be tested cannot be effectively amplified.
[0047] Figure 2 c Qsep 400 detected the DNA fragment size distribution of the ucnRNA-seq library after two rounds of PCR, which was mainly distributed between 200-500 bp, which is a normal library fragment distribution.
[0048] 3. Analysis of sensitivity and repeatability of ucnRNA-seq assay The analysis results show that ucnRNA-seq can detect about 2,000 genes with nuclear protein-bound RNA fpkm>1 in 1 cell, about 4,000 genes with nuclear protein-bound RNA fpkm>1 in 10, 100 or 1,000 cells, and about 8,000 genes with nuclear protein-bound RNA fpkm>1 in 10,000 cells, with high detection sensitivity (see Figure 3 Moreover, the correlation R values between 1–10,000 cell biological replicates were all > 0.9, indicating that the method has good reproducibility (see Figure 3 b).
[0049] 4. Compare the percentage of RNA introns detected by SMART-seq and ucnRNA-seq.
[0050] The results showed that the RNA detected by ucnRNA-seq contained a large number of introns, accounting for about 50%, while the proportion of introns in mRNA detected by SMART-seq was about 5%, indicating that the majority of nucleoprotein-bound RNA detected by ucnRNA-seq was newly formed immature RNA (see Figure 4 a and 4b).
[0051] 5. The expression of nuclear protein-bound RNA was significantly changed after HELA cells were treated with RNA polymerase II transcription inhibitor DRB (Benzimidazole) for 4 h (see Figure 5 ). This indicates that ucnRNA-seq can well monitor changes in nuclear RNA expression.
[0052] Example 2 Simultaneous construction of mRNA and nuclear protein-bound RNA sequencing libraries in mouse embryos at different stages before implantation The method is the same as in Example 1.
[0053] 1. Mouse M II oocytes and 1–8 cell embryos were collected for simultaneous SMART-seq and ucnRNA-seq library construction (see Figure 6 a). Hierarchical clustering analysis of ucnRNA-seq results showed that the hierarchical clustering results of M II oocytes and mouse embryos at different times were good (see Figure 6 b). Figure 6c Heat map showing the expression of nuclear protein-bound RNA in M II oocytes and mouse embryos at different times. The results show that compared with M II oocytes, a small number of genes are upregulated in zygotes, but a large number (more than 2,000) of genes are activated in the early 2-cell stage (E2C), which is earlier than the previous report that mouse mRNA expression is activated in large quantities in the late 2-cell stage.
[0054] 2. Figure 7 a is a volcano plot of differentially expressed genes in nuclear protein-bound RNA between mouse fertilized eggs (Zygote) and M II oocytes. Figure 7 b is the GO analysis of up-regulated genes in Zygote nucleoprotein-bound RNA compared with mouse M II oocytes. The results showed that up-regulated Zygote nucleoprotein-bound RNA was mainly related to protein translation. During this period, a large amount of protein needs to be synthesized to prepare for genome activation in the 2-cell stage.
[0055] 3. Correlation analysis was performed on the ucnRNA-seq and SMART-seq results of mouse Zygote. The differences between them were significant, indicating that there were significant differences in the RNA detected by the two methods (see Figure 8 a). Further analysis revealed that miRNA is the most abundant in the mouse Zygote detected by ucnRNA-seq, which is consistent with the need to degrade RNA from the mother during this period; this is also information that cannot be detected in SMART-seq2. mRNA, Mt_rRNA and miscRNA are closely followed (see Figure 8 b).
[0056] Appendix 1: Second round PCR primers (s stands for thiolation, bold is the index sequence)
Claims
1. A method for simultaneously constructing a sequencing library of mRNA and nucleoprotein-bound RNA in trace cells, characterized in that: The following steps are involved: S1. Lyse cells with lysis buffer, add magnetic beads to the cell lysis buffer, and centrifuge to separate cytoplasm and cell nuclei; S2. Using the cell paste obtained in step S1, construct an mRNA transcriptome sequencing library using SMART-seq2; S3. Digest the cell nuclei adsorbed by the magnetic beads obtained in step S1 with DNase I to remove genomic DNA, and remove ribosomal RNA and mature mRNA not bound to nucleoprotein by elution, and retain the nucleoprotein-RNA complex on the magnetic beads; S4. fragmenting the RNA complex obtained in step S3 and the RNA bound to the nucleoprotein, releasing the RNA fragments from the magnetic beads, and collecting the supernatant containing the RNA fragments; S5. The RNA fragment obtained in step S4 is subjected to reverse transcription and template displacement reaction using a reverse transcription primer and M-MLV reverse transcriptase, and a template displacement primer is added to the 5' end of the cDNA in the template displacement reaction; S6. The cDNA obtained in step S5 was subjected to the first round of PCR amplification using primers SEQ ID NO: 3 and SEQ ID NO: 4, and the PCR product was purified using magnetic beads. S7. The first-round PCR product obtained in step S6 is subjected to a second-round PCR using primers containing the Index, and finally a sequencing library of nucleoprotein-bound RNA is obtained.
2. The method according to claim 1, characterized in that The number of cells contained in the micro-cell sample in step S1 is 1-10000, and the magnetic beads are streptavidin C1 magnetic beads.
3. The method according to claim 1, characterized in that The reaction system for digesting DNA in step S3 includes cell lysis solution, DNase I, and 10× DNase I reaction buffer.
4. The method according to claim 1, characterized in that The reaction system for RNA fragmentation in step S4 includes 4× Template Switching buffer and enzyme-free water. The reaction conditions for RNA fragmentation are 85-94° C. for 5-8 min.
5. The method according to claim 1, characterized in that In step S5, the reverse transcription primer is SEQ ID NO: 1, and the template replacement primer is SEQ ID NO:
2.
6. The method according to claim 5, characterized in that The reverse transcription reaction and template displacement reaction system in step S5 includes RNA fragmentation product, dNTP, reverse transcription primer, template displacement primer, Template Switching buffer, template displacement reverse transcriptase mixture, and enzyme-free water. The conditions for the reverse transcription and template replacement reactions are 42°C for 90-100 min and 85°C for 5-8 min.
7. The method according to claim 1, characterized in that The reaction conditions for the first round of PCR amplification in step S6 are: 98°C 40-45 s; 98°C 10-20 s, 62°C 15-25 s, 72°C 2-4 min, 10-16 cycles; 72°C 5-8 min; and stored at 4°C.
8. The method according to claim 1, characterized in that The primers containing Index in the second round of PCR amplification in step S7 include any one of SEQ ID NO: 5 to SEQ ID NO:
24.
9. The method according to claim 8, characterized in that The reaction conditions were: 98°C for 40-45 s; 98°C for 10-20 s, 62°C for 15-25 s, 72°C for 2-4 min, 5-12 cycles; 72°C for 5-8 min; and stored at 4°C.
10. The method according to any one of claims 1 to 9, used for constructing a sequencing library of mRNA and / or nuclear protein-bound RNA in trace cells.