Saccharomyces cerevisiae engineering bacteria with high yield of mannan as well as construction method and application thereof
The construction of Saccharomyces cerevisiae engineering bacteria with high mannan yield through CRISPR/Cas9 gene editing technology solved the problem of low purity of the existing Saccharomyces cerevisiae mannosum protein, and achieved efficient production of mannosum protein with high purity, significantly improving the astringency and overall quality of the wine.
Patent Information
- Application Number
- CN202510391974.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-06-13
AI Technical Summary
The existing Saccharomyces cerevisiae mannose protein is not very purity, and it is difficult to effectively regulate the astringency and overall quality of the wine.
Through CRISPR/Cas9 gene editing technology, a highly mannan-produced Saccharomyces cerevisiae engineering bacteria was constructed. The specific methods include constructing pCas9-426-ΔSMI1 and pCas9-426-ΔFKS1 plasmids, overexpressing the ALG5 gene in the GDP-mannose pathway, and further knocking out the MNN2 gene to obtain unbranched mannose protein on the N-glycosylated outer chain.
A high yield of mannan protein has been achieved, with a significantly improved purity to 89.94%, which can effectively balance the astringency and softness of the wine, while improving the color and colloid stability and improving the overall quality of the wine.
Smart Images

Figure CN120138020A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of brewing microorganisms, and particularly relates to an engineered Saccharomyces cerevisiae strain and a method for constructing the same, as well as the application of a mannoprotein with a specific structure produced by fermenting the engineered Saccharomyces cerevisiae strain in regulating the astringency of wine. Background Art
[0002] Yeast mannoprotein is a non-filamentous glycoprotein located on the outermost layer of the yeast cell wall. As a natural functional component, it has biological activities in improving intestinal health, stimulating immunity, antioxidation, reducing blood lipids, adsorbing mycotoxins, etc. It is applied in the production of mannan oligosaccharides, biological emulsifiers, nutritional health foods, fruit preservation, animal nutrition and wine, and is currently widely used as a wine stabilizer. Yeast mannoprotein can act on substances such as anthocyanins, tannins, lactic acid bacteria, aromatic substances and proteins in wine, can stabilize anthocyanins and tannins in wine, accelerate the malolactic fermentation process, retain aromatic substances, and enhance the protein stability in wine, thereby effectively improving the quality of wine. The special structure of mannoprotein can serve as the action point for glycan chain branched glycosylation, and glycosylation can directly act on the easily precipitated proteins to enhance their stability and prevent protein precipitation, thereby achieving the purpose of regulating the quality of wine.
[0003] Research progress on the N-glycosylation and O-glycosylation synthesis pathways and process control gene modification strategies of yeast mannoprotein provides new technologies for the efficient production of mannoprotein. Kwak et al. overexpressed the PMI40, SEC53 and PSA1 genes encoding mannose 6-phosphate isomerase, phosphomannomutase and GDP-mannose pyrophosphorylase in Saccharomyces boulardii, formed a combined strong promoter PTDH3 to enhance the GDP-mannose pathway. The mannan content in the cell wall of the obtained SbM2-p strain was 5.8 times higher than that of the wild type (0.37 mg / g cell dry weight). On this basis, the SED1 and DPM1 genes were overexpressed under the control of PTDH3, and the mannan content in the cell wall of the obtained SbM2SD-p strain was 12.7% higher than that of the SbM2-p strain, that is, 2.835 mg / g cell dry weight.
[0004] Mannoproteins produced by different yeasts vary greatly in their composition, structure and function. Currently, mannoprotein from Saccharomyces cerevisiae is mostly used in the market, which has a higher mannose / glucose ratio than other yeasts, but the current purity is not high. The purity of mannoprotein MP60 from Angel Yeast only reaches 60%. To promote the wide commercial application of yeast mannoprotein, it is necessary to select a Saccharomyces cerevisiae strain with high mannoprotein production and good effect in regulating the astringency of wine. Summary of the Invention
[0005] The object of the present invention is to provide a genetically engineered Saccharomyces cerevisiae strain with high mannan production and a method for constructing the same through advanced genetic engineering techniques.
[0006] The genetically engineered Saccharomyces cerevisiae strain with high mannan production provided by the present invention is constructed by the following method:
[0007] Step 1: Construct the plasmids pCas9-426-ΔSMI1 and pCas9-426-ΔFKS1
[0008] Design 20bp sgRNAs for the SMI1 gene and the FKS1 gene, replace the 20bp base sequence at the sgRNA position on the gRNA / Cas9 co-expression free plasmid pCas9-426-2 using Snapgene software and design linearization primers; using the plasmid pCas9-426-2 as a template, perform double digestion with MluI-NsiI and amplify by PCR using the linearization primers. The obtained vector and fragment are ligated by Gibson to obtain the plasmids pCas9-426-ΔSMI1 and pCas9-426-ΔFKS1 respectively.
[0009] The sequence of the 20bp sgRNA of the above SMI1 gene is: acgtccacggagtcaaacga
[0010] The sequence of the 20bp sgRNA of the above FKS1 gene is: tgaaggcgacaactccctag
[0011] The sequences of the linearization primers for constructing the plasmid pCas9-426-ΔSMI1 are as follows:
[0012] SMI1-FOR: tcaaacgagttttagagctagaaatagcaagt
[0013] SMI1-REV: ttgtgagtttagtatacatgcatttacttataatacagttttttagttttg
[0014] SMI1-sgRNA-F: tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa
[0015] SMI1-sgRNA-R: tttctagctctaaaactcgtttgactccgtggacgtgatcatttatctttcactgc
[0016] The sequences of the linearization primers for constructing the plasmid pCas9-426-ΔFKS1 are as follows:
[0017] FKS1 - FOR: ctccctaggttttagagctagaaatagcaagt
[0018] FKS1 - REV: gaagctctaatttgtgagtttagtatacatgc
[0019] FKS1 - sgRNA - F: tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa
[0020] FKS1 - sgRNA - R: gctatttctagctctaaaacctagggagttgtcgccttcagatcatttat
[0021] Step 2: Construct the free homologous arm donor fragment UP - SMI1 - DOWN
[0022] Using the genome of Saccharomyces cerevisiae BY4741 as a template, with primers SMI1 - up - F and SMI1 - up - R, the upstream homologous arm fragment SMI1 - UP of the SMI1 gene was amplified by high - fidelity enzyme fastPfu PCR. With primers SMI1 - down - F and SMI1 - down - R, the downstream homologous arm fragment SMI1 - DOWN of the SMI1 gene was amplified by high - fidelity enzyme fastPfu PCR. Finally, the free homologous arm donor fragment UP - SMI1 - DOWN of the SMI1 gene was obtained by overlapping extension PCR using primers SMI1 - up - F and SMI1 - down - R.
[0023] The sequences of the above - mentioned primers are as follows:
[0024] SMI1 - up - F: cctacttcgagatcaaaagaat
[0025] SMI1 - up - R: gagatcttttgacctgaccattgttgctgtt
[0026] SMI1 - down - F: atggtcaggtcaaaagatctcaacaaggtttatc
[0027] SMI1 - down - R: gttgagatttttgctgttgtg
[0028] Step 3: Construct the recombinant Saccharomyces cerevisiae BY4741 - ΔSMI1
[0029] The pCas9-426-ΔSMI1 plasmid in Step 1 and the free homologous arm donor fragment UP-SMI1-DOWN in Step 2 were transferred into Saccharomyces cerevisiae BY4741 using a yeast transformation kit to obtain recombinant Saccharomyces cerevisiae BY4741-ΔSMI1.
[0030] Step 4: Construction of the free overexpression donor fragment TEF1-ALG5-ADH1 of the ALG1 gene
[0031] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the ALG5 gene was amplified by high-fidelity enzyme fastPfuPCR using primers ALG5-F and ALG5-R. The fragment obtained by double digestion of plasmid pY26-TEF-GPD with NotI-Bg1II was overlapped and extended by PCR with the amplified ALG5 gene to obtain the linearized plasmid pY26-TEF-GPD-ALG5. The TEF1 promoter, ADH1 terminator and the middle fragment of the linearized plasmid pY26-TEF-GPD-ALG5 were amplified by PCR using primers U-T-F and D-A-R to obtain the donor fragment TEF1-ALG5-ADH1.
[0032] The sequences of the above primers are as follows:
[0033] ALG5-F: gttttctagaactagcgcggccgcatgagagcgttgagattcct
[0034] ALG5-R: gcgaagaattgttaattaaagatctctaacatttcttattatctct
[0035] U-T-F: cactgaagaaactttcatagcttcaaaatgtttctact
[0036] D-A-R: tcttaatgacagcaggagcgacctcatgctatact
[0037] Step 5: Construction of the donor fragment FU1-TEF1-ALG5-ADH1-FD1
[0038] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the upstream homologous arm fragment FKS1-UP of the FKS gene was obtained by high-fidelity enzyme fastPfu PCR amplification with primers FKS1-up-F and FKS1-up-R. The downstream homologous arm fragment FKS1-DOWN of the FKS1 gene was obtained by high-fidelity enzyme fastPfu PCR amplification with primers FKS1-down-F and FKS1-down-R. Finally, the upstream homologous arm fragment FKS1-UP, the downstream homologous arm fragment FKS1-DOWN of the FKS1 gene, and the donor fragment TEF1-ALG5-ADH1 in step 4 were Gibson ligated with primers FKS1-up-F and FKS1-down-R to obtain the donor fragment FU1-TEF1-ALG5-ADH1-FD1.
[0039] The sequences of the above primers are as follows:
[0040] FKS1-up-F: tatggtggtcagtataccgcttct
[0041] FKS1-up-R: cattttgaagctatgaaagtttcttcagtgtcttc
[0042] FKS1-down-F: agcatgaggtcgctcctgctgtcattaagagaaatta
[0043] FKS1-down-R: aactcagcattttccagttcatgtggt
[0044] Step 6: Constructing a Saccharomyces cerevisiae engineering strain with high mannan production
[0045] The pCas9-426-ΔFKS1 plasmid in step 1 and the donor fragment FU1-TEF1-ALG5-ADH1-FD1 in step 5 were co-transformed into the recombinant Saccharomyces cerevisiae BY4741-ΔSMI1 in step 3 through a yeast transformation kit to obtain the Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5 with high mannan production.
[0046] Furthermore, the present invention provides the use of the above-mentioned Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5 in the fermentation production of mannan.
[0047] The present invention also provides a Saccharomyces cerevisiae engineering strain for regulating the astringency of wine, which is constructed by the following steps:
[0048] Step 1: Constructing the pCas9-426-ΔMNN2 plasmid
[0049] Design a 20-bp gRNA for the MNN2 gene, replace the 20-bp base sequence at the gRNA position on the gRNA / Cas9 co-expression free plasmid pCas9-426-2 using Snapgene software, and design linearization primers; using plasmid pCas9-426-2 as a template, perform double digestion with MluI-NsiI and amplify by PCR using the linearization primers. The obtained vector and fragment are ligated by Gibson to obtain the pCas9-426-ΔMNN2 plasmid.
[0050] The sequence of the 20-bp sgRNA of the above MNN2 gene is: atacatggatgagaacacgt
[0051] The sequences of the above linearization primers are as follows:
[0052] MNN2-FOR: gaacacgtgttttagagctagaaatagcaagt
[0053] MNN2-REV: gaagctctaatttgtgagtttagtatacatgc
[0054] MNN2-sgRNA-F: tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa
[0055] MNN2-sgRNA-R: ctagctctaaaacacgtgttctcatccatgtatgatcatttatct
[0056] Step 2: Construct the free homologous arm donor fragment UP-MNN2-DOWN
[0057] Using the genome of Saccharomyces cerevisiae BY4741 as a template, use primers MNN2-up-F and MNN2-up-R, and amplify the upstream homologous arm MNN2-UP of the MNN2 gene by high-fidelity enzyme fastPfu PCR. Use primers MNN2-down-F and MNN2-down-R, and amplify the downstream homologous arm MNN2-DOWN of the MNN2 gene by high-fidelity enzyme fastPfu PCR; finally, use primers MNN2-up-F and MNN2-down-R for overlapping extension PCR to obtain the free homologous arm donor fragment UP-MNN2-DOWN of the MNN2 gene.
[0058] The sequences of the above primers are as follows:
[0059] MNN2-up-F: ccctgctggttatatccctgctga
[0060] MNN2-up-R: ccgacccgttgcataactgaaaatataattttact
[0061] MNN2-down-F: aattatattttcagttatgcaacgggtcggactat
[0062] MNN2-down-R: agtttataatctgatctaggcactctcagattgc
[0063] Step 3: Constructing a Saccharomyces cerevisiae engineering strain for regulating the astringency of wine
[0064] Co-transform the pCas9-426-ΔMNN2 plasmid in Step 1 and the donor fragment UP-MNN2-DOWN in Step 2 into the above-mentioned Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5 through a yeast transformation kit to obtain the Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 for regulating the astringency of wine.
[0065] Furthermore, the present invention provides the use of the above-mentioned Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 in the fermentation production of mannoproteins with unbranched outer chains in N-glycosylation.
[0066] The present invention also provides the use of the above-mentioned mannoproteins with unbranched outer chains in N-glycosylation in regulating the astringency of wine.
[0067] The present invention also provides a fermentation inoculum, which comprises the above-mentioned Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5 or the above-mentioned Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2.
[0068] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0069] 1. The present invention uses the CRISPR / Cas9 gene editing technology, uses Saccharomyces cerevisiae BY4741 as the chassis strain, deletes the genes SMI1 and FKS1 encoding cell wall β-1,3-glucan synthase by using the cell wall component compensation mechanism, and overexpresses the gene ALG5 encoding dolichyl phosphate-β-glycosyltransferase in the GDP-mannose pathway, so as to obtain a Saccharomyces cerevisiae engineering strain with high mannose production, and the mannose production is as high as 283.164 mg / L (28.316 mg / g dry cell weight of the strain).
[0070] 2. The α-1,2-mannosyltransferase MNN2 in the engineered Saccharomyces cerevisiae strain with high mannan production was further knocked out in the present invention to obtain a new engineered Saccharomyces cerevisiae strain. The glycosylation side chain of the mannan protein produced by using this engineered strain is an N-glycosylation straight chain (i.e., there is no branch on the outer chain of N-glycosylation). Its yield is 6.45%, and the purity is 89.94%, which is significantly higher than that of the mannan protein MP60 of Angel Yeast (purity 60%).
[0071] 3. Adding the mannan protein with no branch on the outer chain of N-glycosylation produced by using the engineered Saccharomyces cerevisiae strain of the present invention to the simulated wine can effectively balance the astringency and improve the smoothness, and at the same time improve the color and colloidal stability, thus improving the overall quality of the wine. BRIEF DESCRIPTION OF THE DRAWINGS
[0072] Figure 1 is the synthesis pathway of the polysaccharide in the cell wall of Saccharomyces cerevisiae.
[0073] Figure 2 is the plate colony map of the engineered Saccharomyces cerevisiae strain BY4741-ΔSMI1ΔFKS1↑ALG5.
[0074] Figure 3 is the comparison of the biomass of BY4741 and its derived engineered strains cultured in the fermentation medium for 72 h.
[0075] Figure 4 is the comparison of the yields of β-glucan and mannan of BY4741 and its derived engineered strains cultured in the fermentation medium for 72 h.
[0076] Figure 5 is the growth curve of BY4741 and the engineered Saccharomyces cerevisiae strains BY4741-ΔSMI1ΔFKS1↑ALG5, BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 cultured in the fermentation medium for 48 h.
[0077] Figure 6 is the comparison chart of the astringency regulation of the mannan protein produced by the engineered Saccharomyces cerevisiae strain BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 and the mannan protein MP60 of Angel Yeast on the simulated wine. DETAILED DESCRIPTION OF THE INVENTION
[0078] The following further specifically describes the detailed content of the present invention in conjunction with the drawings and specific embodiments, but does not limit the protection scope of the present invention thereby.
[0079] The sequences of the sgRNA and primers used in the following examples are as follows:
[0080] The sequence of the 20bp sgRNA of the SMI1 gene is: acgtccacggagtcaaacga (as shown in SEQ ID NO:1
[0081] )
[0082] The sequence of the 20bp sgRNA of the FKS1 gene is: tgaaggcgacaactccctag (as shown in SEQ ID NO:2
[0083] )
[0084] The sequence of the 20bp sgRNA of the MNN2 gene is: atacatggatgagaacacgt (as shown in SEQ ID NO:3
[0085] )
[0086] SMI1-up-F: cctacttcgagatcaaaagaat (as shown in SEQ ID NO:4)
[0087] SMI1-up-R: gagatcttttgacctgaccattgttgctgtt (as shown in SEQ ID NO:5)
[0088] SMI1-down-F: atggtcaggtcaaaagatctcaacaaggtttatc (as shown in SEQ ID NO:6)
[0089] SMI1-down-R: gttgagatttttgctgttgtg (as shown in SEQ ID NO:7)
[0090] SMI1-FOR: tcaaacgagttttagagctagaaatagcaagt (as shown in SEQ ID NO:8)
[0091] SMI1-REV: ttgtgagtttagtatacatgcatttacttataatacagttttttagttttg (as shown in SEQ IDNO:9)
[0092] SMI1-sgRNA-R: tttctagctctaaaactcgtttgactccgtggacgtgatcatttatctttcactgc (as shown in SEQ ID NO:10)
[0093] SMI1-sgRNA-F: tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa (as shown in SEQ ID NO: 11)
[0094] FKS1-up-F: tatggtggtcagtataccgcttct (as shown in SEQ ID NO: 12)
[0095] FKS1-up-R: cattttgaagctatgaaagtttcttcagtgtcttc (as shown in SEQ ID NO: 13)
[0096] FKS1-down-R: aactcagcattttccagttcatgtggt (as shown in SEQ ID NO: 14)
[0097] FKS1-down-F: agcatgaggtcgctcctgctgtcattaagagaaatta (as shown in SEQ ID NO: 15)
[0098] ALG5-F: gttttctagaactagcgcggccgcatgagagcgttgagattcct (as shown in SEQ ID NO: 16)
[0099] ALG5-R: gcgaagaattgttaattaaagatctctaacatttcttattatctct (as shown in SEQ ID NO: 17)
[0100] U-T-F: cactgaagaaactttcatagcttcaaaatgtttctact (as shown in SEQ ID NO: 18)
[0101] D-A-R: tcttaatgacagcaggagcgacctcatgctatact (as shown in SEQ ID NO: 19)
[0102] MNN2-up-F: ccctgctggttatatccctgctga (as shown in SEQ ID NO: 20)
[0103] MNN2-up-R: ccgacccgttgcataactgaaaatataattttact (as shown in SEQ ID NO: 21)
[0104] MNN2-down-F: aattatattttcagttatgcaacgggtcggactat (as shown in SEQ ID NO:22)
[0105] MNN2-down-R: agtttataatctgatctaggcactctcagattgc (as shown in SEQ ID NO:23)
[0106] FKS1-FOR: ctccctaggttttagagctagaaatagcaagt (as shown in SEQ ID NO:24)
[0107] FKS1-REV: gaagctctaatttgtgagtttagtatacatgc (as shown in SEQ ID NO:25)
[0108] FKS1-sgRNA-R: gctatttctagctctaaaacctagggagttgtcgccttcagatcatttat (as shown in SEQ ID NO:26)
[0109] FKS1-sgRNA-F: tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa (as shown in SEQ ID NO:27)
[0110] MNN2-FOR: gaacacgtgttttagagctagaaatagcaagt (as shown in SEQ ID NO:28)
[0111] MNN2-REV: gaagctctaatttgtgagtttagtatacatgc (as shown in SEQ ID NO:29)
[0112] MNN2-sgRNA-R: ctagctctaaaacacgtgttctcatccatgtatgatcatttatct (as shown in SEQ ID NO:30)
[0113] MNN2-sgRNA-F: tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa (as shown in SEQ ID NO:31)
[0114] Example 1
[0115] According to Figure 1The synthesis pathway of cell wall polysaccharides of Saccharomyces cerevisiae is shown, and an engineered Saccharomyces cerevisiae strain with high - yield mannan is constructed. The specific construction method is as follows:
[0116] Step 1: Construct the pCas9 - 426 - ΔSMI1 plasmid and the pCas9 - 426 - ΔFKS1 plasmid
[0117] The SMI1 gene sequence and the homologous arm sequences of 500 bp each upstream and downstream of it are obtained by querying the NCBI database. Import this sequence into the blenching website and design a 20 - bp sgRNA located on the sense strand. Use the Snapgene software to replace the 20 - bp base sequence at the sgRNA position on the gRNA / Cas9 co - expression free plasmid pCas9 - 426 - 2, and design the linearization primers SMI1 - FOR, SMI1 - REV, SMI1 - sgRNA - R, and SMI1 - sgRNA - F. Using the plasmid pCas9 - 426 - 2 as a template, perform double digestion with MluI - NsiI and PCR amplification using the above linearization primers. The first 50 - μL PCR amplification system is: 2×fastPfu PCR mix 1 μL, SMI1 - FOR(10 μM)1 μL, SMI1 - REV(10 μM)1 μL, plasmid pCas9 - 426 - 2(200 ng / μL)1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH 2 O 32 μL. The reaction program is: denaturation at 98℃ for 3 min, then denaturation at 98℃ for 30 s, annealing at 50℃ for 30 s, extension at 72℃ for 2 min for a total of 30 cycles, and then extension at 72℃ for 10 min to obtain the first fragment SMI1 - C of 4989 bp. The second 50 - μL PCR amplification system is: 2×fastPfu PCR mix 1 μL, SMI1 - sgRNA - F(10 μM)1 μL, SMI1 - sgRNA - R(10 μM)1 μL, plasmid pCas9 - 426 - 2(200 ng / μL)1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH 2 O 32 μL. The reaction program is: denaturation at 98℃ for 3 min, then denaturation at 98℃ for 30 s, annealing at 50℃ for 30 s, extension at 72℃ for 30 s for a total of 30 cycles, and then extension at 72℃ for 10 min to obtain the second fragment SMI1 - R of 459 bp. Then, ligate the vector obtained by enzyme digestion and the two PCR - amplified fragments through Gibson ligation to obtain the pCas9 - 426 - ΔSMI1 plasmid. The obtained plasmid is transformed into Escherichia coli DH5a, extracted, and stored at - 20℃ after correct sequencing.
[0118] According to the above method for constructing the pCas9-426-ΔSMI1 plasmid, using the plasmid pCas9-426-2 as a template, double digestion with MluI-NsiI and PCR amplification using the linearization primers FKS1-FOR, FKS1-REV, FKS1-sgRNA-F, and FKS1-sgRNA-R. The first 50 μL PCR amplification system is as follows: 2×fastPfu PCR mix 1 μL, FKS1-FOR (10 μM) 1 μL, FKS1-REV (10 μM) 1 μL, plasmid pCas9-426-2 (200 ng / μL) 1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH 2 O 32 μL. The reaction program is: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 2 min, followed by extension at 72°C for 10 min to obtain the first fragment FKS1-C of 5000 bp. The second 50 μL PCR amplification system is: 2×fastPfu PCR mix 1 μL, FKS1-sgRNA-F (10 μM) 1 μL, FKS1-sgRNA-R (10 μM) 1 μL, plasmid pCas9-426-2 (200 ng / μL) 1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH 2 O 32 μL. The reaction program is: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, followed by extension at 72°C for 10 min to obtain the second fragment FKS1-R of 463 bp. Then, the vector obtained by enzyme digestion and the two PCR-amplified fragments are ligated by Gibson to obtain the constructed pCas9-426-ΔFKS1 plasmid. The obtained plasmid is transformed into Escherichia coli DH5a, extracted, and stored at -20°C after correct sequencing.
[0119] Step 2: Construct the free homologous arm donor fragment
[0120] Using the genome of Saccharomyces cerevisiae BY4741 as a template, and using the primers SMI1-up-F and SMI1-up-R, high-fidelity enzyme fastPfu PCR amplification is carried out to obtain the 500 bp upstream homologous arm fragment SMI1-UP of the SMI1 gene. The PCR amplification system is: 2×fastPfu PCR mix 1 μL, SMI1-up-F (10 μM) 1 μL, SMI1-up-R (10 μM) 1 μL, BY4741 genomic DNA 1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH2 32 μL of O, and the reaction program was: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s, followed by extension at 72°C for 10 min. Using primers SMI1-down-F and SMI1-down-R, a 500-bp downstream homologous arm fragment SMI1-DOWN of the SMI1 gene was obtained by high-fidelity enzyme Pfu PCR amplification. The PCR amplification system was: 1 μL of 2×fastPfu PCRmix, 1 μL of SMI1-down-F (10 μM), 1 μL of SMI1-down-R (10 μM), 1 μL of BY4741 genomic DNA, 4 μL of 2.5 mM dNTPs, 10 μL of 5×fastPfuBuffer, ddH 2 32 μL of O, and the reaction program was: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s, followed by extension at 72°C for 10 min. Finally, the upstream homologous arm fragment SMI1-UP and the downstream homologous arm fragment SMI1-DOWN of the SMI1 gene were subjected to overlapping extension PCR using primers SMI1-up-F and SMI1-down-R. The overlapping extension PCR system was: The PCR amplification system was: 1 μL of 2×fastPfu PCRmix, 1 μL of SMI1-up-F (10 μM), 1 μL of SMI1-down-R (10 μM), 1 μL of SMI1-UP, 1 μL of SMI1-DOWN, 4 μL of 2.5 mM dNTPs, 10 μL of 5×fastPfu Buffer, ddH 2 31 μL of O, and the reaction program was: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 1 min, followed by extension at 72°C for 10 min. Finally, a 1000-bp free homologous arm donor fragment UP-SMI1-DOWN of the SMI1 gene was obtained.
[0121] Step 3: Construct recombinant Saccharomyces cerevisiae BY4741-ΔSMI1
[0122] The pCas9-426-ΔSMI1 plasmid in Step 1 and the free homologous arm donor fragment UP-SMI1-DOWN in Step 2 were transferred into Saccharomyces cerevisiae BY4741 using a yeast transformation kit (PEG / LiAc method). The obtained strain was spread on SD-URA solid medium, and the strain verified to be correct by amplification was the recombinant Saccharomyces cerevisiae with the SMI1 gene knocked out, named recombinant Saccharomyces cerevisiae BY4741-ΔSMI1.
[0123] Step 4: Construct the free overexpression donor fragment TEF1-ALG5-ADH1 of the ALG1 gene
[0124] Using the genome of Saccharomyces cerevisiae BY4741 as a template, with primers ALG5-F and ALG5-R, the 1005bp ALG5 gene was amplified by high-fidelity enzyme fastPfuPCR. The PCR amplification system was: 2×fastPfu PCRmix 1μL, ALG5-F (10μM) 1μL, ALG5-R (10μM) 1μL, BY4741 genome 1μL, 2.5mM dNTPs 4μL, 5×fastPfu Buffer 10μL, ddH 2 O 32μL. The reaction program was: denaturation at 98℃ for 3min, then denaturation at 98℃ for 30s, annealing at 58℃ for 30s, extension at 72℃ for 1min for a total of 30 cycles, and then extension at 72℃ for 10min. The fragment P obtained by double digestion of plasmid pY26-TEF-GPD with NotI-Bg1II was Gibson ligated with the amplified ALG5 gene to obtain the linearized plasmid pY26-TEF-GPD-ALG5. Using primers U-T-F and D-A-R, the TEF1 promoter, ADH1 terminator and the middle fragment of the linearized plasmid pY26-TEF-GPD-ALG5 were amplified by PCR. The PCR amplification system was: 2×fastPfuPCRmix 1μL, U-T-F (10μM) 1μL, D-A-R (10μM) 1μL, linearized plasmid pY26-TEF-GPD-ALG5 1μL, 2.5mM dNTPs 4μL, 5×fastPfu Buffer 10μL, ddH 2 O 32μL. The reaction program was: denaturation at 98℃ for 3min, then denaturation at 98℃ for 30s, annealing at 59℃ for 30s, extension at 72℃ for 1min for a total of 30 cycles, and then extension at 72℃ for 10min. Finally, the 1735bp donor fragment TEF1-ALG5-ADH1 was obtained.
[0125] Step 5: Construct the donor fragment FU1-TEF1-ALG5-ADH1-FD1
[0126] Using the genome of Saccharomyces cerevisiae BY4741 as a template, with primers FKS1-up-F and FKS1-up-R, the 500bp upstream homologous arm fragment FKS1-UP of the FKS1 gene was amplified by high-fidelity enzyme fastPfuPCR. The PCR amplification system was: 2×fastPfu PCRmix1μL, FKS1-up-F (10μM) 1μL, FKS1-up-R (10μM) 1μL, BY4741 genome 1μL, 2.5mMdNTPs 4μL, 5×fastPfuBuffer 10μL, ddH 2O 32 μL. The reaction program was as follows: denaturation at 98°C for 3 min, followed by 30 cycles of denaturation at 98°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 30 s, and then extension at 72°C for 10 min. Using primers FKS1-down-F and FKS1-down-R, a 500-bp downstream homologous arm fragment FKS1-DOWN of the FKS1 gene was obtained by high-fidelity enzyme fastPfu PCR amplification. The PCR amplification system was: 2×fastPfu PCR mix 1 μL, FKS1-down-F (10 μM) 1 μL, FKS1-down-R (10 μM) 1 μL, BY4741 genome 1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH 2 O 32 μL. The reaction program was as follows: denaturation at 98°C for 3 min, followed by 30 cycles of denaturation at 98°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, and then extension at 72°C for 10 min. Finally, the upstream homologous arm fragment FKS1-UP, the downstream homologous arm fragment FKS1-DOWN of the FKS1 gene, and the donor fragment TEF1-ALG5-ADH1 in step 4 were Gibson ligated using primers FKS1-up-F and FKS1-down-R to obtain the donor fragment FU1-TEF1-ALG5-ADH1-FD1.
[0127] Step 6: Construction of a recombinant Saccharomyces cerevisiae engineering strain with high mannan production
[0128] The pCas9-426-ΔFKS1 plasmid in step 1 and the donor fragment FU1-TEF1-ALG5-ADH1-FD1 in step 5 were co-transformed into the recombinant Saccharomyces cerevisiae BY4741-ΔSMI1 in step 3 using a yeast transformation kit (PEG / LiAc method). The obtained strain was spread on SD-URA solid medium, and the strain verified to be correct by amplification was the recombinant Saccharomyces cerevisiae with the SMI1 and FKS1 genes knocked out and the ALG5 gene overexpressed, named Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5.
[0129] Example 2
[0130] The Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5 (denoted as BSFA12) in Example 1 was used for fermentation production of mannan. The fermentation method was as follows:
[0131] Step 1: Obtaining single colonies by the streak plate method
[0132] The Saccharomyces cerevisiae engineering strain BY4741-ΔSMI1ΔFKS1↑ALG5 stored in a glycerol tube was streaked on a YPDA plate and cultured at 30°C for 2 days to obtain single colonies (seeFigure 2 )。The composition of the YPDA medium is: 20 g / L of glucose, 20 g / L of peptone, 10 g / L of yeast extract powder, and 20 g / L of agar.
[0133] Step 2: Preparation of yeast seed liquid
[0134] Pick a single colony from Step 1 and inoculate it into the YPD seed culture medium, and culture it in a constant temperature incubator at 30 °C for 16 h to obtain the yeast seed liquid. The YPD seed culture medium is the YPDA medium without agar added.
[0135] Step 3: Fermentation
[0136] Inoculate the yeast seed liquid from Step 2 into the fermentation medium at an inoculation amount of 2%, and shake culture at 30 °C and 200 rpm for 72 h, and then centrifuge at 4000 rpm for 5 min to harvest the cell precipitate, and measure the contents of β-glucan and mannan. The composition of the fermentation medium is: 50 g / L of glucose, 5 g / L of peptone, 5 g / L of yeast extract powder, 0.3 g / L of dipotassium hydrogen phosphate, 0.3 g / L of potassium dihydrogen phosphate, and 0.5 g / L of magnesium sulfate. The method for measuring the contents of β-glucan and mannan is: resuspend the cell precipitate with 10 mL of PBS buffer (0.01 M, pH 7.2 - 7.4), and ultrasonically disrupt it in a cell ultrasonic disruptor. The ultrasonic disruption conditions are: power 350 W, duty cycle 50%, work for 3 s and stop for 3 s, with a total duration of 15 min. After ultrasonic disruption, add 0.1 g / mL lyticase of yeast cell wall, enzymatically hydrolyze at 45 °C for 2 h, stir constantly during this period, and centrifuge at 4000 rpm for 10 min to obtain the supernatant. Add 1 mL of concentrated sulfuric acid to the supernatant and hydrolyze it at 100 °C for 4 h, and filter it through a 0.22 μm filter membrane for HPLC detection. The detection chromatographic column is Bio-Rad HPX 87H; mobile phase: 5 mM H 2 SO 4 aqueous solution; flow rate: 0.5 mL / min; column temperature: 50 °C; the detector is an RID (differential refractive index) detector. Use D-(+)-glucose and D-(+)-mannose standards to establish a standard curve. Unless otherwise specified, the conversion coefficients of mannose and glucose to mannan and β-glucan are both 0.9.
[0137] At the same time, compare with the fermentation results of the chassis strain BY4741, engineered strains BY4741-ΔSMI1 (BS2), BY4741-ΔFKS1 (BF9), BY4741-ΔFKS1↑ALG5 (BFA8), BY4741-ΔSMI1-ΔFKS1 (BSF5), and the results are as Figure 3 and Figure 4 shown. Figure 4In it, "-" represents no operation; "Δ" represents knockout; "+" represents overexpression.
[0138] From Figure 3 The results show that after 72 h of fermentation of the chassis strain BY4741 and each engineered strain, the OD600 is stable at 2.3 - 2.4, indicating that the growth of Saccharomyces cerevisiae is not affected after knocking out each gene.
[0139] From Figure 4 The results show that the mannan yields of BS2, BF9, BFA8, BSF5, and BSFA12 are 129.4 mg / L, 179.3 mg / L, 162.9 mg / L, 194.46 mg / L, and 283.16 mg / L respectively, all higher than 120.97 mg / L of the chassis strain BY4741. Among them, the mannan yield of BSFA12 constructed in Example 1 is the highest, and the mannan yield of this strain reaches 28.316 mg / g yeast dry weight in the shake flask, which is significantly higher than the prior art.
[0140] Example 3
[0141] In this example, an engineered Saccharomyces cerevisiae strain for regulating the astringency of wine was constructed according to the following steps:
[0142] Step 1: Construct the pCas9-426-ΔMNN2 plasmid
[0143] According to the construction method of the pCas9-426-ΔSMI1 plasmid in Step 1 of Example 1, using the plasmid pCas9-426-2 as a template, double digestion with MluI-NsiI and PCR amplification using the linearization primers MNN2-FOR, MNN2-REV, MNN2-sgRNA-R, and MNN2-sgRNA-F. The first 50 μL PCR amplification system is: 2×fastPfu PCR mix 1 μL, MNN2-FOR (10 μM) 1 μL, MNN2-REV (10 μM) 1 μL, plasmid pCas9-426-2 (200 ng / μL) 1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH 232 μL of O, and the reaction program was: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 2 min, followed by extension at 72°C for 10 min to obtain the first fragment MNN2-C of 4956 bp; the second 50 μL PCR amplification system was: 1 μL of 2×fastPfu PCR mix, 1 μL of MNN2-sgRNA-R (10 μM), 1 μL of MNN2-sgRNA-F (10 μM), 1 μL of plasmid pCas9-426-2 (200 ng / μL), 4 μL of 2.5 mM dNTPs, 10 μL of 5×fastPfu Buffer, 32 μL of ddH2O, and the reaction program was: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, followed by extension at 72°C for 10 min to obtain the second fragment MNN2-R of 459 bp. Then, the vector obtained by digestion and the two PCR-amplified fragments were ligated by Gibson to obtain the pCas9-426-ΔMNN2 plasmid. The obtained plasmid was transformed and extracted by Escherichia coli DH5α, and after correct sequencing, it was stored at -20°C for use.
[0144] Step 2: Construct the free homologous arm donor fragment UP-MNN2-DOWN
[0145] Using the genome of Saccharomyces cerevisiae BY4741 as a template, and using primers MNN2-up-F and MNN2-up-R, the 1000 bp upstream homologous arm MNN2-UP of the MNN2 gene was amplified by high-fidelity enzyme fastPfu PCR. The PCR amplification system was: 1 μL of 2×fastPfu PCR mix, 1 μL of MNN2-up-F (10 μM), 1 μL of MNN2-up-R (10 μM), 1 μL of BY4741 genomic DNA, 4 μL of 2.5 mM dNTPs, 10 μL of 5×fastPfu Buffer, ddH 2 32 μL of O, and the reaction program was: denaturation at 98°C for 3 min, then 30 cycles of denaturation at 98°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 1 min, followed by extension at 72°C for 10 min. Using primers MNN2-down-F and MNN2-down-R, the 1000 bp downstream homologous arm MNN2-DOWN of the MNN2 gene was amplified by high-fidelity enzyme fastPfu PCR. The PCR amplification system was: 1 μL of 2×fastPfu PCR mix, 1 μL of MNN2-down-F (10 μM), 1 μL of MNN2-down-R (10 μM), 1 μL of BY4741 genomic DNA, 4 μL of 2.5 mM dNTPs, 10 μL of 5×fastPfu Buffer, ddH 2O 32 μL, and the reaction program was: denaturation at 98°C for 3 min, then denaturation at 98°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min for a total of 30 cycles, and then extension at 72°C for 10 min. Finally, the 2000 bp free homologous arm donor fragment UP-MNN2-DOWN of the MNN2 gene was obtained by overlapping extension PCR using primers MNN2-up-F and MNN2-down-R. The overlapping extension PCR system was: 2×fastPfu PCRmix 1 μL, MNN2-up-F (10 μM) 1 μL, MNN2-down-R (10 μM) 1 μL, BY4741 genomic DNA 1 μL, 2.5 mM dNTPs 4 μL, 5×fastPfu Buffer 10 μL, ddH 2 O 32 μL, and the reaction program was: denaturation at 98°C for 3 min, then denaturation at 98°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min 30 s for a total of 30 cycles, and then extension at 72°C for 10 min.
[0146] Step 3: Constructing a Saccharomyces cerevisiae engineering bacterium for regulating the astringency of wine
[0147] The pCas9-426-ΔMNN2 plasmid in Step 1 and the donor fragment UP-MNN2-DOWN in Step 2 were co-transformed into the Saccharomyces cerevisiae engineering bacterium BY4741-ΔSMI1ΔFKS1↑ALG5 obtained in Example 1 through a yeast transformation kit (PEG / LiAc method) to obtain the Saccharomyces cerevisiae engineering bacterium BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2.
[0148] According to the methods of Steps 1 to 3 in Example 2 above, the Saccharomyces cerevisiae engineering bacterium BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 (denoted as BSFAM2) constructed in this example, the Saccharomyces cerevisiae engineering bacterium BY4741-ΔSMI1ΔFKS1↑ALG5 constructed in Example 1 above, and the chassis strain BY4741 were cultured respectively. During the shaking culture at 30°C and 200 rpm for 48 h in the fermentation medium, the OD600 was measured every 2 h using an ultraviolet spectrophotometer, and the growth curve is shown in Figure 5 .
[0149] Example 4
[0150] The mannan protein in the cell wall of the Saccharomyces cerevisiae engineering bacterium BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 in Example 3 was extracted by a combination of ultrasound and enzymatic hydrolysis. The specific method was as follows:
[0151] Step 1: Cultivate the engineered Saccharomyces cerevisiae strain BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 according to the methods of Steps 1 to 3 in Example 2 to obtain cell pellets.
[0152] Step 2: Prepare a 5% yeast suspension with the obtained cell pellets using 0.01M PBS buffer, and initially break the yeast cell wall in a cell ultrasonic disruptor to release other enzymes in the yeast cells. Ultrasonic disruption conditions: power 350W, duty cycle 50%, work for 3s and stop for 3s, total duration 15 min. After ultrasonic disruption, add 0.1g / mL lyticase for yeast cell wall, enzymatically digest at 45°C for 2 h, stir continuously during this period, and centrifuge at 4000 rpm for 10 min to obtain the mannan-protein extract.
[0153] Step 3: Precipitate the mannan-protein extract with 80% ethanol solution at 4°C for 48 h, dialyze with a 3.5KDa dialysis bag at 4°C for 48 h, and then vacuum freeze-dry for 48 h to obtain purified mannan-protein powder. The N-glycosylated outer chain of the mannan-protein has no branches, and its yield is 6.45%.
[0154] Use the phenol-sulfuric acid method to measure the polysaccharide content in the obtained mannan-protein powder and calculate its purity. After calculation, its purity is 89.94%, which is significantly higher than 60% of the mannan-protein MP60 from Angel Yeast.
[0155] Example 5
[0156] Application of the mannan-protein with no branches on the N-glycosylated outer chain in the regulation of wine astringency in Example 4
[0157] Step 1: Prepare simulated wine
[0158] Heat and dissolve 0.75 g of potassium bitartrate in 220 mL of distilled water, cool and then add 30 mL of ethanol, and adjust the pH to 3.3 with citric acid. All reagents used are food-grade, safe, non-toxic, and harmless.
[0159] Step 2: Add the mannan-protein with no branches on the N-glycosylated outer chain to the simulated wine at 0.2 g / L (add 1 g / L tannin to 10 mL of the above simulated wine), recruit professional sensory evaluation personnel for sensory experiments, and score the wine astringency according to the five-point method. At the same time, conduct a comparative experiment with the mannan-protein MP60 from Angel Yeast. The results are shown in Figure 6 . In the figure, the control represents the simulated wine (without adding any mannan-protein).
[0160] From Figure 6It can be seen that applying the mannoprotein without branched chains on the N-glycosylated outer chain obtained by the present invention to wine can significantly reduce the astringency of the wine, while improving the body softness, color and colloidal stability of the wine, thereby improving the overall quality of the wine.
Claims
1. A method for constructing an engineered strain of Saccharomyces cerevisiae that produces high levels of mannan, characterized in that The method comprises the following steps: Step 1: Construction of pCas9-426-ΔSMI1 plasmid and pCas9-426-ΔFKS1 plasmid Design 20 bp sgRNAs for the SMI1 gene and the FKS1 gene, use Snapgene software to replace the 20 bp base sequence at the sgRNA position on the gRNA / Cas9 co-expression free plasmid pCas9-426-2 and design linearization primers; Plasmid pCas9-426-2 was used as a template, double digested with MluI-NsiI and amplified by PCR using linearized primers. The obtained vector and fragment were connected by Gibson to obtain pCas9-426-ΔSMI1 plasmid and pCas9-426-ΔFKS1 plasmid, respectively. The sequence of the 20bp sgRNA of the SMI1 gene is: acgtccacggagtcaaacga The sequence of the 20bp sgRNA of the FKS1 gene is: tgaaggcgacaactccctag The sequences of the linearized primers for constructing the pCas9-426-ΔSMI1 plasmid are as follows: SMI1-FOR:tcaaacgagttttagagctagaaatagcaagt SMI1-REV:ttgtgagtttagtatacatgcatttacttataatacagttttttagttttg SMI1-sgRNA-F:tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa SMI1-sgRNA-R:tttctagctctaaaactcgtttgactccgtggacgtgatcatttatctttcactgc The sequences of the linearized primers for constructing the pCas9-426-ΔFKS1 plasmid are as follows: FKS1-FOR:ctccctaggttttagagctagaaatagcaagt FKS1-REV:gaagctctaatttgtgagtttagtatacatgc FKS1-sgRNA-F:tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa FKS1-sgRNA-R: gctatttctagctctaaaacctagggagttgtcgccttcagatcatttat Step 2: Construction of free homology arm donor fragment UP-SMI1-DOWN Using the genome of Saccharomyces cerevisiae BY4741 as a template, primers SMI1-up-F and SMI1-up-R and high-fidelity enzyme fastPfu were used to amplify the upstream homologous arm fragment SMI1-UP of the SMI1 gene. Primers SMI1-down-F and SMI1-down-R were used to amplify the downstream homologous arm fragment SMI1-DOWN of the SMI1 gene. Finally, primers SMI1-up-F and SMI1-down-R were used to overlap extension PCR to obtain the free homologous arm donor fragment UP-SMI1-DOWN of the SMI1 gene. The sequences of the above primers are as follows: SMI1-up-F:cctacttcgagatcaaaagaat SMI1-up-R: gagatcttttgacctgaccattgttgctgtt SMI1-down-F: atggtcaggtcaaaagatctcaacaaggtttatc SMI1-down-R:gttgagatttttgctgttgtg Step 3: Construction of recombinant Saccharomyces cerevisiae BY4741-ΔSMI1 The pCas9-426-ΔSMI1 plasmid in step 1 and the free homology arm donor fragment UP-SMI1-DOWN in step 2 were transformed into Saccharomyces cerevisiae BY4741 using a yeast transformation kit to obtain recombinant Saccharomyces cerevisiae BY4741-ΔSMI1; Step 4: Construction of ALG1 gene free overexpression donor fragment TEF1-ALG5-ADH1 The genome of Saccharomyces cerevisiae BY4741 was used as a template, and the ALG5 gene was amplified by PCR using primers ALG5-F and ALG5-R and the high-fidelity enzyme fastPfu. The fragment obtained by double-digesting the plasmid pY26-TEF-GPD with NotI-Bg1II was overlapped with the amplified ALG5 gene to obtain the linearized plasmid pY26-TEF-GPD-ALG5. The TEF1 promoter, ADH1 terminator and the middle fragment of the linearized plasmid pY26-TEF-GPD-ALG5 were amplified by PCR using primers UTF and DAR to obtain the donor fragment TEF1-ALG5-ADH1. The sequences of the above primers are as follows: ALG5-F: gttttctagaactagcgcggccgcatgagagcgttgagattcct ALG5-R:gcgaagaattgttaattaaagatctctaacatttcttattatctct UTF: cactgaagaaactttcatagcttcaaaatgtttctact DAR: tcttaatgacagcaggagcgacctcatgctatact Step 5: Construction of donor fragment FU1-TEF1-ALG5-ADH1-FD1 Using the genome of Saccharomyces cerevisiae BY4741 as a template, primers FKS1-up-F and FKS1-up-R and the high-fidelity enzyme fastPfu were used to amplify the upstream homology arm fragment FKS1-UP of the FKS gene, and primers FKS1-down-F and FKS1-down-R were used to amplify the downstream homology arm fragment FKS1-DOWN of the FKS1 gene using the high-fidelity enzyme fastPfu; finally, the upstream homology arm fragment FKS1-UP and the downstream homology arm fragment FKS1-DOWN of the FKS1 gene were Gibson-ligated with the primers FKS1-up-F and FKS1-down-R and the donor fragment TEF1-ALG5-ADH1 in step 4 to obtain the donor fragment FU1-TEF1-ALG5-ADH1-FD1; The sequences of the above primers are as follows: FKS1-up-F:tatggtggtcagtataccgcttct FKS1-up-R:cattttgaagctatgaaagtttcttcagtgtcttc FKS1-down-F:agcatgaggtcgctcctgctgtcattaagagaaatta FKS1-down-R:aactcagcattttccagttcatgtggt Step 6: Construction of a high-mannan-producing Saccharomyces cerevisiae engineered strain The pCas9-426-ΔFKS1 plasmid in step 1 and the donor fragment FU1-TEF1-ALG5-ADH1-FD1 in step 5 were co-transformed into the recombinant Saccharomyces cerevisiae BY4741-ΔSMI1 in step 3 using a yeast transformation kit to obtain the Saccharomyces cerevisiae engineered strain BY4741-ΔSMI1ΔFKS1↑ALG5 with high mannan production.
2. The engineered yeast Saccharomyces cerevisiae with high mannan production obtained by the construction method according to claim 1.
3. Use of the engineered yeast Saccharomyces cerevisiae according to claim 2 in the fermentation production of mannan.
4. A method for constructing an engineered strain of Saccharomyces cerevisiae for regulating the astringency of wine, characterized in that The method comprises the following steps: Step 1: Construction of pCas9-426-ΔMNN2 plasmid Design a 20 bp gRNA for the MNN2 gene, use Snapgene software to replace the 20 bp base sequence at the gRNA position on the gRNA / Cas9 co-expression free plasmid pCas9-426-2 and design a linearization primer; Plasmid pCas9-426-2 was used as a template, double digested with MluI-NsiI and amplified by PCR using linearized primers, and the obtained vector and fragment were connected by Gibson to obtain pCas9-426-ΔMNN2 plasmid; The sequence of the 20bp sgRNA of the above MNN2 gene is: atacatggatgagaacacgt The sequence of the linearized primer is as follows: MNN2-FOR:gaacacgtgttttagagctagaaatagcaagt MNN2-REV:gaagctctaatttgtgagtttagtatacatgc MNN2-sgRNA-F:tttttttctgtacagacgcgtgtacgcatgtaacattatactgaa MNN2-sgRNA-R:ctagctctaaaacacgtgttctcatccatgtatgatcatttatct Step 2: Construction of free homology arm donor fragment UP-MNN2-DOWN Using the genome of Saccharomyces cerevisiae BY4741 as a template, primers MNN2-up-F and MNN2-up-R and high-fidelity enzyme fastPfu were used to amplify the upstream homologous arm MNN2-UP of the MNN2 gene. Primers MNN2-down-F and MNN2-down-R were used to amplify the downstream homologous arm MNN2-DOWN of the MNN2 gene. Finally, primers MNN2-up-F and MNN2-down-R were used to overlap and extend PCR to obtain the free homologous arm donor fragment UP-MNN2-DOWN of the MNN2 gene. The sequences of the above primers are as follows: MNN2-up-F:ccctgctggttatatccctgctga MNN2-up-R:ccgacccgttgcataactgaaaatataattttatact MNN2-down-F:aattatattttcagttatgcaacgggtcggactat MNN2-down-R:agtttataatctgatctaggcactctcagattgc Step 3: Construction of engineered Saccharomyces cerevisiae for regulating wine astringency The pCas9-426-ΔMNN2 plasmid of step 1 and the donor fragment UP-MNN2-DOWN of step 2 are co-transformed into the engineered yeast BY4741-ΔSMI1ΔFKS1↑ALG5 of claim 1 using a yeast transformation kit to obtain the engineered yeast BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 for regulating the astringency of wine.
5. The engineered Saccharomyces cerevisiae obtained by the construction method of claim 4 for regulating the astringency of wine.
6. A fermentation agent, characterized in that: The method comprises the engineered yeast BY4741-ΔSMI1ΔFKS1↑ALG5 of claim 2 or the engineered yeast BY4741-ΔSMI1ΔFKS1↑ALG5-ΔMNN2 of claim 5.
7. Use of the engineered yeast Saccharomyces cerevisiae according to claim 5 in fermentation to produce mannoprotein with no branch on the N-glycosylated outer chain.
8. Use of the unbranched N-glycosylated outer chain mannoprotein according to claim 7 in regulating the astringency of wine.