Recombinant marine protein with antioxidant and anti-inflammatory effects as well as preparation method and application of recombinant marine protein
Through the synthesis and fermentation of recombinant marine proteins, the problems of limited therapeutic effects, complex preparation and low yield of natural marine polypeptides have been solved, and efficient and safe antioxidant and anti-inflammatory effects have been achieved, providing new ideas for the development of new drugs and health products.
Patent Information
- Application Number
- CN202510333482.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-13
AI Technical Summary
The therapeutic effects of natural marine polypeptides are limited, complex preparation methods and low yields, which limit their wide application.
By synthesizing the coding genes of recombinant marine proteins, recombinant expression plasmids are constructed and transformed into Bacillus subtilis for fermentation, which improves yield and ensures biological activity and safety.
It has achieved significant antioxidant and anti-inflammatory effects, improved the yield and biological activity of marine peptides, avoided the side effects of traditional drugs, and provided new ideas for the development of drugs and health products.
Smart Images

Figure CN120136993A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of recombinant proteins, and particularly relates to a recombinant marine protein with antioxidant and anti-inflammatory effects, a preparation method thereof, and an application thereof. Background Art
[0002] With the aggravation of problems such as environmental pollution, increasing life pressure, and population aging, the demand for antioxidant and anti-inflammatory agents is growing. Free radicals and inflammatory responses play a key role in the occurrence and development of various diseases, such as cardiovascular diseases, cancers, neurodegenerative diseases, etc. Therefore, the development of novel bioactive substances with antioxidant and anti-inflammatory effects has important medical and health significance.
[0003] In recent years, marine biological resources have received extensive attention due to their unique biological activities and medicinal values. Marine organisms live in extreme environments and are rich in bioactive substances. Among them, marine polypeptides have attracted much attention due to their various biological activities. These polypeptides have multiple functions such as antioxidant, anti-inflammatory, antibacterial, and antiviral, providing rich resources for the development of novel drugs and health products. As a natural bioactive substance, marine polypeptides have the advantages of high safety, low side effects, and high bioavailability, avoiding the problem of large side effects of traditional antioxidant and anti-inflammatory drugs, and becoming the new favorite in the field of antioxidant and anti-inflammatory. However, the preparation methods of natural marine polypeptides are complex, with low yields and limited therapeutic effects, which limit their wide application. Summary of the Invention
[0004] The object of the present invention is to solve the problems of limited therapeutic effects, complex preparation methods, and low yields of natural marine polypeptides, and to provide a recombinant marine protein with antioxidant and anti-inflammatory effects and a preparation method thereof. The recombinant marine protein contains partial domains of Mytilus californianus foot protein type 6 variant 1 (GenBank: ABC84186.1, and its encoding gene GenBank: DQ351537.1) and partial domains of Mytilus galloprovincialis foot protein type 5 (GenBank: AAS00463.1, and its encoding gene GenBank: AY521220.1). It includes numerous active functional amino acids and has significant antioxidant and anti-inflammatory effects. After synthesizing the encoding gene of the recombinant marine protein, a recombinant expression plasmid is constructed and transformed into Bacillus subtilis for fermentation production. This preparation method not only improves the yield of the recombinant marine protein but also ensures its biological activity and safety.
[0005] To achieve the above object, the technical solution provided by the present invention is as follows:
[0006] A recombinant marine protein with antioxidant and anti-inflammatory effects, comprising a partial domain of Mytilus californianus foot protein type 6 variant 1 and a partial domain of Mytilus edulis foot protein type 5; the amino acid sequence of the partial domain of Mytilus californianus foot protein type 6 variant 1 is shown in SEQ ID NO.1; the amino acid sequence of the partial domain of Mytilus edulis foot protein type 5 is shown in SEQ ID NO.2.
[0007] Among them, the amino acid sequence of the recombinant marine protein is shown in SEQ ID NO.3.
[0008] The present invention also claims the coding gene of the recombinant marine protein; the coding gene of the recombinant marine protein is optimized and synthesized based on the amino acid sequence of the recombinant marine protein according to the codon preference of Bacillus subtilis; preferably, the nucleotide sequence of the coding gene of the recombinant marine protein is shown in SEQ ID NO.4.
[0009] The present invention also claims an expression cassette or a recombinant expression vector of the coding gene of the recombinant marine protein.
[0010] The present invention also claims a recombinant bacterium containing the expression cassette or the recombinant expression vector; the chassis bacterium of the recombinant bacterium is Bacillus subtilis, preferably Bacillus subtilis 168.
[0011] The present invention also provides a preparation method of the recombinant marine protein, using homologous recombination to connect the coding gene of the recombinant marine protein with a vector to construct a recombinant expression vector, introducing it into Bacillus subtilis to construct a recombinant Bacillus subtilis, and inoculating it into a fermentation medium for fermentation to obtain it.
[0012] Among them, the vector is pHT43 plasmid.
[0013] Among them, the fermentation medium includes yeast extract, tryptone and phosphate buffer system.
[0014] Among them, the fermentation is to inoculate the recombinant Bacillus subtilis into the fermentation medium and ferment until the OD of the recombinant Bacillus subtilis 600 is 0.8 - 1, adding IPTG inducer (isopropylthio-β-galactoside) to the fermentation medium, and continuing to ferment for 24 - 48 h; the fermentation culture is carried out under the conditions of a temperature of 18 - 37 °C and a rotation speed of 80 - 300 rpm, preferably under the conditions of a temperature of 37 °C and a rotation speed of 200 rpm; the initial concentration of the IPTG inducer in the fermentation medium is 0.1 - 1 mM.
[0015] Preferably, the method for preparing the recombinant marine protein is as follows:
[0016] The pHT43 plasmid was linearized with BamHI and XbaI restriction endonucleases. The restriction digestion reaction system was: 10 μg of plasmid, 10 U each of BamHI and XbaI, 1 μL of 10× restriction digestion buffer, and water was added to 100 μL. The restriction digestion condition was to react at 37 °C for 1 h. After the restriction digestion was completed, the restriction digestion product was subjected to agarose gel electrophoresis, and the linearized plasmid fragment was recovered. Using the synthesized coding gene of the recombinant marine protein as a template, primers F1 / R1 (the nucleotide sequence of F1 (5′~3′): gcacgctgttatttgtcagtttgccgattacaaaaacatcagccgtaggatccgg; the nucleotide sequence of R1 (5′~3′): cgggctgccccggggacgtcgactctagattaatggtgatgatgatgatg) were used for PCR amplification (the PCR reaction system was: 100 ng of template DNA, 10 μM each of primers F1 and R1, 0.2 mM dNTPs, 1 U of Taq enzyme, 1 μL of 10× PCR buffer, and water was added to 100 μL; the amplification program was: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, for a total of 30 cycles; final extension at 72 °C for 10 min). After the amplification was completed, the PCR product was subjected to agarose gel electrophoresis to detect the size and purity of the amplified fragment, and the recombinant marine protein fragment introduced with homologous arms matching the two ends of the linearized plasmid was recovered. The linearized plasmid fragment was ligated with the recombinant marine protein fragment introduced with homologous arms by homologous recombination. The ligation reaction system was: 50 ng of linearized plasmid fragment, 50 ng of recombinant marine protein fragment, 1 U of DNA ligase, 1 μL of 10× ligation buffer, and water was added to 100 μL. The ligation condition was to react at 37 °C for 0.5 h. After the ligation was completed, the ligation product was transformed into Escherichia coli DH5α competent cells. The transformed bacterial solution was spread on an LB plate containing Amp and cultured at 37 °C for 12 - 16 h. After the transformants grew out, single colonies were selected for identification, and positive clones containing the recombinant marine protein gene were screened out. The positive clones were subjected to sequencing verification to ensure that the recombinant marine protein gene sequence was correct. Subsequently, the plasmid was extracted, transformed into Bacillus subtilis competent cells, and correct positive clones were screened out, which were recombinant Bacillus subtilis.
[0017] After the fermentation was completed, a fermentation broth containing the recombinant marine protein was obtained. The method for separating and purifying the recombinant marine protein from the fermentation broth was: the fermentation broth was centrifuged to remove the bacterial cell precipitate, and the supernatant was filtered through a filter membrane, purified by a cation exchange chromatography column, subjected to Ni column affinity chromatography, dialyzed, and freeze-dried to obtain the pure product of the recombinant marine protein.
[0018] Preferably, the method for separating and purifying the recombinant marine protein from the fermentation broth is as follows: The fermentation broth is centrifuged at 8000 rpm for 10 min to remove the bacterial cell precipitate, and the supernatant is filtered through a 0.45 μm filter membrane to further remove impurities; The filtrate is loaded onto a cation exchange chromatography column and eluted with a 0.1 M NaCl aqueous solution. During the elution process, the elution flow rate is 1 mL / min, and the absorbance value of the eluate is measured to determine the elution position of the recombinant marine protein, and the elution peak containing the recombinant marine protein is collected; The eluate is loaded onto a Ni column for Ni column affinity chromatography and eluted with a Tris-HCl buffer solution (concentration 20 mM, pH 7.4) containing 0.1 M NaCl and 200 mM imidazole. During the elution process, the elution flow rate is 0.5 mL / min, and the absorbance value of the eluate is measured to determine the elution position of the recombinant marine protein, and the elution peak containing the recombinant marine protein is collected. The eluate purified by the Ni column is transferred into a dialysis bag (the cut-off molecular weight is not less than 3000 Da) and dialyzed with a 0.1 M Tris-HCl buffer solution (pH 7.4) as the dialysis solution. The dialysis solution is changed every 4 h, and the total dialysis time is 12 h to remove salts; After dialysis is completed, the dialysis product is freeze-dried. The temperature during freeze-drying is -40 °C, the vacuum degree is 0.1 Pa, and the freeze-drying time is 24 h, and finally the pure product of the recombinant marine protein is obtained.
[0019] The present invention also provides the application of the recombinant marine protein in the preparation of antioxidant and / or anti-inflammatory products and / or wound dressings. The antioxidant and anti-inflammatory products are drugs and / or daily chemical products.
[0020] Among them, the product is a drug or a daily chemical product; the product dosage form is any one of free powder, gel, cream, paste, lotion, spray, suspension, solution, dispersed ointment, hydrogel and ointment; The application scenarios are: skin care, antipruritic, sunscreen, topical treatment of dermatitis, wound dressing, oral treatment or drug delivery and other daily chemical or medical fields.
[0021] The recombinant marine protein of the present invention has broad application prospects. It not only has significant antioxidant and anti-inflammatory effects in daily chemical or medical fields such as skin care, antipruritic, sunscreen, topical treatment of dermatitis, wound dressing, oral treatment or drug delivery, but also provides new ideas and methods for the development of new drugs and health products. Through synthetic biology technology, the present invention not only improves the yield and biological activity of marine polypeptides, but also brings new solutions to the antioxidant and anti-inflammatory fields, meeting the needs of this field for new bioactive substances.
[0022] Beneficial effects:
[0023] 1. The recombinant marine protein with antioxidant and anti-inflammatory effects successfully constructed in the present invention is composed of multiple marine biological proteins, contains numerous active functional amino acids, and has significant antioxidant and anti-inflammatory effects compared with natural marine biological proteins; compared with traditional antioxidant and anti-inflammatory chemical drugs, it has higher safety, smaller toxic and side effects, and higher bioavailability.
[0024] 2. The present invention constructs recombinant Bacillus subtilis to ferment and produce recombinant marine protein, which improves the yield and biological activity of marine polypeptides compared with the prior art. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The following further describes the present invention in detail with reference to the drawings and specific embodiments, and the above and / or other advantages of the present invention will become clearer.
[0026] Figure 1 Statistical chart of the DPPH radical scavenging rate of recombinant marine protein (RMP), RMP-6, and RMP-5 in Example 2.
[0027] Figure 2 Statistical chart of the ABTS radical scavenging rate of recombinant marine protein (RMP), RMP-6, and RMP-5 in Example 2.
[0028] Figure 3 Statistical chart of the skin moisture content of volunteers in the experimental group and the control group in Example 3.
[0029] Figure 4 Statistical chart of the skin elasticity of volunteers in the experimental group and the control group in Example 3.
[0030] Figure 5 Statistical chart of the relative expression level of inflammatory factor TNF-α in the skin tissues of mice in the experimental group and the control group in Example 4.
[0031] Figure 6 Statistical chart of the relative expression level of inflammatory factor IL-6 in the skin tissues of mice in the experimental group and the control group in Example 4.
[0032] Figure 7 Statistical chart of the skin wound healing rate of mice in the experimental group and the control group in Example 5. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0033] The following further illustrates the present invention according to the following embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and do not limit the present invention.
[0034] For specific technologies or conditions not specified in the examples, follow the technologies or conditions described in the literature in this field or the product instructions. For reagents or instruments without specified manufacturers, they are all conventional products that can be obtained through regular channels.
[0035] Example 1 Preparation of Recombinant Marine Protein
[0036] (1) Synthesis of the recombinant marine protein coding gene
[0037] General Biosystems (Anhui) Co., Ltd. synthesized the recombinant marine protein coding gene (its nucleotide sequence is shown in SEQ ID NO.4) using chemical synthesis method. After synthesis, it was sequenced and verified.
[0038] (2) Construction of the recombinant expression vector
[0039] The pHT43 plasmid was linearized with BamHI and XbaI restriction enzymes. The enzyme digestion reaction system was: 10 μg of plasmid, 10 U each of BamHI and XbaI, 1 μL of 10× enzyme digestion buffer, and water was added to 100 μL. The enzyme digestion condition was to react at 37°C for 1 h. After enzyme digestion, the enzyme digestion product was subjected to agarose gel electrophoresis, and the linearized plasmid fragment was recovered.
[0040] Using the synthesized recombinant marine protein coding gene as a template, PCR amplification was carried out using primers F1 / R1 (the PCR reaction system was: 100 ng of template DNA, 10 μM each of primers F1 and R1, 0.2 mM dNTPs, 1 U of Taq enzyme, 1 μL of 10× PCR buffer, and water was added to 100 μL; the amplification program was: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, a total of 30 cycles; final extension at 72°C for 10 min). After amplification, the PCR product was subjected to agarose gel electrophoresis to detect the size and purity of the amplified fragment, and the recombinant marine protein fragment introduced with homologous arms matching the two ends of the linearized plasmid was recovered.
[0041] The linearized plasmid fragment was ligated to the recombinant marine protein fragment with introduced homologous arms. The ligation reaction system was as follows: 50 ng of linearized plasmid fragment, 50 ng of recombinant marine protein fragment, 1 U of DNA ligase, 1 μL of 10× ligation buffer, and water was added to 100 μL. The ligation condition was to react at 37 °C for 0.5 h. After ligation was completed, the ligation product was transformed into competent Escherichia coli DH5α cells. The transformed bacterial solution was spread on an LB plate containing 100 μg / mL Amp and cultured at 37 °C for 12 - 16 h. After transformants grew out, single colonies were selected for identification, and positive clones containing the recombinant marine protein gene were screened out. The positive clones were verified by sequencing to ensure that the recombinant marine protein gene sequence was correct. Subsequently, the plasmid was extracted to obtain the recombinant expression vector.
[0042] (3) Construction of recombinant Bacillus subtilis
[0043] The recombinant expression vector was transformed into competent Bacillus subtilis 168 cells. The transformed bacterial solution was spread on an LB plate containing 50 μg / mL chloramphenicol and cultured at 37 °C for 12 h. After transformants grew out, single colonies were selected for identification, and positive clones containing the recombinant expression vector were screened out. The positive clones were verified by sequencing to obtain recombinant Bacillus subtilis.
[0044] (4) Fermentation production of recombinant marine protein
[0045] The recombinant Bacillus subtilis was inoculated into LB liquid medium and cultured at 37 °C and 200 rpm for 1 day to obtain the recombinant Bacillus subtilis seed solution; the recombinant Bacillus subtilis seed solution was inoculated into the fermentation medium (formula: (NH 4 ) 2 SO 4 20 g / L, K 2 HPO 4 20 g / L, KH 2 PO 4 20 g / L, Na 3 C 6 H 5 O 7 ·3H 2 O 20 g / L, MgSO 4 ·7H 2 O 20 g / L, yeast extract powder 50 g / L, peptone 30 g / L) at a ratio of 3% by volume and cultured at 200 rpm and 37 °C for 3 - 4 hours to make the OD of recombinant Bacillus subtilis in the fermentation medium 600Reach 0.8 - 1, add IPTG inducer to the fermentation medium (to induce the promoter to initiate the transcription of the recombinant marine protein - encoding gene, the initial concentration of IPTG in the fermentation medium is 0.5 mM), and then continue to ferment at 200 rpm and 37 °C for 36 h to obtain the fermentation broth containing the recombinant marine protein. During the fermentation process, maintain parameters such as the temperature, pH (7.5 - 8.5), and dissolved oxygen (greater than 20%) in the fermenter within an appropriate range to ensure the efficient expression of the recombinant marine protein.
[0046] (5) Isolate and purify the recombinant marine protein
[0047] Transfer the fermentation broth to a centrifuge, centrifuge at 8000 rpm for 10 min to remove the cell precipitate, and filter the supernatant through a 0.45 - μm filter membrane to further remove impurities; load the filtrate onto a cation - exchange chromatography column and elute with a 0.1 M NaCl aqueous solution. During the elution process, the elution flow rate is 1 mL / min, detect the absorbance value of the eluate to determine the elution position of the recombinant marine protein, and collect the elution peak containing the recombinant marine protein; load the eluate onto a Ni column for Ni - column affinity chromatography, and elute with a Tris - HCl buffer solution (concentration 20 mM, pH 7.4) containing 0.1 M NaCl and 200 mM imidazole. During the elution process, the elution flow rate is 0.5 mL / min, detect the absorbance value of the eluate to determine the elution position of the recombinant marine protein, and collect the elution peak containing the recombinant marine protein. Transfer the eluate purified by the Ni column into a dialysis bag (the cut - off molecular weight is 3000 Da), and dialyze with a 0.1 M Tris - HCl buffer solution (pH 7.4) as the dialysis solution. Replace the dialysis solution every 4 h, and dialyze for a total of 12 h to remove salts; after dialysis is completed, lyophilize the dialysis product. The temperature during lyophilization is - 40 °C, the vacuum degree is 0.1 Pa, and the lyophilization time is 24 h. Finally, obtain the pure recombinant marine protein (named Recombinant Marine Protein, RMP), with a purity > 98%.
[0048] Refer to the above steps (1) - (5) to construct recombinant Bacillus subtilis overexpressing partial domains of Mytilus californianus foot protein type 6 variant 1 (RMP - 6) and partial domains of Mytilus edulis foot protein type 5 (RMP - 5) respectively, and obtain proteins RMP - 6 and RMP - 5 through fermentation respectively. The nucleotide sequences of the coding genes of RMP - 6 and RMP - 5 are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively. The primers used when constructing the recombinant expression vectors of the coding genes of RMP - 6 and RMP - 5 are F6 / R6 and F5 / R5 respectively.
[0049] The nucleotide sequences of the primers used in the above steps are shown in Table 1.
[0050] Table 1 Primers required for constructing recombinant expression vectors
[0051]
[0052] Example 2 Verification of the Antioxidant Effect of Recombinant Marine Protein
[0053] In order to further verify the antioxidant activity of recombinant marine protein, in vitro antioxidant experiments of recombinant marine protein were carried out using DPPH free radical scavenging experiments and ABTS free radical scavenging experiments.
[0054] DPPH free radical scavenging experiment: prepare 20mM DPPH ethanol solution, take 2mL of it and mix it with 2mL of pure water, and detect the absorbance of the mixed solution at a wavelength of 517nm, which is recorded as A 0 ; Dissolve the recombinant marine protein in anhydrous ethanol to prepare 0.1 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 0.75 mg / mL and 1.0 mg / mL recombinant marine protein ethanol solutions respectively. Take 2 mL of recombinant marine protein ethanol solutions of different concentrations and add them to 2 mL of the above DPPH ethanol solution. After mixing evenly, react at room temperature in the dark for 30 minutes. Measure the absorbance of the reaction solution at a wavelength of 517 nm, recorded as A. Calculate the DPPH free radical scavenging rate according to formula Ⅰ. The DPPH free radical scavenging rate test method of proteins RMP-6 and RMP-5 is the same as the above method. The experimental results are as follows Figure 1 As shown, the recombinant marine protein has a significant scavenging effect on DPPH free radicals, and the scavenging ability is enhanced with the increase of the concentration of the recombinant marine protein. At a concentration of 1.0 mg / mL, its DPPH free radical scavenging rate reaches more than 80%, and compared with the individual effects of proteins RMP-6 and RMP-5, the DPPH free radical scavenging rate of the recombinant marine protein RMP of the present invention is significantly improved.
[0055] ABTS free radical scavenging experiment: Prepare 7.0mmol / L ABTS aqueous solution and 2.45mmol / L potassium persulfate aqueous solution, mix them in a ratio of 1:1, and then react in the dark for more than 12 hours until its absorbance (734nm) stabilizes at 0.7-0.8 to obtain ABTS reaction solution. Take 1.6mL of the above ABTS reaction solution and mix it thoroughly with 0.6mL of anhydrous ethanol, and then detect the absorbance at 734nm, which is recorded as A 0′. The recombinant marine protein was dissolved in distilled water to prepare aqueous solutions of recombinant marine protein at concentrations of 0.1 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 0.75 mg / mL, and 1.0 mg / mL. 0.6 mL of each aqueous solution of recombinant marine protein at different concentrations was mixed with 1.6 mL of the above ABTS reaction solution and reacted for 10 min. The absorbance of the reaction solution at a wavelength of 734 nm was measured and denoted as A′. The DPPH radical scavenging rate was calculated according to Formula Ⅱ, and the experimental results are as Figure 2 shown. The recombinant marine protein also has a significant scavenging effect on ABTS radicals. At a concentration of 1.0 mg / mL, its ABTS radical scavenging rate reaches more than 75%, showing stronger antioxidant ability compared with RMP-6 and RMP-5.
[0056] The above experiments prove that compared with RMP-6 and RMP-5 alone, the recombinant marine protein of the present invention has significant antioxidant activity, has strong ability to scavenge free radicals and reduce oxidized substances, providing a strong experimental basis for its application in the antioxidant field.
[0057] Formula Ⅰ: DPPH radical scavenging rate = (A 0 -A) / A 0 × 100%;
[0058] Formula Ⅱ: ABTS radical scavenging rate = (A 0 ′-A′) / A 0 ′× 100%.
[0059] Example 3 Verification of the Application Effect of Recombinant Marine Protein in Skin Care
[0060] To verify the application effect of recombinant marine protein in skin care, 20 volunteers aged between 25 and 50 were recruited. The skin of these volunteers had problems such as varying degrees of dryness, roughness, and fine lines.
[0061] Before the start of the experiment, a skin moisture tester and a skin elasticity tester were used to conduct basic tests on the skin moisture content and elasticity of all volunteers, and the initial data were recorded.
[0062] The volunteers were randomly divided into two groups of 10 people each. During the experiment, one group used a cream containing recombinant marine protein (experimental group), and the other group used a common cream without recombinant marine protein (control group). After cleansing their faces in the morning and evening, the volunteers took an appropriate amount of cream and evenly applied it to the skin areas that needed care, such as the face and neck, and gently massaged it until completely absorbed. The volunteers were required to avoid using other skin care products that might affect the skin condition during the experiment and maintain normal living habits and diet. The experiment lasted for 4 weeks. At the end of the 2nd week, 3rd week, and 4th week, the skin moisture content and elasticity of the volunteers were detected again.
[0063] The preparation method of the cream in the experimental group is as follows: First, weigh 30 g of vaseline, 20 g of stearic acid, 10 g of glycerol, and 5 g of the recombinant marine protein prepared in Example 1. Put the vaseline and stearic acid into a beaker and place it in a constant temperature water bath, heat it to 70 - 80 °C until it completely melts. Then pour the melted vaseline and stearic acid into a stirrer, add glycerol and the recombinant marine protein, and stir evenly at a speed of 500 - 800 rpm. Then pour the stirred mixture into an emulsifier and perform emulsification treatment at a speed of 8000 - 10000 rpm to make the mixture form a uniform cream-like state. Finally, fill the emulsified cream into a sterile container with a filling machine and seal it for storage. The common cream in the control group does not add recombinant marine protein, and other ingredients and preparation methods are the same as those in the experimental group.
[0064] The experimental results are as Figure 3 and Figure 4 shown. After 2 weeks of using the recombinant marine protein cream, the skin moisture content of the volunteers in the experimental group increased significantly, with an average increase of 20%, while that in the control group only increased by 5%. After 4 weeks of use, the skin moisture content in the experimental group increased by an average of 25%, and that in the control group increased by 10%. At the same time, the skin elasticity of the volunteers in the experimental group was also significantly improved. After 2 weeks of use, the skin elasticity increased by an average of 15%, and after 4 weeks, it increased by an average of 25%. While the skin elasticity in the control group only increased by 5% and 10% at these two time points respectively.
[0065] Verification of the application effect of recombinant marine protein in the local treatment of dermatitis in Example 4
[0066] The application effect of recombinant marine protein in the local treatment of dermatitis was evaluated by establishing a mouse skin inflammation model. Twenty male mice aged 6 - 8 weeks with a body weight of 18 - 22 g were selected and randomly divided into two groups of 10 mice each. The mice were adaptively fed for 1 week before the experiment, during which they had free access to food and water.
[0067] A skin inflammation model was established by applying xylene, an inflammation inducer, to the back skin of mice. The specific operation was as follows: The hair on the back of the mice was shaved off, and after disinfection with 75% alcohol, an appropriate amount of xylene was evenly applied to the back skin of the mice, with the application area being approximately 2 cm × 2 cm. After application, obvious inflammatory reactions such as skin redness, swelling, and itching occurred in the mice. Two hours after the establishment of the inflammation model, the inflammatory sites of the experimental group mice were smeared with a gel containing recombinant marine protein, and the control group was smeared with a blank gel without recombinant marine protein, three times a day.
[0068] The preparation method of the recombinant marine protein gel was as follows: First, weigh 2 g of carbomer and 1 g of recombinant marine protein. Pour the carbomer into a stirrer, add an appropriate amount of distilled water (100 - 200 mL), and stir until completely dissolved. Then add the recombinant marine protein and continue to stir evenly. Finally, the prepared gel was filled into a sterile container with a filling machine and sealed for storage.
[0069] The blank gel of the control group did not add recombinant marine protein, and the other components and preparation methods were the same as those of the experimental group.
[0070] On the 1st, 3rd, 5th, and 7th days after applying the drugs, the changes in the skin inflammatory sites of the mice were observed respectively, including the degree of skin redness and swelling and whether there was exudate, and the observations were recorded. The observation results are shown in Tables 2 and 3. Skin tissue samples were collected for pathological analysis and inflammatory factor detection. After the skin tissue samples were collected, they were immediately frozen in liquid nitrogen and then stored in a -80 °C refrigerator for inflammatory factor detection. The inflammatory factor detection was performed by enzyme-linked immunosorbent assay (ELISA) method, and a corresponding kit was used to detect the expression levels of inflammatory factors TNF-α and IL-6 in the skin tissue. The detection results are as Figure 5 and Figure 6 shown.
[0071] Table 2 Degree of skin redness and swelling
[0072]
[0073] + indicates the severity, - indicates no redness and swelling
[0074] Table 3 Degree of skin exudate
[0075]
[0076] + indicates the severity, - indicates no exudate
[0077] Figure 5 and Figure 6The experimental results showed that the skin inflammatory response of the experimental group mice gradually alleviated after applying the recombinant marine protein gel. On the 3rd day, the degree of redness and swelling at the inflammatory site significantly decreased (Table 2), the skin color returned to normal, while the skin inflammatory response of the control group mice persisted, and the degree of redness and swelling did not significantly decrease (Table 2), and the itching was still obvious. The results of inflammatory factor detection showed that the expression levels of inflammatory factors TNF-α and IL-6 in the skin tissues of the experimental group mice gradually decreased after applying the recombinant marine protein gel and approached the normal level on the 7th day, while the levels of inflammatory factors in the skin tissues of the control group mice did not change significantly and remained at a relatively high level. The above results indicated that the recombinant marine protein could significantly alleviate the skin inflammatory response, promote the recovery of skin inflammation, and had a good effect on the local treatment of dermatitis.
[0078] Example 5 Verification of the Application Effect of Recombinant Marine Protein in Wound Dressings
[0079] The application effect of recombinant marine protein in wound dressings was verified by establishing a full-thickness skin defect model in mice. Twenty female mice aged 8 - 10 weeks with a body weight of 20 - 25 g were randomly divided into two groups, with 10 mice in each group. The mice were adaptively fed for 1 week before the experiment, during which they had free access to food and water. A full-thickness skin defect wound with a diameter of about 8 mm was created on the back of the mice. The specific operation was as follows: The hair on the back of the mice was shaved off, and after disinfection with 75% alcohol, a full-thickness skin defect wound was created on the back of the mice using an 8-mm round puncher to ensure that the wound edges were neat. Then the wounds of the experimental group mice were covered with a hydrogel dressing containing recombinant marine protein, and the control group was covered with a blank hydrogel dressing without recombinant marine protein. The dressings were changed once a day.
[0080] The preparation method of the recombinant marine protein hydrogel dressing was as follows: First, weigh 5 g of sodium alginate, 2.5 g of calcium chloride, and 2 g of recombinant marine protein. Pour sodium alginate into a stirrer, add an appropriate amount of distilled water of 200 - 500 mL, and stir until completely dissolved. Then add the recombinant marine protein and continue to stir evenly. Pour the mixture into a mold, add calcium chloride to make it solidify to form a hydrogel dressing. The prepared hydrogel dressing was placed in a freeze dryer for freeze-drying treatment to obtain a dry hydrogel dressing. Finally, the dry hydrogel dressing was sealed and stored in a sterile package.
[0081] The blank hydrogel dressing of the control group did not add recombinant marine protein, and other components and preparation methods were the same as those of the experimental group.
[0082] During the wound healing process, observe the wound healing condition every day, including the degree of wound contraction, the growth of new tissues, whether there is infection, etc., and take photos for record. At the same time, on the 7th, 14th, and 21st days after wound healing, collect wound tissue samples for healing effect evaluation. The wound healing rate is calculated by measuring the change in the wound scar area, and the wound scar area is measured by image analysis software to measure the area of the scar region. At the initial stage of wound healing (usually on the 0th day), measure and record the area of the wound scar, denoted as S 0 (unit: mm 2 ). During the subsequent healing process, at regular intervals (such as on the Nth day), measure the wound area again, denoted as S n . Calculate the wound healing rate (Wound Healing Rate, WHR) according to the following formula:
[0083]
[0084] The experimental results of the wound healing rate are as Figure 7 shown. The results show that the wound healing speed of the experimental group mice is significantly faster than that of the control group. On the 7th day, the wound healing rate of the experimental group reaches 60%, while that of the control group is only 40%; on the 14th day, the wounds of the experimental group are basically healed, and the healing rate reaches 90%, while the healing rate of the control group is only 70%; on the 21st day, the wounds of the experimental group are completely healed, with smaller scars and lighter colors, while the wounds of the control group heal more slowly, with larger scars and darker colors. The results show that the recombinant marine protein can significantly promote wound healing, improve the wound healing speed and quality, reduce scar formation, and has good application effects as a wound dressing.
[0085] The present invention provides an idea and method for a recombinant marine protein with antioxidant and anti-inflammatory effects, its preparation method and application. There are many methods and ways to specifically implement this technical solution. The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention. Each component not clearly defined in this embodiment can be realized by existing technologies.
Claims
1. A recombinant marine protein with antioxidant and anti-inflammatory effects, characterized in that: It comprises a partial domain of California mussel foot protein type 6 variant 1 and a partial domain of purple mussel foot protein type 5; the amino acid sequence of the partial domain of California mussel foot protein type 6 variant 1 is shown in SEQ ID NO.1; the amino acid sequence of the partial domain of purple mussel foot protein type 5 is shown in SEQ ID NO.
2.
2. The recombinant marine protein according to claim 1, characterized in that Its amino acid sequence is shown in SEQ ID NO.
3.
3. The gene encoding the recombinant marine protein according to claim 1 or 2.
4. The gene encoding the recombinant marine protein according to claim 3, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.
4.
5. An expression cassette or recombinant expression vector containing the gene encoding the recombinant marine protein according to claim 3.
6. A recombinant bacterium containing the expression cassette or recombinant expression vector according to claim 5.
7. The recombinant bacterium according to claim 6, characterized in that The base bacteria is Bacillus subtilis.
8. The method for preparing the recombinant marine protein according to claim 1 or 2, characterized in that: The coding gene of the recombinant marine protein is connected to a vector by homologous recombination to construct a recombinant expression vector, which is introduced into Bacillus subtilis to construct a recombinant Bacillus subtilis, which is inoculated into a fermentation medium for fermentation to obtain the vector; the vector is a pHT43 plasmid.
9. Use of the recombinant marine protein according to claim 1 in the preparation of antioxidant products and / or anti-inflammatory products and / or wound dressings.
10. The use according to claim 9, characterized in that: The antioxidant products and anti-inflammatory products are medicines and / or daily chemical products.
Citation Information
Cited By
Application of recombinant mussel protein dressing in preparation of medicine for promoting skin wound repair
CN121221833A