Simple iterative editing tool for bacillus subtilis and application of simple iterative editing tool
By optimizing the plasmid design and use methods, using a dual plasmid system and a temperature-sensitive replica protein, the problems of low efficiency and complex operation of Bacillus subtilis gene editing are solved, and efficient, accurate and low-cost gene editing is achieved, and multiple rounds of iterative editing is supported.
Patent Information
- Application Number
- CN202510333321.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-13
AI Technical Summary
In the prior art, Bacillus subtilis has low gene editing efficiency, complex operation process, insufficient editing accuracy, high cost and lack of iterative editing capabilities.
By optimizing the plasmid design and usage methods, using a dual plasmid system and temperature-sensitive replicated protein, the temperature screening and elimination of plasmids is achieved, the plasmid elimination and reintroduction steps are simplified, the sgRNA and Cas9n protein design is optimized, and the editing accuracy and stability are improved.
It significantly improves the efficiency of gene editing, shortens the editing cycle, supports rapid targeting and editing of multiple genes, reduces the instability of plasmids and the metabolic burden of host strains, and achieves low-cost and efficient multi-round iterative editing.
Smart Images

Figure CN120138017A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a simple iterative editing tool for Bacillus subtilis and its application. Background Art
[0002] As an important model microorganism, Bacillus subtilis has a wide range of applications in biotechnology and industrial production. With the development of genetic engineering technology, the demand for genome editing of Bacillus subtilis is increasing. Traditional gene editing methods, such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have problems such as cumbersome operation and low efficiency, which limit the application of Bacillus subtilis in biosynthesis and metabolic engineering.
[0003] In recent years, the CRISPR-Cas system, as a powerful gene editing tool, has been widely used in the genome editing of Bacillus subtilis. Although certain progress has been made in the application of the CRISPR-Cas system in Bacillus subtilis, the systems developed for Bacillus subtilis are relatively few and the functions are relatively single and cumbersome. Currently, the main editing systems include single-plasmid knockout systems and two-plasmid knockout systems. The single-plasmid system integrates Cas9, sgRNA, and donor DNA into one plasmid, with a simple operation process. However, since all elements are integrated on one plasmid vector, the plasmid is too large, resulting in low transformation efficiency. The two-plasmid system expresses Cas9 and sgRNA separately through two plasmids, and can achieve efficient gene editing. However, the two-plasmid system requires a large amount of time to eliminate plasmids in multiple rounds of editing, increasing the complexity of the operation. In addition, the instability of the plasmid and the adaptive burden of the host strain are also problems that need to be solved urgently.
[0004] To solve these problems, the present invention has developed a tool for simply and iteratively editing Bacillus subtilis, aiming to improve the efficiency and convenience of gene editing, while reducing the plasmid instability and the metabolic burden of the host strain. Through innovative plasmid design and usage methods, this tool has achieved efficient, stable, and iterative editing in Bacillus subtilis, providing strong technical support for the genomic research and industrial application of Bacillus subtilis. Summary of the Invention
[0005] Object of the Invention: The technical problem to be solved by the present invention is to provide a simple iterative editing tool for Bacillus subtilis and its application in view of the deficiencies of the prior art, so as to solve the problems of low gene editing efficiency, complex operation process, insufficient editing accuracy, high cost, and lack of iterative editing ability in the prior art.
[0006] To solve the above technical problems, the present invention discloses a simple iterative editing tool for Bacillus subtilis and its application. Through optimized plasmid design and usage methods, the present invention achieves efficient gene editing, significantly shortens the editing cycle, supports rapid targeting and editing of multiple genes, and meets the requirements of complex genome editing. At the same time, the present invention adopts a two-plasmid system, and realizes temperature screening and elimination of plasmids through a temperature-sensitive replication protein, simplifies the steps of plasmid elimination and re-introduction, and avoids the complexity of multiple transformations and screenings in the traditional two-plasmid system. In addition, through optimized sgRNA and Cas9n protein design, the present invention achieves precise editing at specific sites, reduces off-target effects, and uses the homology-directed repair mechanism to ensure the accuracy and stability of editing. The tool construction and usage costs of the present invention are relatively low, especially the synthesis cost of sgRNA is low, and the simplification of the operation process also greatly saves experimental time and labor costs. Through the temperature-sensitive replication protein, rapid elimination and re-introduction of plasmids are realized. The present invention supports multiple rounds of iterative editing. After editing one gene, the plasmid can be quickly eliminated and a new plasmid can be introduced for editing at a new site, achieving efficient multiple-round editing. Finally, through the temperature-sensitive replication protein, the stability and controllability of the plasmid are realized, avoiding the instability and metabolic burden of the plasmid in the host strain, ensuring the adaptability of the host strain, and not having a significant impact on the growth and metabolism of the host strain. In summary, the present invention provides a gene editing tool for Bacillus subtilis that is efficient, simple, precise, low-cost and has the ability of iterative editing, meeting the requirements of Bacillus subtilis genome editing in biotechnology and industrial production. The specific technical solutions are as follows:
[0007] A method for constructing a simple iterative gene editing tool for Bacillus subtilis, comprising the following steps:
[0008] (1) Construct a pQ-Cas9n plasmid, and the pQ-Cas9n plasmid contains a Cas9n protein coding gene;
[0009] (2) Construct a pC-TS plasmid, and the pC-TS plasmid includes an ampicillin resistance gene and its promoter, a p15A replicon, a constitutive promoter, and a temperature-sensitive replication protein gene with kanamycin resistance;
[0010] (3) The simple iterative gene editing tool for Bacillus subtilis is composed of the pQ-Cas9n plasmid and the pC-TS plasmid.
[0011] Among them, in step (1), the nucleotide sequence of the Cas9n protein coding gene is as shown in SEQ ID NO.5; the starting plasmid of the pQ-Cas9n plasmid is pHT01.
[0012] Among them, in step (1), the pQ-Cas9n plasmid is constructed as follows: the starting plasmid pHT01 is digested with BamHI and XbaI and then ligated with the Cas9n protein coding gene by homologous recombination. Preferably, the Cas9n protein coding gene is amplified by primers with sequences shown in SEQ ID NO.18 and SEQ ID NO.19 and then undergoes homologous recombination with the starting plasmid pHT01 digested with BamHI and XbaI.
[0013] Preferably, pQ-Cas9n contains ampicillin and chloramphenicol resistance. This plasmid can be amplified in Escherichia coli and can also replicate in Bacillus subtilis, enabling efficient editing of Bacillus subtilis. In addition, the expression of the Cas9n protein is initiated by an inducible promoter, ensuring genome editing of the bacteria when needed and reducing the harmful effects of the protein's leaky expression.
[0014] Among them, in step (2), the nucleotide sequence of the ampicillin resistance gene and its promoter is shown in SEQ ID NO.1; the nucleotide sequence of the p15A replicon is shown in SEQ ID NO.2; the constitutive promoter is pHpaII, and its nucleotide sequence is shown in SEQ ID NO.3; the nucleotide sequence of the temperature-sensitive replication protein repF gene with kanamycin resistance is shown in SEQ ID NO.4. The temperature-sensitive replication protein has the following characteristics: plasmids containing repF can replicate normally at 30 - 37 °C but cannot replicate at 42 °C, thus achieving plasmid elimination through temperature screening to realize the technical advantage of simple iterative editing in this patent.
[0015] Among them, in step (2), the pC-TS plasmid is constructed as follows: the following gene fragments with restriction enzyme sites at both ends are ligated by homologous recombination and screened for resistance to obtain the pC-TS plasmid:
[0016] Amplify the nucleotide sequence shown in SEQ ID NO.1 and make its 5' end and 3' end carry EcoRI and XbaI restriction enzyme sites (preferably, the amplification primer sequences are shown in SEQ ID NO.10 and SEQ ID NO.11);
[0017] Amplify the nucleotide sequence shown in SEQ ID NO.2 and make its 5' end and 3' end carry EcoRI and BamHI restriction enzyme sites (preferably, the amplification primer sequences are shown in SEQ ID NO.12 and SEQ ID NO.13);
[0018] Amplify the nucleotide sequence shown in SEQ ID NO.3 and add BamHI restriction sites and XbaI restriction sites at its 5' end and 3' end (preferably, the amplification primer sequences are shown in SEQ ID NO.14 and SEQ ID NO.15);
[0019] Amplify the nucleotide sequence shown in SEQ ID NO.4 and add EcoRI restriction sites and XbaI restriction sites at its 5' end and 3' end (preferably, the amplification primer sequences are shown in SEQ ID NO.16 and SEQ ID NO.17).
[0020] Preferably, the pC-TS plasmid contains two restriction sites: EcoRI and XbaI, and has a terminator (SEQ ID NO.20: ttcagaacgctcggttgccgccgggcgttttttat) after the XbaI restriction site. The plasmid can be linearized through these two restriction sites and ligated with the target sgRNA to serve as an sgRNA guiding plasmid. The sgRNA sequence is initiated by the constitutive promoter pHpaII to meet the positioning requirements, and a terminator is connected to its 3' end for transcription termination.
[0021] In a second aspect, the present invention provides an easily iterable gene editing tool for Bacillus subtilis constructed by the construction method described in the first aspect.
[0022] In a third aspect, the present invention provides the application of the easily iterable gene editing tool described in the second aspect in gene editing of the Bacillus subtilis genome. The easily iterable gene editing tool not only shows high efficiency in Bacillus subtilis, but also can be applied in other microorganisms, having wide applicability.
[0023] Among them, the Bacillus subtilis includes any one of Bacillus subtilis 168, Bacillus subtilis PY79 or Bacillus subtilis 1A976.
[0024] Fourthly, the present invention provides a method for gene editing of the Bacillus subtilis genome by using the easily iterable gene editing tool described in the third aspect, comprising the following steps: introducing the pQ-Cas9n plasmid into a Bacillus subtilis host bacterium to obtain a first engineered bacterium; amplifying a gene knockout cassette or a gene expression cassette of a gene to be edited, cloning it into the pC-TS plasmid, and introducing it into the first engineered strain to obtain a second engineered bacterium, thereby achieving the editing of the gene to be edited in the Bacillus subtilis genome. Preferably, the gene knockout cassette or the gene expression cassette of the gene to be edited comprises an sgRNA targeting the gene to be edited and a homologous repair sequence, and the gene knockout cassette or the gene expression cassette of the gene to be edited is cloned between the EcoRI and XbaI restriction sites of the pC-TS plasmid. More preferably, the gene to be edited is the aprE gene, and its nucleotide sequence is as shown in SEQ ID NO.6. The gene knockout cassette of the gene to be edited comprises an sgRNA targeting aprE and a homologous repair sequence, and its nucleotide sequence is as shown in SEQ ID NO.7.
[0025] Among them, the second engineered bacterium can be cultured at 42 °C for 36 - 48 h to eliminate the pC-TS plasmid and then continue to introduce the next pC-TS plasmid containing the gene knockout cassette or the gene expression cassette of the gene to be edited, thereby achieving iterative gene editing of the Bacillus subtilis genome. Preferably, the next gene to be edited is the nprE gene, and its nucleotide sequence is as shown in SEQ ID NO.8. The gene knockout cassette of the next gene to be edited comprises an sgRNA targeting nprE and a homologous repair sequence, and its nucleotide sequence is as shown in SEQ ID NO.9.
[0026] Beneficial effects:
[0027] The beneficial effects of the present invention are mainly reflected in the following aspects:
[0028] 1. Improving editing efficiency: Through optimized plasmid design and usage methods, the present invention achieves efficient gene editing, significantly shortening the editing cycle. At the same time, it supports rapid targeting and editing of multiple genes, meeting the requirements of complex genome editing. Traditional gene editing methods, such as zinc finger ribonucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have the problems of cumbersome operation and low efficiency. However, the dual-plasmid system of the present invention realizes rapid elimination and reintroduction of plasmids through temperature-sensitive replication proteins, greatly improving the editing efficiency.
[0029] 2. Simplified operation process: The present invention adopts a dual-plasmid system, and realizes temperature screening and elimination of plasmids through temperature-sensitive replication proteins, simplifying the steps of plasmid elimination and reintroduction. The traditional dual-plasmid system takes a lot of time to eliminate plasmids in multiple rounds of editing, which increases the complexity of the operation. The tool of the present invention realizes rapid elimination and reintroduction of plasmids through temperature-sensitive replication proteins, avoiding the complexity of multiple transformations and screening in traditional dual-plasmid systems, and greatly simplifying the operation process.
[0030] 3. Reduce costs: The plasmid construction and use costs of the present invention are relatively low, especially the synthesis cost of sgRNA is low. Traditional gene editing methods, such as ZFNs and TALENs, require complex protein engineering design, cumbersome operation, and high cost. The tool of the present invention greatly reduces the cost of plasmid construction and use through optimized plasmid design and use methods, and the simplification of the operation process also saves experimental time and labor costs.
[0031] 4. Realize iterative editing: The present invention realizes the rapid elimination and reintroduction of plasmids through temperature-sensitive replication proteins, and supports multiple rounds of iterative editing. After editing a gene, the plasmid can be quickly eliminated and a new plasmid can be introduced for new site editing, realizing efficient multiple rounds of editing. Traditional gene editing methods require a lot of time to eliminate plasmids in multiple rounds of editing, which increases the complexity of the operation. The tool of the present invention realizes the rapid elimination and reintroduction of plasmids through temperature-sensitive replication proteins, greatly improves the editing efficiency, and supports multiple rounds of iterative editing.
[0032] 5. Wide applicability: The tools of the present invention are applicable to any species of Bacillus subtilis, including but not limited to Bacillus subtilis 168, Bacillus subtilis PY79, Bacillus subtilis 1A976, etc. The CRISPR-Cas system not only shows high efficiency in Bacillus subtilis, but can also be used in other microorganisms, and has wide applicability. Traditional gene editing methods have limited applicability among different bacterial species, while the tools of the present invention have wide applicability through optimized plasmid design and use methods, meeting the genome editing needs of different bacterial species.
[0033] 6. Improve plasmid stability: The present invention achieves plasmid stability and controllability through temperature-sensitive replication proteins, avoiding the instability and metabolic burden of plasmids in host strains. In traditional gene editing methods, the instability of plasmids and the adaptive burden of host strains are urgent problems to be solved. The tool of the present invention achieves plasmid stability and controllability through temperature-sensitive replication proteins, ensuring the adaptability of host strains, and will not significantly affect the growth and metabolism of host strains.
[0034] In summary, the present invention provides a Bacillus subtilis gene editing tool that is efficient, simple, low-cost and has iterative editing ability, with significant beneficial effects, meeting the needs of Bacillus subtilis genome editing in biotechnology and industrial production, and providing strong technical support for the genome research and industrial application of Bacillus subtilis. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] The following further specifically describes the present invention in conjunction with the drawings and specific embodiments, and the above and / or other advantages of the present invention will become clearer.
[0036] Figure 1 It is the plasmid map of pC-TS.
[0037] Figure 2 It is the plasmid map of pQ-Cas9n.
[0038] Figure 3 It is the nucleic acid electrophoresis map of single gene knockout of aprE using the tool and editing method of the present invention. From left to right, the first lane is the size of the original aprE gene, and the 2nd - 7th lanes are the sizes of the residual nucleic acids after the aprE gene is knocked out in 6 transformants.
[0039] Figure 4 It is the nucleic acid electrophoresis map of iterative knockout of nprE on the basis of knocking out aprE using the tool and editing method of the present invention. From left to right, the first lane is the size of the original nprE gene, and the 2nd - 7th lanes are the sizes of the residual nucleic acids after the nprE gene is knocked out in 6 transformants.
[0040] Figure 5 It is the nucleic acid electrophoresis map of knocking out nprE in different Bacillus strains using the tool and editing method of the present invention. From left to right, the first lane is the size of the original nprE gene, and the 2nd - 4th lanes are Bacillus subtilis 168, Bacillus subtilis PY79 and Bacillus subtilis 1A976 respectively. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0041] The following further explains the present invention in conjunction with embodiments, which can better understand the present invention. The following embodiments are only used to illustrate the present invention and do not limit the scope of implementation of the present invention.
[0042] Example 1 Construction and Usage Method of a Simple Iterative Editing Tool
[0043] 1. Experimental Materials and Reagents
[0044] Bacillus subtilis strain 168; Escherichia coli competent cell DH5α; PCR amplification kit; restriction enzymes EcoRI, BamHI and XbaI; DNA ligase (homologous recombination enzyme Exnase lI); ampicillin (working concentration: 100 μg / mL), chloramphenicol (working concentration: 50 μg / mL), kanamycin (working concentration: 5 μg / mL) (for screening transformants); LB medium; pHT01 plasmid (carrying the inducible promoter Pgrac).
[0045] 2. Construction of the editing tool plasmid
[0046] (1) Construction of the pC-TS plasmid:
[0047] Synthesize the fragment Amp (nucleotide sequence shown in SEQ ID NO.1) with ampicillin resistance and its promoter, the fragment p15A ori (nucleotide sequence shown in SEQ ID NO.2) with the p15A ori replicon, the constitutive promoter pHpaII (nucleotide sequence shown in SEQ ID NO.3), and the fragment repF-k (nucleotide sequence shown in SEQ ID NO.4) with the temperature-sensitive replication protein repF and kanamycin resistance respectively.
[0048] Using the synthesized Amp fragment with the nucleotide sequence shown in SEQ ID NO.1 as a template, perform PCR amplification of the Amp fragment using primers F-Amp and R-Amp. The amplification conditions are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for 30 cycles; final extension at 72°C for 10 min. The amplification product is detected by agarose gel electrophoresis, and the gel is cut and recovered to obtain the Amp fragment. In the same way, perform PCR amplification of the synthesized p15A ori fragment using primers F-p15A and R-p15A to obtain the p15A ori fragment. Perform PCR amplification of the synthesized pHpaII fragment using primers F-pHpaII and R-pHpaII to obtain the pHpaII fragment. Perform PCR amplification of the synthesized repF-k fragment using primers F-Kna and R-repF to obtain the repF-k fragment. The primer sequences used are shown in Table 1.
[0049] Table 1 Primer sequences
[0050] Primer Sequence (5’-3’) F-Amp ccaatttcctttttgcgtgtgatgcgggtaactagcctcgccgatcccgcaagagg(SEQ ID NO.10) R-Amp catttccgctcgccgcagtcgaacgacagttaccaatgcttaatcag(SEQ ID NO.11) F-p15A ctgattaagcattggtaactgtcgttcgactgcggcgagcggaaatg(SEQ ID NO.12) R-p15A cccgattgctgaacagattaataatagattttaggcctagaaatattttatctg(SEQ ID NO.13) F-pHpaII cagataaaatatttctaggcctaaaatctattattaatctgttcagcaatcggg(SEQ ID NO.14) R-pHpaII cggcggcaaccgagcgttctgaatctagagaattctaaatcgctcctttttaggtggc(SEQ ID NO.15) F-Kna gaacgctcggttgccgccgggcgttttttatgaggtcatcgttcaaaatggtatgcg(SEQ ID NO.16) R-repF cctcttgcgggatcggcgaggctagttacccgcatcacacgcaaaaaggaaattgg(SEQ ID NO.17) F-Cas9n cccaattaaaggaggaaggatcagtaggatccatggataagaaatactcaataggc(SEQ ID NO.18) R-Cas9n cgggctgccccggggacgtcgactctagattagtcacctcctagctgactcaaatc(SEQ ID NO.19)
[0051] Perform digestion and ligation reactions on the above 4 fragments obtained by PCR amplification and gel extraction. First, perform double digestion on fragment Amp with EcoRI and XbaI, on fragment p15A ori with EcoRI and BamHI, on fragment pHpaII with BamHI and XbaI, and on fragment repF-k with EcoRI and XbaI. After detecting the digestion products by agarose gel electrophoresis, cut and extract the gel. Perform ligation reaction on the 4 recovered fragments, transform the ligation products into competent Escherichia coli cells, coat them on LB solid medium containing ampicillin and kanamycin, and culture at 37 °C for 12 - 16 h. Select single colonies for colony PCR identification, and send the positive clones for sequencing verification. The plasmid with correct sequencing results is the successfully constructed pC-TS plasmid. The pC-TS plasmid obtained through the above amplification, digestion, and ligation steps also carries the terminator lambda t0 terminator (nucleotide sequence as shown in SEQ ID NO.20). The plasmid map of pC-TS is as Figure 1 shown.
[0052] (2) Construction of pQ-Cas9n plasmid:
[0053] General Biosystems synthesized the Cas9n fragment (nucleotide sequence as shown in SEQ ID NO.5). Using the synthesized Cas9n fragment as a template, perform PCR amplification with primers F-Cas9n and R-Cas9n. The amplification conditions are the same as above, and the primers are shown in Table 1. After detecting the amplification products by agarose gel electrophoresis, cut and extract the gel to obtain the Cas9n fragment.
[0054] Perform double digestion on plasmid pHT01 with BamHI and XbaI endonucleases. After detecting the digestion products by agarose gel electrophoresis, cut and extract the gel.
[0055] Perform ligation reaction on the recovered Cas9n fragment and the linearized pHT01 plasmid. Transform the ligation products into competent Escherichia coli cells, coat them on LB solid medium containing ampicillin and chloramphenicol, and culture at 37 °C for 12 - 16 h. Select single colonies for colony PCR identification, and send the positive clones for sequencing verification. The plasmid with correct sequencing results is the successfully constructed pQ-Cas9n plasmid, as Figure 2 shown.
[0056] 3. Use of editing tools
[0057] (1) Preparation of competent cells: Prepare competent cells of Bacillus subtilis 168 by chemical transformation method and electroporation method respectively.
[0058] Chemical transformation method: Bacillus subtilis 168 was cultured to the logarithmic growth phase, and the cells were collected. After washing twice with ice-cold 0.5 M CaCl 2 solution and centrifuging to remove the supernatant, the cells were suspended in CaCl 2 solution to prepare competent cells. The competent cells were aliquoted and stored at -80 °C in the refrigerator for later use.
[0059] Electroporation method: Bacillus subtilis 168 was cultured to the logarithmic growth phase, and the cells were collected. After washing twice with ice-cold electroporation buffer (electroporation buffer: 10% v / v glycerol, 0.5 M mannitol, 0.5 M sorbitol) and centrifuging to remove the supernatant, the cells were suspended in the electroporation buffer to prepare competent cells. The competent cells were aliquoted and stored at -80 °C in the refrigerator for later use.
[0060] (2) Plasmid transformation: The constructed pQ-Cas9n plasmid (2 - 3 μg) was transformed into the competent cells of Bacillus subtilis (500 μL) prepared by the chemical transformation method or the electroporation method respectively. For the chemical transformation method, the competent cells were thawed in an ice bath, the pQ-Cas9n plasmid was added, gently mixed, then heat-shocked in a 42 °C water bath for 90 s, quickly placed in an ice bath and allowed to stand for 2 min. Then an appropriate amount of LB medium was added, and the cells were cultured with shaking at 37 °C for 1 h. Finally, the cells were spread on an LB solid medium containing chloramphenicol and cultured at 37 °C for 12 - 16 h. For the electroporation method, the competent cells were thawed in an ice bath, the pQ-Cas9n plasmid was added, quickly transferred to an electroporation cuvette, and electroporated with a pulse electroporator (electroporation conditions: 2.5 kV, 4 ms, 200 Ω). After electroporation, an appropriate amount of LB medium was immediately added, and the cells were cultured with shaking at 37 °C for 1 h. Finally, the cells were spread on an LB solid medium containing chloramphenicol and cultured at 37 °C for 12 - 16 h. Single colonies were selected for colony PCR identification, and the positive clones were the successfully transformed strain BS(pQ-Cas9n).
[0061] The successfully transformed strain BS(pQ-Cas9n) was prepared into competent cells by the chemical transformation method or the electroporation method respectively, and then the pC-TS plasmid was transformed into them (2 - 3 μg plasmid was transferred into 500 μL competent cells). The transformation method was the same as above, except that chloramphenicol and kanamycin were added to the medium for screening. The transformed strain was the engineered bacterium that could be used for gene editing.
[0062] (3) Gene editing operation: According to the gene locus to be edited, design and synthesize the gene knockout cassette or gene expression cassette of the gene to be edited (both the gene expression cassette and the gene knockout cassette include sgRNA sequences and homologous repair sequences). Insert the synthesized gene knockout cassette or gene expression cassette sequence between the EcoRI and XbaI restriction sites of the pC-TS plasmid to construct a pC-TS plasmid containing the target sgRNA.
[0063] Transform the constructed pC-TS plasmid containing the target sgRNA into the engineering bacterium BS(pQ-Cas9n) by the same method as above. The transformed strain is cultured in an environment of 30 - 37 °C (specifically 30 °C in this example) so that the pC-TS plasmid can replicate normally, and the Cas9n protein is expressed under the control of the IPTG-regulated inducible promoter Pgrac. The induction process is as follows: when the strain grows to the logarithmic growth phase (OD600 is 0.5 - 1), add the inducer IPTG for induced expression for 24 - 48 h (36 h in this example), and the added concentration of IPTG is 0.1 - 1 mM (0.2 mM in this example). After binding with the sgRNA, it edits the target gene locus.
[0064] During the editing process, regularly sample for PCR amplification and sequencing analysis to detect the editing situation of the target gene locus. According to the editing results, adjust the editing conditions, such as induction time, inducer concentration, etc., to improve the editing efficiency. After the editing is completed (that is, PCR amplification and sequencing analysis show that the target gene locus has been successfully edited), transfer the strain to an environment of 42 °C and culture for one generation for 48 h. Utilize the characteristics of the temperature-sensitive replication protein repF to make the pC-TS plasmid unable to replicate and be eliminated. During the culture process, observe the growth state of the strain and the plasmid elimination situation. Confirm that the pC-TS plasmid has been successfully eliminated by extracting the plasmid DNA of the strain and performing electrophoresis analysis.
[0065] (4) Multiple rounds of iterative editing: After completing one round of gene editing, if other gene loci need to be edited, the pC-TS plasmid with the new editing locus can be introduced into the engineering strain that has eliminated the pC-TS plasmid according to the above method, and the editing process is repeated to achieve multiple rounds of iterative editing.
[0066] During multiple rounds of iterative editing, pay attention to optimizing the editing conditions and plasmid elimination methods to improve the editing efficiency and accuracy. At the same time, conduct detailed phenotypic and genotypic analyses on the strains after each round of editing to ensure that the editing effect meets the expectations.
[0067] Example 2 Knockout of a single gene aprE in Bacillus subtilis
[0068] Knock out aprE (the nucleotide sequence is shown in SEQ ID NO.6) in Bacillus subtilis 168. The specific steps are as follows:
[0069] (1) Plasmid construction: Design and synthesize the corresponding gene knockout cassette (including sgRNA and its homologous repair arm sequence, as shown in SEQ ID NO.7) according to the sequence of the gene aprE, so that it can specifically target the gene aprE. Insert the synthesized gene knockout cassette shown in SEQ ID NO.7 into the EcoRI and XbaI restriction sites of the pC-TS plasmid constructed in Example 1 by the plasmid construction method described in Example 1 to construct the pC-TS plasmid targeting aprE.
[0070] (2) Preparation of competent cells and plasmid transformation: Prepare competent cells of Bacillus subtilis 168 by electroporation and transform the pQ-Cas9n plasmid into the competent cells to obtain the transformant BS(pQ-Cas9n). Transform the pC-TS plasmid targeting aprE into BS(pQ-Cas9n) by electroporation or chemical transformation to obtain the engineering bacteria for gene knockout.
[0071] (3) Gene knockout operation: Culture the engineering bacteria prepared in step (2) at 30 °C, induce the expression of Cas9n protein according to the method described in Example 1, and cut the gene aprE after binding with sgRNA. During the culture process, promote the knockout and repair of the gene aprE through the homologous repair fragment added in pC-TS. Regularly sample for PCR amplification and sequencing analysis to detect the knockout situation of the gene aprE.
[0072] (4) Plasmid elimination and verification: After editing, transfer the strain to 42 °C for one generation of culture for 48 h to eliminate the pC-TS plasmid targeting aprE.
[0073] Randomly pick the genomic DNA of 6 transformants, perform PCR amplification and sequencing analysis to verify whether the gene aprE has been successfully knocked out, and it is found that the aprE gene fragment becomes smaller, indicating successful knockout. As Figure 3 shown, the aprE gene of all 6 transformants has been successfully knocked out, and the knockout efficiency reaches 100% (the calculation method of the knockout efficiency is the number of strains with the target gene successfully knocked out / the total number of strains picked * 100%, here it is 6 / 6 * 100% = 100%).
[0074] The results showed that: (1) Evaluation of gene knockout efficiency: Through sequencing analysis, it was confirmed that the gene aprE was successfully knocked out in Bacillus subtilis 168, and the knockout efficiency reached 100%. (2) Evaluation of plasmid elimination effect: Through electrophoresis analysis, the pC-TS plasmid was successfully eliminated after culturing at 42°C, and the growth state of the strain was good (the OD of the plasmid-eliminated strain and the non-eliminated strain 600 data was comparable), and it was not affected by the plasmid elimination process.
[0075] In this example, the engineered strain that successfully knocked out the aprE gene and eliminated the pC-TS plasmid was named BS(pQ-Cas9n)-ΔaprE.
[0076] Example 3 Editing of multiple genes aprE and nprE in Bacillus subtilis
[0077] The Bacillus subtilis BS(pQ-Cas9n)-ΔaprE in which aprE was knocked out in Example 2 was iteratively edited to knock out nprE to improve its extracellular protein degradation effect. The nucleotide sequence of nprE is shown in SEQ ID NO.8, and the specific steps are as follows:
[0078] (1) Plasmid construction: According to the gene nprE sequence, the corresponding gene knockout cassette (including sgRNA and its homologous repair arm sequence, as shown in SEQ ID NO.9) was designed and synthesized. The gene knockout cassette shown in SEQ ID NO.9 was inserted between the EcoRI and XbaI restriction sites of the pC-TS plasmid constructed in Example 1 by the plasmid construction method described in Example 1 to construct a pC-TS plasmid targeting nprE.
[0079] (2) Preparation of competent cells and plasmid transformation: The competent cells of Bacillus subtilis BS(pQ-Cas9n)-ΔaprE constructed in Example 2 were prepared by the chemical transformation method, and then the pC-TS plasmid targeting nprE was transformed into the BS(pQ-Cas9n)-ΔaprE competent cells for editing of the gene nprE. After the editing was completed, the strain was cultured for one generation at 42°C to eliminate the pC-TS plasmid targeting nprE.
[0080] (3) Gene editing operation: In each round of editing process, the engineered bacteria were cultured at 30°C according to the induction expression method described in Example 2 to induce the expression of Cas9n protein, which combined with the corresponding sgRNA to cut and edit the target gene. By adding homologous repair fragments, precise editing of the gene nprE was achieved. Samples were taken regularly for PCR amplification and sequencing analysis to detect the gene editing situation.
[0081] (4) Plasmid curing and verification: After each round of editing, the strain was transferred to an environment at 42 °C for one generation of cultivation for 48 h to cure the pC-TS plasmid targeting aprE.
[0082] Six transformants were randomly selected, genomic DNA was extracted, PCR amplification and sequencing analysis were performed to verify whether the gene nprE was successfully edited. As Figure 4 shown, the nprE gene was successfully knocked out in all six transformants, and the knockout efficiency reached 100%.
[0083] The results showed that (1) Gene editing efficiency: Through sequencing analysis, it was confirmed that the genes aprE and nprE were successfully edited in Bacillus subtilis 168, and the editing efficiency reached 100% for both. (2) Evaluation of plasmid curing effect: Through electrophoresis analysis, the pC-TS plasmid was successfully cured during the 42 °C cultivation after each round of editing, and the growth and metabolism of the strain were not significantly affected (the OD 600 data of the plasmid-cured strain and the uncured strain were comparable).
[0084] Example 4 Gene editing of Bacillus subtilis from different sources
[0085] In this example, the same gene editing (knocking out the gene nprE) was performed on Bacillus subtilis strains from different sources (such as Bacillus subtilis 168, Bacillus subtilis PY79, and Bacillus subtilis 1A976) to verify the applicability of the tool of the present invention. The specific steps are as follows:
[0086] (1) Plasmid construction: According to the conserved sequence of the gene nprE, the corresponding gene knockout cassette (the nucleotide sequence is shown in SEQ ID NO.9) was designed and synthesized. The SEQ ID NO.9 sequence was inserted between the EcoRI and XbaI restriction sites of the pC-TS plasmid to construct the pC-TS plasmid targeting nprE.
[0087] (2) Preparation of competent cells and plasmid transformation: The competent cells of different Bacillus subtilis strains (competent cells of Bacillus subtilis PY79 and competent cells of Bacillus subtilis 1A976) were prepared by chemical transformation or electroporation. The pQ-Cas9n plasmid was transformed into the competent cells of the above two strains by chemical transformation or electroporation respectively to obtain the corresponding transformants. The pC-TS plasmid targeting nprE was transformed into the above transformants respectively to obtain the engineering bacteria that can be used for gene knockout.
[0088] (3) Gene knockout operation: Different engineered bacteria were respectively induced to express Cas9n protein according to the method described in Example 1. After binding with sgRNA, the gene nprE was cleaved. During the cultivation process, by adding homologous repair fragments, the knockout and repair of the gene nprE were promoted. Samples were taken regularly for PCR amplification and sequencing analysis to detect the knockout situation of the gene nprE, as Figure 5 shown.
[0089] (4) Plasmid elimination and verification: After editing, the strains obtained in step (3) were respectively transferred to a 42 °C environment for one generation of cultivation for 48 h, so that the pC-TS plasmid targeting nprE was eliminated. Genomic DNA of different strains was extracted for PCR amplification and sequencing analysis to verify whether the gene nprE was successfully knocked out.
[0090] The results showed that: (1) Evaluation of gene knockout efficiency: Through sequencing analysis, it was confirmed that the gene nprE was successfully knocked out in different Bacillus subtilis strains, and the knockout efficiency was between 100%, indicating that the tool of the present invention is applicable to Bacillus subtilis strains from different sources. (2) Evaluation of plasmid elimination effect: Through electrophoresis analysis, the pC-TS plasmid was successfully eliminated after cultivation at 42 °C in different strains, and the growth state of the strains was good (the OD 600 data of the plasmid-eliminated strains and the non-eliminated strains were comparable), and it was not affected by the plasmid elimination process. After cultivation at 42 °C, by extracting the plasmid DNA of the strains and performing electrophoresis analysis, it was confirmed that the pC-TS plasmid had been successfully eliminated. At the same time, observing the growth state of the strains after cultivation at 42 °C, it was found that their growth was not significantly affected, indicating that the plasmid elimination process had no significant negative impact on the growth and metabolism of the host strains. In addition, in the continuous cultivation experiment of the edited strains, it was found that the growth curve of the plasmid-eliminated strains after cultivation at 42 °C had no obvious difference compared with that of the strains without plasmid elimination, indicating that the plasmid elimination process had no inhibitory effect on the growth of the strains.
[0091] The present invention verifies the editing status of target gene loci by performing PCR amplification and sequencing analysis on the edited Bacillus subtilis genome. The results show that the editing tool of the present invention can efficiently achieve gene editing of Bacillus subtilis, with the editing success rate significantly higher than that of traditional methods, and can simultaneously perform rapid targeting and editing of multiple gene loci, greatly shortening the editing cycle. For example, when editing the aprE gene locus of Bacillus subtilis 168, the editing success rate of the editing tool of the present invention can reach 100%, which is significantly higher than the editing efficiency of existing literature, such as the editing methods in [Editing of the Bacillus subtilis Genome by the CRISPR-Cas9 System.], [NewCRISPR-Cas9 vectors for genetic modifications of Bacillus species.] or [Fragment Exchange Plasmid Tools for CRISPR / Cas9-Mediated Gene Integrationand Protease Production in Bacillus subtilis.], the highest knockout efficiency of which is 97%. While for the editing method in [A Simplified Method for CRISPR-Cas9 Engineering of Bacillussubtilis.], the knockout efficiency is only 89%.
[0092] Through multiple rounds of iterative editing experiments, the continuous editing of different gene loci of Bacillus subtilis was successfully carried out, demonstrating that the tool of the present invention has good iterative editing ability and can meet the requirements of complex genome editing. For example, in two rounds of iterative editing experiments on Bacillus subtilis 168, the editing success rate of the first round was 100%, and the editing success rate of the second round was 100%. Moreover, the strains after two rounds of editing both showed the expected phenotypic and genotypic characteristics, indicating that the tool of the present invention has high stability and reliability in multiple rounds of iterative editing.
[0093] The embodiments involved in the present invention fully demonstrate the effectiveness and superiority of the simple iterative gene editing tool of Bacillus subtilis of the present invention and its usage method. Through optimized plasmid design and usage method, this tool achieves efficient gene editing, significantly shortens the editing cycle, and supports rapid targeting and editing of multiple genes. Meanwhile, the use of temperature-sensitive replication proteins enables temperature screening and elimination of plasmids, simplifies the steps of plasmid elimination and reintroduction, reduces plasmid instability and the metabolic burden of host strains, has broad application prospects, provides strong technical support for genomic research and industrial applications of Bacillus subtilis, and reflects the creativity of the present invention.
[0094] The present invention provides a simple iterative gene editing tool for Bacillus subtilis and the ideas and methods for its application. There are many methods and ways to specifically implement this technical solution. The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention. Each component not clearly defined in this embodiment can be realized by existing technologies.
Claims
1. A method for constructing a simple iterative editing tool for Bacillus subtilis, characterized in that: The steps include: (1) constructing a pQ-Cas9n plasmid, wherein the pQ-Cas9n plasmid contains a Cas9n protein encoding gene; (2) constructing a pC-TS plasmid, wherein the pC-TS plasmid includes an ampicillin resistance gene and its promoter, a p15A replicon, a constitutive promoter, and a temperature-sensitive replication protein gene with kanamycin resistance; (3) A simple iterative editing tool for Bacillus subtilis composed of pQ-Cas9n plasmid and pC-TS plasmid.
2. The construction method according to claim 1, characterized in that: In step (1), the nucleotide sequence of the Cas9n protein encoding gene is shown in SEQ ID NO.5; the starting plasmid of the pQ-Cas9n plasmid is pHT01.
3. The construction method according to claim 2, characterized in that: In step (1), the pQ-Cas9n plasmid is constructed as follows: the starting plasmid pHT01 is double-digested with BamHI and XbaI and then connected with the Cas9n protein encoding gene by homologous recombination to obtain the pQ-Cas9n plasmid.
4. The construction method according to claim 1, characterized in that: In step (2), the nucleotide sequence of the ampicillin resistance gene and its promoter is shown in SEQ ID NO.1; The nucleotide sequence of the p15A replicon is shown in SEQ ID NO.2; The constitutive promoter is pHpaII, and its nucleotide sequence is shown in SEQ ID NO.3; The nucleotide sequence of the temperature-sensitive replication protein gene with kanamycin resistance is shown in SEQ ID NO.
4.
5. The construction method according to claim 4, characterized in that: In step (2), the pC-TS plasmid is constructed as follows: the following gene fragments with restriction sites at both ends are connected by homologous recombination and resistance screening to obtain the pC-TS plasmid: Amplify the nucleotide sequence shown in SEQ ID NO.1 and add EcoRI restriction site and XbaI restriction site to its 5' end and 3' end respectively; Amplify the nucleotide sequence shown in SEQ ID NO.2 and add EcoRI and BamHI restriction sites at its 5' and 3' ends; Amplify the nucleotide sequence shown in SEQ ID NO.3 and add BamHI restriction site and XbaI restriction site to its 5' end and 3' end; The nucleotide sequence shown in SEQ ID NO. 4 was amplified and the 5' and 3' ends thereof were provided with EcoRI and XbaI restriction sites.
6. A simple iterative editing tool constructed by the construction method according to any one of claims 1 to 5.
7. Use of the simple iterative editing tool according to claim 6 in genome editing of Bacillus subtilis.
8. The use according to claim 7, characterized in that: The Bacillus subtilis includes any one of Bacillus subtilis 168, Bacillus subtilis PY79 or Bacillus subtilis 1A976.
9. A method for gene editing of the Bacillus subtilis genome using the simple iterative editing tool according to claim 6, characterized in that: The method comprises the following steps: introducing the pQ-Cas9n plasmid into a Bacillus subtilis host bacterium to obtain a first engineered bacterium; amplifying a gene knockout box or a gene expression box of a gene to be edited and cloning it into a pC-TS plasmid, and introducing it into the first engineered bacterium to obtain a second engineered bacterium, thereby realizing editing of the gene to be edited in the Bacillus subtilis genome.
10. The method according to claim 9, characterized in that The second engineered bacteria is cultured at 42° C. for 36-48 hours to eliminate the pC-TS plasmid, and then the next pC-TS plasmid containing a gene knockout cassette or a gene expression cassette of the gene to be edited can be introduced to achieve iterative gene editing of the Bacillus subtilis genome.