Nucleic acid molecule for detecting corn O-3-M1, detection method and application of nucleic acid molecule

Abstract

The invention relates to a nucleic acid molecule for detecting corn O-3-M1, a detection method and application of the nucleic acid molecule. The nucleic acid molecule of the corn O-3-M1 comprises a sequence as shown in SEQ ID NO.5 or a reverse complementary sequence of the sequence as shown in SEQ ID NO.5. The corn O-3-M1 is rich in DHA (docosahexaenoic acid), and the detection method can accurately and quickly identify whether a biological sample contains the DNA molecule of the transgenic corn event O-3-M1 or not.

Description

Technical Field

[0001] The present invention relates to the field of plant biotechnology. Specifically, it relates to a nucleic acid molecule for detecting O-3-M1 in maize plants and its detection method, and particularly to a transgenic maize event O-3-M1 with a trait of improved DHA-rich quality, as well as a nucleic acid molecule for detecting whether a biological sample contains the specific transgenic maize event O-3-M1 and its detection method. Background Art

[0002] DHA (docosahexaenoic acid) is a long-chain polyunsaturated fatty acid that plays an important role in human brain function, heart health, and overall well-being. It is particularly important during fetal and early childhood development as it is a key component of the brain and retina. DHA is important for cognitive function and memory and has been shown to help reduce the risk of cognitive decline in the elderly. It is also important for cardiovascular health as it helps reduce inflammation, triglycerides, and blood pressure and may lower the risk of heart disease.

[0003] Fish and other seafood are the main sources of DHA in the human diet, but overfishing and other environmental issues have raised concerns about the sustainability of these sources. In addition, some people may not consume enough fish or other seafood to meet their DHA requirements. Synthesizing DHA in plants can provide a more sustainable and accessible source of DHA. This is particularly important for those following a vegetarian or vegan diet who may not consume any animal-derived DHA. It can also be used to add DHA to bread, cereals, and other plant-based products, providing a convenient way for people to increase their DHA intake. Synthesizing DHA in plants can not only provide a sustainable alternative source of DHA but may also be more cost-effective than current sources such as fish oil.

[0004] Since crops, horticultural plants, and other angiosperms do not possess the enzymes required to synthesize long-chain ω-3 fatty acids such as EPA and DHA. Therefore, unlike animals, higher plants cannot synthesize EPA and DHA, while microalgae, mosses, and fungi can synthesize ω-3 long-chain polyunsaturated fatty acids, and their synthesis often requires a series of oxygen desaturation and elongation reactions, all of which use essential fatty acids linoleic acid (LA) or α-linolenic acid (ALA) as precursor substances, malonyl-CoA as the two-carbon unit donor, and under the catalytic action of a series of fatty acid desaturases and fatty acid elongases, ultimately synthesize long-chain polyunsaturated fatty acids (Damude HG, Zhang H, Farrall L, et al. Identification of bifunctional delta12 / omega3 fatty acid desaturases for improving the ratio of omega3 to omega6 fatty acids in microbes and plants. Proc Natl Acad Sci USA, 2006, 103(25):9446-51). Currently, the mainly well-studied pathways are the Δ4, Δ6, and Δ8 pathways.

[0005] The methods for synthesizing DHA in plants can be divided into two types: one is to introduce genes encoding DHA biosynthetic enzymes from microalgae or other organisms. This enables plants to produce DHA in tissues including seeds. This method has successfully produced DHA-rich oil in rapeseed and maize (Ruiz-Lopez N, Haslam RP, Napier JA, et al. Successful high-level accumulation of fish oil omega-3 long-chain polyunsaturated fatty acids in a transgenic oilseed crop. Plant J, 2014, 77(2):198-208), which can be used as a source of DHA for animal feed or human consumption; the other method is to increase the levels of DHA precursors in plants, such as linoleic acid (LA) or α-linolenic acid (ALA), which can be converted into DHA in the body. This method has successfully increased the level of ALA in plants such as flaxseed, but the rate of this conversion is relatively low, and the conversion efficiency decreases with age, and the conversion of ALA to DHA in the body is limited. Generally speaking, although it is possible to synthesize DHA in plants, more research is still needed to optimize production and improve the conversion efficiency from precursors to DHA.

[0006] Ruiz-Lopez et al. used Camelina sativa as the transgenic receptor, and ligated the Δ6-desaturase gene from the marine eukaryotic microalga Ostreococcus tauri, the Δ6-elongase gene from Physcomitrella patens, the Δ5-desaturase gene from Thraustochytrium sp., the Δ12-desaturase gene from Phytophthora sojae, and the ω3-desaturase gene from Phytophthora infestans with specific promoters to successfully construct an EPA expression vector. The results showed that the highest content of EPA could reach 31%. To further obtain DHA, based on the above research, Ruiz-Lopez et al. added the Δ5-elongases gene from the marine eukaryotic microalga Ostreococcus tauri and the Δ4-desaturase gene from Emiliania huxleyi, and ligated these 7 genes with specific promoters to successfully construct a DHA expression vector. The final results showed that the highest contents of EPA and DHA could reach 12% and 14% respectively, which were very close to the contents of EPA and DHA in fish oil (i.e., 13% EPA, 13% DHA). [2] 。

[0007] Currently, the highest DHA content obtained is by Petrie and Liu et al. [6] obtained through the Δ6 pathway in Arabidopsis thaliana. The highest DHA content can reach 15.1%. Liu et al. ligated the Δ12-desaturase gene from Lachancea kluyveri, the Δ15-desaturase gene from Pichia pastoris, the Δ6-desaturase gene from Micromonas pusilla, the Δ6-elongases gene and Δ5-elongases gene from Pyramimonas cordata, and the Δ5-desaturases gene and Δ4-desaturases gene from Pavlova salina with specific promoters and a silencing suppressor of tobacco mosaic virus to successfully construct an expression vector and transform Arabidopsis thaliana.

[0008] Maize is the food crop with the largest planting area and the highest yield in China. If the synthesis of DHA can be achieved in maize, the cost required for humans to obtain DHA will be greatly reduced. For this reason, the applicant applied the Agrobacterium-mediated genetic transformation technology and transferred six key genes in the long-chain polyunsaturated fatty acid Δ6 pathway into the high-oil maize material BY815 through the transgenic overexpression method, obtaining a batch of maize transformants with increased long-chain polyunsaturated fatty acid content, and screening out the excellent transformant O-3-M1 with high DHA content from them.

[0009] It is known that the expression of foreign genes in plants is affected by their chromosomal positions, possibly due to the chromatin structure (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) close to the integration site. For this reason, it is usually necessary to screen a large number of events to possibly identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression levels of introduced genes can vary greatly among events; there may also be differences in the spatial or temporal patterns of expression, such as differences in the relative expression of transgenes between different plant tissues. This difference means that the actual expression pattern may not be consistent with the expression pattern expected based on the transcriptional regulatory elements in the introduced gene construct, resulting in differences in the trait performance of transformation events. Therefore, it is usually necessary to generate hundreds or thousands of different events (also called transformation events or transformants) and screen out a single event with the expected transgene expression level and expression pattern for commercial purposes. Events with the expected transgene expression level and expression pattern can be used to introgress the transgene into other genetic backgrounds through sexual outcrossing using conventional breeding methods. The offspring produced by this crossing method retain the transgene expression characteristics of the original transformation event. Applying this strategic model can ensure reliable gene expression in many varieties that are well adapted to local growth conditions. Therefore, it is necessary to identify and screen more transformation events to obtain excellent transformation events with excellent comprehensive trait performance and commercial prospects.

[0010] It would be beneficial to be able to detect the presence of a specific event to determine whether the offspring of a sexual hybridization contains a gene of interest. In addition, methods for detecting specific events would also assist in complying with relevant regulations, such as the need for formal approval and labeling of foods derived from recombinant crops before they are put on the market. It is possible to detect the presence of transgenes by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods typically focus on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the inserted transgenic DNA is known, such methods cannot be used to distinguish different events, especially those generated with the same DNA construct. Therefore, currently, a pair of primers spanning the junction between the inserted transgene and the flanking DNA is often used by PCR to identify specific transgenic events, specifically, a first primer containing the flanking sequence and a second primer containing the inserted sequence. SUMMARY OF THE INVENTION

[0011] In the present invention, six key genes in the Δ6 pathway of long-chain polyunsaturated fatty acids are overexpressed in maize, and the DHA content of transgenic maize plants and wild-type receptor control plants is compared, in order to obtain a maize transformation event with a higher DHA content and a detection method therefor.

[0012] To achieve the above object, the present invention uses the Agrobacterium infection technique to transform the pZZ-HED expression vector into immature embryos of maize receptor BY815, and obtains a batch of maize transformation events of PpD15des, MpD6des, PcD6elo, PsD5des, PcD5elo and PsD4des genes and bar gene. Among them, O-3-M1 exhibits stable generational heredity, the grains have a high DHA content, and the yield traits are excellent, having good application prospects.

[0013] To characterize the identity characteristics of O-3-M1, the present invention provides a nucleic acid molecule, which nucleic acid molecule comprises the sequence shown in SEQ ID NO.1, or its complementary sequence.

[0014] Furthermore, the nucleic acid molecule sequence comprises the sequence shown in SEQ ID NO.2, or its complementary sequence.

[0015] Even further, the nucleic acid molecule sequence comprises the sequences shown in SEQ ID NO.3 and / or SEQ ID NO.4, or its complementary sequence.

[0016] Even further, the nucleic acid molecule sequence comprises the sequence shown in SEQ ID NO.5, or its complementary sequence.

[0017] On the other hand, the present invention provides a probe for detecting a maize transformation event, characterized in that it comprises the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or its complementary sequence.

[0018] The present invention also provides a primer pair for detecting a maize transformation event, characterized in that the amplification product of the primer pair contains the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or its reverse complementary sequence.

[0019] In some embodiments, the above primer pair is the sequence shown in SEQ ID NO.6 and SEQ ID NO.7 or its complementary sequence.

[0020] The present invention also provides a kit or microarray for detecting a maize transformation event, characterized in that it contains the above probe and / or the above primer pair.

[0021] The present invention also provides a method for detecting a maize transformation event, characterized in that it includes using the above probe or the above primer pair or the above probe and primer pair or the above kit or microarray to detect whether the transformation event exists in a sample to be tested.

[0022] The present invention also provides a method for breeding maize, characterized in that the method comprises the following steps:

[0023] 1) Obtaining maize containing the above nucleic acid molecule;

[0024] 2) Obtaining maize plants, seeds, plant cells, progeny plants or plant parts from the maize obtained in step 1) by pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, self-crossing or hybridization or a combination of the above; and optionally,

[0025] 3) Identifying the DHA content of the progeny plants obtained in step 2) and using the above method to detect whether the transformation event exists therein.

[0026] Furthermore, the present invention also provides products made from the maize plants, seeds, plant cells, progeny plants or plant parts obtained by the above method, including food, feed or industrial raw materials.

[0027] The SEQ ID NO.1 is a 22-nucleotide sequence located near the insertion junction at the 5'-end of the inserted sequence in the transgenic maize event O-3-M1. The SEQ ID NO.1 spans the left flanking genomic DNA sequence of the maize insertion site and the DNA sequence at the 5'-end of the left border of the inserted sequence. The presence of the transgenic maize event O-3-M1 can be identified by containing the SEQ ID NO.1 or its reverse complementary sequence.

[0028] In the present invention, the nucleic acid sequence can be at least 11 or more consecutive polynucleotides (the first nucleic acid sequence) of any part of the transgenic inserted sequence in the SEQ ID NO.3 or its reverse complementary sequence, or at least 11 or more consecutive polynucleotides (the second nucleic acid sequence) of any part of the 5'-left flanking maize genomic DNA region in the SEQ ID NO.3 or its reverse complementary sequence. The nucleic acid sequence can further be a part of the SEQ ID NO.3 that is homologous to or reverse complementary to the complete SEQ ID NO.1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for generating an amplification product. When the amplification product generated by using the DNA primer pair in the DNA amplification method is an amplification product including the SEQ ID NO.1 or the SEQ ID NO.3 or its reverse complementary sequence, the presence of the transgenic maize event O-3-M1 or its progeny can be diagnosed.

[0029] The SEQ ID NO.3 is a 3246-nucleotide sequence located near the insertion junction at the 5'-end of the inserted sequence in the transgenic maize event O-3-M1. The SEQ ID NO.3 consists of a 394-nucleotide maize left flanking genomic DNA sequence (nucleotides 1-394 of the SEQ ID NO.3), a 63-nucleotide construct left border DNA sequence (nucleotides 395-457 of the SEQ ID NO.3), and a 2789-nucleotide DNA sequence of the first expression cassette of the bar gene (nucleotides 458-3246 of the SEQ ID NO.3). The presence of the transgenic maize event O-3-M1 can be identified by containing the SEQ ID NO.3 or its reverse complementary sequence.

[0030] The SEQ ID NO.5 is a sequence of 20,443 nucleotides characterizing the transgenic maize event O-3-M1, including the first expression cassette (nucleotides 458-3,246 of SEQ ID NO.5) containing the terminator CaMV35S polyA, the bar gene, and the promoter Ubiquitin promoter, the second expression cassette (nucleotides 3,291-5,668 of SEQ ID NO.5) containing the terminator T35S, the PpD15des gene, and the promoter P2R5SGPA, the third expression cassette (nucleotides 4,762-6,749 of SEQ ID NO.5) containing the promoter P2R5SGPA, the PcD5elo gene, and the terminator Tmas, the fourth expression cassette (nucleotides 6,750-10,895 of SEQ ID NO.5) containing the promoter Pglobulin-1, the PcD6elo gene, and the terminator Tnos, the fifth expression cassette (nucleotides 12,064-16,519 of SEQ ID NO.5) containing the terminator T35s, the PsD5des gene, and the promoter Pglobulin-2, the sixth expression cassette (nucleotides 16,520-18,823 of SEQ ID NO.5) containing the terminator Tmas, the MpD6des gene, and the promoter PZmBD1, and the seventh expression cassette sequence (nucleotides 18,189-20,443 of SEQ ID NO.5) containing the promoter PZmBD1, the PsD4des gene, and the terminator Tnos. The presence of the transgenic maize event O-3-M1 can be identified by containing the SEQ ID NO.5 or its reverse complementary sequence.

[0031] As is well known to those skilled in the art, the first and second nucleic acid molecules do not have to consist solely of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probes or primers described in the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, and they can be selected from the nucleotides described in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, or SEQ ID NO.4. When selected from the nucleotides shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, or SEQ ID NO.4, the probes and primers can be at least about 21 to about 50 or more consecutive nucleotides in length.

[0032] The present invention also provides a method for increasing the DHA content in corn kernels, which is characterized by comprising planting at least one transgenic corn plant in soil, wherein the transgenic corn plant contains nucleotides at positions 3291-20443 of SEQ ID NO.5 in its genome, or the genome of the transgenic corn plant contains SEQ ID NO.5; and the transgenic corn plant has the quality-improving trait of rich DHA in kernels.

[0033] In the nucleic acid molecule and its detection method for detecting corn plants according to the present invention, the following definitions and methods can better define the present invention and guide those of ordinary skill in the art to implement the present invention. Unless otherwise specified, the terms are understood according to the conventional usage of those of ordinary skill in the art.

[0034] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Physical map of the plant expression vector pZZ-HED.

[0036] Figure 2 Amplification result of the PpD15des gene of transgenic corn.

[0037] Marker: Molecular weight standard, with the band sizes marked beside; N: Genome of the negative control BY815; P: Positive control plasmid pZZ-HED; 1-7: Genomes of the O-3-M1 to O-3-M7 transformants.

[0038] Figure 3 Amplification result of the MpD6des gene of transgenic corn.

[0039] Marker: Molecular weight standard, with the band sizes marked beside; N: Genome of the negative control BY815; P: Positive control plasmid pZZ-HED; 1-7: Genomes of the O-3-M1 to O-3-M7 transformants.

[0040] Figure 4 Amplification result of the PcD6elo gene of transgenic corn.

[0041] Marker: Molecular weight standard, with the band sizes marked beside; N: Genome of the negative control BY815; P: Positive control plasmid pZZ-HED; 1-7: Genomes of the O-3-M1 to O-3-M7 transformants.

[0042] Figure 5 Amplification result of the PsD5des gene of transgenic corn.

[0043] Marker: Molecular weight standard, with band sizes marked beside; N: Genomic DNA of negative control BY815; P: Positive control plasmid pZZ-HED; 1 - 7: Genomic DNA of O-3-M1 to O-3-M7 transformants.

[0044] Figure 6 Amplification results of the PcD5elo gene in transgenic maize

[0045] Marker: Molecular weight standard, with band sizes marked beside; N: Genomic DNA of negative control BY815; P: Positive control plasmid pZZ-HED; 1 - 7: Genomic DNA of O-3-M1 to O-3-M7 transformants.

[0046] Figure 7 Amplification results of the PsD4des gene in transgenic maize

[0047] Marker: Molecular weight standard, with band sizes marked beside; N: Genomic DNA of negative control BY815; P: Positive control plasmid pZZ-HED; 1 - 7: Genomic DNA of O-3-M1 to O-3-M7 transformants.

[0048] Figure 8 Amplification results of the bar gene in transgenic maize

[0049] Marker: Molecular weight standard, with band sizes marked beside; N: Genomic DNA of negative control BY815; P: Positive control plasmid pZZ-HED; 1 - 7: Genomic DNA of O-3-M1 to O-3-M7 transformants.

[0050] Figure 9 Specific PCR detection of the left border of transformant O-3-M1

[0051] M: DNA marker, with band sizes marked beside; N: Blank control; P: Plasmid; C: Receptor BY815;

[0052] T: O-3-M1. Detailed implementation

[0053] The transformation event O-3-M1 involved in this application refers to a maize plant obtained by genetic transformation using maize inbred line BY815 as the receptor, with an exogenous gene insert (T-DNA insert) inserted between specific genomic sequences. In a specific embodiment, the expression vector used for genetic transformation has Figure 1For the physical map shown, the resulting T-DNA insert has the sequence shown by nucleotides 395 to 20443 of SEQ ID NO.5. Transformation event O-3-M1 can refer to this transgenic process, or to the combination of the T-DNA insert and flanking sequences within the genome obtained from this process, or can refer to the maize plants obtained from this transgenic process. In a specific example, this event is also applicable to other recipient varieties transformed with the same expression vector, thereby obtaining plants with the T-DNA insert inserted at the same genomic location. Transformation event O-3-M1 can also refer to the progeny plants obtained by asexual reproduction, sexual reproduction, haploid or diploid reproduction, or a combination of the above of the above plants.

[0054] Example 1 Obtaining and Identifying Transformation Events

[0055] The nucleic acid sequences of the artificially synthesized PpD15des, MpD6des, PcD6elo, PsD5des, PcD5elo, and PsD4des genes were ligated to the basic vector of pZZ by homologous recombination, and finally a positive plasmid was obtained and named pZZ-HED (see the physical map of the vector in Figure 1 ). The recombinant vector was transformed into Agrobacterium tumefaciens EHA105, and the target sequence was detected. After the sequence detection was correct, the pZZ-HED plasmid was transformed into immature embryos of inbred maize BY815 by the Agrobacterium transformation method, and a batch of maize transformation events was obtained.

[0056] Leaf samples were taken from 99 T 0 -generation transgenic materials, and leaf DNA was extracted using the CTAB method. Six pairs of primers were used to detect foreign genes in transgenic plants. The specific detection method was as follows: Using maize genomic DNA as a template, PCR amplification was carried out with specific primer pairs for the PpD15des, MpD6des, PcD6elo, PsD5des, PcD5elo, and PsD4des genes (Table 2), and materials with band sizes of 1300 bp (PpD15des gene), 1392 bp (MpD6des gene), 850 bp (PcD6elo gene), 1278 bp (PsD5des gene), 850 bp (PcD5elo gene), and 1344 bp (PsD4des gene) were plants containing six foreign genes. The electrophoresis results of the PCR amplification products are as shown in Figures 2 to 8 .

[0057] Table 2 Primer Sequences for PCR Detection of Foreign Genes

[0058]

[0059]

[0060] Those containing foreign genes are labeled as 1, and those without are labeled as 0. After detection and screening, 20 events containing all genes were selected, and the specific event information is shown in Table 3.

[0061] Table 3 Statistics of PCR Detection Results of Foreign Genes

[0062]

[0063] The results showed that transgenic maize events O-3-M1 to O-3-M20 contained 6 foreign genes and exhibited stable generational heredity.

[0064] Example 2 Identification of Target Trait (DHA Content) and Agronomic Traits of Transformation Event O-3-M1

[0065] (1) Detection of DHA content in grains of T 1 generation transgenic materials

[0066] When determining the fatty acid content, the grains of T 1 generation maize transgenic materials were dried, crushed to triglycerides, and the oil (TAG) was extracted, then saponified and methylated with methanol and sodium methoxide, or reacted with 3-(trifluoromethyl)phenyl-trimethylammonium hydroxide (Meth Prep IITM, Fischer Scientific Cat#AT18007) in methanol at 1.25% to form fatty acid methyl esters. The resulting fatty acid methyl esters (FAME) can be analyzed by gas chromatography-mass spectrometry using a capillary column that separates FAME based on unsaturation and fatty acid chain length. Chromatography usually generates peak data, and the area under each peak is integrated. The area percentage is not absolute but provides an acceptable approximation. For example, by including reference standards and internal standards of known concentrations, the absolute yield in mg / g results can be calculated. The detection results showed that compared with the control, except that O-3-M10 and O-3-M19 did not contain DHA and EPA, the remaining transgenic materials contained 0.19 - 0.53 mg / g of DHA and 0.26 - 0.41 mg / g of EPA, and the content of α-linolenic acid (18:(3)) was significantly increased; among them, the contents of DHA, EPA, and α-linolenic acid in O-3-M1 were the highest, and the specific content detection information is shown in Table 4.

[0067] Table 4 Statistics of Detection Results of Unsaturated Fatty Acid Content

[0068]

[0069] (2) Agronomic Trait Evaluation

[0070] While identifying unsaturated fatty acids in several transformants, detailed records were also made of their yield-related traits, plant height and 100-seed weight. Statistical analysis of the data revealed that transformant O-3-M1 had the highest content of unsaturated fatty acids and exhibited good agronomic traits (Table 5).

[0071] Table 5 Investigation results of plant height and 100-seed weight traits The values are the means ± standard deviations from 3 biological replicates. Statistical analysis was performed using LSD for multiple comparisons (α = 0.05), and different letters indicate significant differences in the data in the same column at the same time period.

[0072] Overall, transformant O-3-M1 is the transformant with the highest DHA content in grains and good agronomic traits. Transformant O-3-M1 has been deposited in the China Center for Type Culture Collection (CCTCC) in the form of seeds, with the deposit number CCTCC NO: P202428, the deposit date: October 30, 2024; the deposit name: Maize seeds O-3-M1 (Zea mays L. O-3-M1); the deposit address: China Center for Type Culture Collection, Wuhan University, Wuhan, China.

[0073] Example 3 Analysis of flanking sequences of the insertion site of the exogenous sequence on the maize genome

[0074] To clarify the insertion site of transformation event O-3-M1, the present invention analyzed the flanking sequences of the insertion site of the exogenous sequence of O-3-M1 on the maize genome.

[0075] Take 100 mg of plant leaves, quickly grind them in liquid nitrogen, and extract total DNA using the CTAB method. After measuring the concentration of genomic DNA, ensure that the total amount of DNA > 2 μg. Using genomic resequencing, with each Read length of 150 bp, obtain at least 20 Gb of data, and ensure that the data quality index Q30 ≥ 80% (i.e., the proportion of bases with a sequencing error rate greater than 0.1% is less than 20%). According to the genomic resequencing results, use the BWA software with the exogenous sequence of the transgenic vector as a template to perform sequence homology comparison and screening with all the sequenced sequences (BWA, http: / / bio-bwa.sourceforge.net / , default settings). Further assemble and screen the selected sequences, and finally obtain a class of Read sequences, which are characterized by containing chimeric sequences of genomic sequences and vector sequences.

[0076] The above sequences were respectively subjected to Blast alignment with the maize B73 reference genome (MaizeGDB database https: / / www.maizegdb.org / blast) and the exogenous sequences of the vector, and the possible insertion position of O-3-M1 on the maize genome was found to be chr10:138203409 bp.

[0077] To verify the left border sequence of this insertion site, primers were designed respectively on the located maize genome sequence and its flanking vector T-DNA sequence: the sequences shown in SEQ ID NO.6 and SEQ ID NO.7. Using the genomic DNA of maize O-3-M1 as a template, PCR amplification was carried out. The obtained PCR products were subjected to first-generation sequencing, and the obtained flanking sequences were assembled into SEQ ID NO.2.

[0078] Analysis showed that the exogenous sequence was inserted forward at the position of chr 10:138203409 bp of the maize genome, and 12 bases "tggcaggatata" were deleted at the LB end of the vector.

[0079] Further analysis found that the T-DNA was inserted into the first exon of the Zm00001eb428370 gene encoding a nuclear localization protein with an AT-HOOK motif. Generally speaking, the insertion of exogenous fragments into genes often has a certain impact on the agronomic traits of the transformants. However, unexpectedly, there were no significant differences in the plant height and 100-kernel weight traits between O-3-M1 and the receptor control.

[0080] Example 4 Detection method for transformation event O-3-M1

[0081] Breeding can be carried out with the transgenic maize event O-3-M1, and the newly developed varieties can be used to produce agricultural products or commodities. If a sufficient amount is detected in the agricultural products or commodities, the agricultural products or commodities are expected to contain nucleotide sequences capable of diagnosing the presence of transgenic maize event O-3-M1 materials in the agricultural products or commodities. The agricultural products or commodities include, but are not limited to, corn oil, corn grits, corn flour, corn gluten, corn tortillas, corn starch, and any other food to be used as a food source for animal consumption, or alternatively as an ingredient in an expanding agent or cosmetic composition for cosmetic use, etc. Nucleic acid detection methods and / or kits based on probes or primer pairs can be developed to detect whether a biological sample contains nucleic acid analysis of transgenic maize event O-3-M1, wherein the probe sequence or primer amplification sequence is selected from the sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4 to diagnose the presence of transgenic maize event O-3-M1.

[0082] One of the detection methods is:

[0083] The genomic DNA of maize samples was extracted using the ordinary CTAB method. The specific operation process was carried out according to Announcement No. 1485-4-2010 of the Ministry of Agriculture and Rural Affairs, "DNA Extraction and Purification for the Detection of Transgenic Plants and Their Products". Among them, the maize samples included the maize to be genetically modified O-3-M1 and the non-genetically modified maize Zheng 58. The specific left border sequence in the O-3-M1 plants was detected by PCR method, and the used PCR primer pairs were SEQ ID NO.6 and SEQ ID NO.7 respectively.

[0084] PCR reaction system:

[0085]

[0086]

[0087] PCR reaction program:

[0088]

[0089] The PCR products were electrophoretically separated in a 1% agarose 1×TAE gel, and then developed under a gel imager.

[0090] The results are shown in Figure 9 . There was no amplification band in the non-genetically modified maize BY815, while the expected specific target band (SEQ ID NO.3) could be amplified in the O-3-M1 transformation event. This PCR method can trace the presence of the transformation event and thus be applied to breeding work.

[0091] In summary, the kernels of the transgenic maize event O-3-M1 of the present invention have a rich DHA content, and the detection method can accurately and rapidly identify whether the biological sample contains the DNA molecule of the transgenic maize event O-3-M1.

[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention.

[0093] Sequence Listing (DHA insertion sequence)

[0094] SEQ ID NO.1:

[0095] TCGCTTCAGTGTTGTGGTGTAA

[0096] SEQ ID NO.2:

[0097] CCAGCAGTACTCTCAAACTGTGGTTGCTTTATAAACTAGAGTTTTCCTCCGATTTTTTTTTTtGCATGTGGCATCTCTGTTATTTTTTATT

[0098] CATTTAAAATGTGGGGGTCCTTTAAAAACAAAATTCTGTGCCCAGTCCTCTAGTTAAAAGCATAACAAGGATATAGAGATTTTGTTGGTCT

[0099] TAGCTCTTAAGTAAGAGCACACTTTAAAGAATTGAGACATAAACATAAACGGAAGGCAGAGATATGGTGCAGGGCTGCAGGCTATATTACC

[0100] CAAAGCATCCAGCTGTTTCTTTTTGCCTGACCCAGGAGGACGCCCTCTACGCTTGCCGTCGGGGTTaGGGGTAGACCCGCCTCCACCGGAC

[0101] TGGGCACCCGTCGcTTCAGTGttgtggtgtaaacaaattgacgcttagacaacttaataacacattgcggacgtttttaatgtactgaatt

[0102] aacgccgaattaattcgggggatctggattttagtactggattttggttttagga

[0103] SEQ ID NO.3:

[0104] TTGGTTTCCCCAGCAGTACTCTCAAACTGTGGTTGCTTTATAAACTAGAGTTTTCCTCCGATTTTTTTTTTtGCATGTGGCATCTCTGTTA

[0105] TTTTTTATTCATTTAAAATGTGGGGGTCCTTTAAAAACAAAATTCTGTGCCCAGTCCTCTAGTTAAAAGCATAACAAGGATATAGAGATTT

[0106] TGTTGGTCTTAGCTCTTAAGTAAGAGCACACTTTAAAGAATTGAGACATAAACATAAACGGAAGGCAGAGATATGGTGCAGGGCTGCAGGC

[0107] TATATTACCCAAAGCATCCAGCTGTTTCTTTTTGCCTGACCCAGGAGGACGCCCTCTACGCTTGCCGTCGGGGTTaGGGGTAGACCCGCCT

[0108] CCACCGGACTGGGCACCCGTCGcTTCAGTGttgtggtgtaaacaaattgacgcttagacaacttaataacacattgcggacgtttttaatg

[0109] tactgaattaacgccgaattaattcgggggatctggattttagtactggattttggttttaggaattagaaattttattgatagaagtatt

[0110] ttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattcccttatctgggaacta

[0111] ctcacacattattatggagaaactcgaaattcgagctcagtcaaatctcggtgacgggcaggaccggacggggcggtaccggcaggctgaa

[0112] gtccagctgccagaaacccacgtcatgccagttcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatatccgagcgcctcg

[0113] tgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccctgtgcctccagggacttcagcaggtgggtgt

[0114] agagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggtcgactcggccgtccagtcgtaggcgttgcgtgccttcca

[0115] ggggcccgcgtaggcgatgccggcgacctcgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtcgtccgtc

[0116] cactcctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcagaccgccggcatgtccg

[0117] cctcggtggcacggcggatgtcggccgggcgtcgttctgggctcatggtagactcgatcctctagagtcgacctgcagaagtaacaccaaa

[0118] caacagggtgagcatcgacaaaagaaacagtaccaagcaaataaatagcgtatgaaggcagggctaaaaaaatccacatatagctgctgca

[0119] tatgccatcatccaagtatatcaagatcaaaataattataaaacatacttgtttattataatagataggtactcaaggttagagcatatga

[0120] atagatgctgcatatgccatcatgtatatgcatcagtaaaacccacatcaacatgtatacctatcctagatcgatatttccatccatctta

[0121] aactcgtaactatgaagatgtatgacacacacatacagttccaaaattaataaatacaccaggtagtttgaaacagtattctactccgatc

[0122] tagaacgaatgaacgaccgcccaaccacaccacatcatcacaaccaagcgaacaaaaagcatctctgtatatgcatcagtaaaacccgcat

[0123] caacatgtatacctatcctagatcgatatttccatccatcatcttcaattcgtaactatgaatatgtatggcacacacatacagatccaaa

[0124] attaataaatccaccaggtagtttgaaacagaattctactccgatctagaacgaccgcccaaccagaccacatcatcacaaccaagacaaa

[0125] aaaaagcatgaaaagatgacccgacaaacaagtgcacggcatatattgaaataaaggaaaagggcaaaccaaaccctatgcaacgaaacaa

[0126] aaaaaatcatgaaatcgatcccgtctgcggaacggctagagccatcccaggattccccaaagagaaacactggcaagttagcaatcagaac

[0127] gtgtctgacgtacaggtcgcatccgtgtacgaacgctagcagcacggatctaacacaaacacggatctaacacaaacatgaacagaagtag

[0128] aactaccgggccctaaccatggaccggaacgccgatctagagaaggtagagagggggggggggaggacgagcggcgtaccttgaagcggag

[0129] gtgccgacgggtggatttgggggagatctggttgtgtgtgtgtgcgctccgaacaacacgaggttggggaaagagggtgtggagggggtgt

[0130] ctatttattacggcgggcgaggaagggaaagcgaaggagcggtgggaaaggaatcccccgtagctgccggtgccgtgagaggaggaggagg

[0131] ccgcctgccgtgccggctcacgtctgccgctccgccacgcaatttctggatgccgacagcggagcaagtccaacggtggagcggaactctc

[0132] gagaggggtccagaggcagcgacagagatgccgtgccgtctgcttcgcttggcccgacgcgacgctgctggttcgctggttggtgtccgtt

[0133] agactcgtcgacggcgtttaacaggctggcattatctactcgaaacaagaaaaatgtttccttagtttttttaatttcttaaagggtattt

[0134] gtttaatttttagtcactttattttattctattttatatctaaattattaaataaaaaaactaaaatagagttttagttttcttaatttag

[0135] aggctaaaatagaataaaatagatgtactaaaaaaattagtctataaaaaccattaaccctaaaccctaaatggatgtactaataaaatgg

[0136] atgaagtattatataggtgaagctatttgcaaaaaaaaaggagaacacatgcacactaaaaagataaaactgtagagtcctgttgtcaaaa

[0137] tactcaattgtcctttagaccatgtctaactgttcatttatatgattctctaaaacactgatattattgtagtactatagattatattatt

[0138] cgtagagtaaagtttaaatatatgtataaagatagataaactgcacttcaaacaagtgtgacaaaaaaaatatgtggtaattttttataac

[0139] ttagacatgcaatgctcattatctctagagaggggcacgaccgggtcacgctgcactgcag

[0140] SEQ ID NO.4:

[0141] Gtcactggattttggttttaggaattagaaattttattgatagaagtattttacaaatacaaatacatactaagggtttcttatatgctca

[0142] acacatgagcgaaaccctataagaaccctaattcccttatctgggaactactcacacattattctggagaaaaatagagagagatagattt

[0143] gtagagagagactggtgatttttgcggacAGGCCTtcaggtatccttcggcttgacgcccacgttattgcagttcctgaacatgtaaacgc

[0144] cgtcatgattctccacgaactggcagctcctccaggtcttccagagggacacccacatgttctcgtcggtgtgcctgtagtgctcgcccat

[0145] caccttcttgatgcactcggtggcctccctggcgtggtagaatgggatcctggacacgtagtggtggaggacatgggtctcgatgatgtcg

[0146] tggaaaatgatgcccaggatgccgaactccctgtcgatggtagccgcggcgcccttcgcgaacgtccactcctgggcgtcgtagtggggca

[0147] tggaggagtcggtgtgctggaggaacgtcacgaagacgagccagtggttcaccagaatccaggggcagaaccaggtgatgaaggtcggcca

[0148] gaagccgaaaaccttgtaggcggtgtacacggaggtgagggtggccaggatgccaaggtcggacaggacgatgtaccagtagtccttcttg

[0149] tcgaacacgggggaggatggccagtagtgggagcggaagaactttgacacgcctgggtacggctggccggtggcgttcgtggcaaggtaga

[0150] gggacaggccgcccagttgctggaacaggagcgcgaaaacgctgtagattggggtctcctcggcgatgtcgtgcagggaggtaacctgatg

[0151] cttctccttgaactcctccgcggtgtacggcacgaacaccatgtccctggtcatatggccggtggccttgtggtgcttggcgtgggagaac

[0152] ttccaggagaagtacgggaccataaccagggaatgcagcacccagcccaccgtgtcgttcacccagccgtagttggagaaggcggagtggc

[0153] cgcactcgtggccaaggatccaaatgccgaagccgaagcaagagatggagaacacgtaggcggaccaggccgcgaacctgaggaactcgtt

[0154] cggcaggagcgggatgtaggtcaggcccacgtaggcgatggcggagatcgccacgatgtcgcgcaccacgtaggacatgctcttcaccagg

[0155] cttctctcgtagcagtgctttgggatggcgtccaggatgtccttgatggtgtagtccggcaccttgaacacgttgccgaaggtgtcgatgg

[0156] cggtcttctgctgcttgaaggaggccacgttgccgctcctcctcacggtcttggtggagccctccaggatctcggagccggacacggtcac

[0157] cttggacatAGGCCTATTCCGGCCGGCTCTGCTGCTTGTGCTTGGTCGACTACTGATGTGGGATGAGCGTCAGATCGTCATGCATGCATGA

[0158] CCCTGCCTGCTTGTTGGCTCGCAGATATAGGCGCGGCCGGGCGCGCGGCCGGCGTTTGTCATGGCTGAGTCATGACCGTGGGTTTGTCATG

[0159] GCTGAGTCATGACCGTGGGTTTGTCATGGCTGAGTCATGACCGTGGGTTTGTCATGGCTGAGTCATGACCGTGGGTTTGTCATGGCTGAGT

[0160] CATGCGGCGCGCTTGACGTGTAAAGTAGCGGCGACGCGTGGCGAGCTGCGGCGGCGGCGCATGCGTACGTGCAACAAACTGCCCGCACGGG

[0161] CTGCATGCGCGCCAGGTCAGCTAGGGGCAGCACGCTGAGCCGAGTGCGTGCCGTACGAAGCGTCGCCAGCAGGTGATTCTAACTTTAGTTT

[0162] GTTGCACGTACACTAAACTTTCTAGGTGACCTTTACACATGTGTACCGATCCACCCACCCACCCCTCCTCGCCTGTCATGACTCAGCCATG

[0163] ACAAACGCTAACCATGACTCAGCCATGACAAACGGAGGCCATGACTCAGCCATGACAAACGGTATCCATGACTCAGCCATGACAAACGCAT

[0164] GCATGACTCAGCCATGACAAACGGGATCGGAGGAGGTTGTCCTTGACGTCGTCTCGAGTCGACGACGAGGTCGCAGCACCGGGCATGCATG

[0165] AGCCTCACGCGGTGCGGTGGCAGCAGGTGGCAGGGAGCGAGCCGCCACGTGCCGCGCTGCCACGTGAGTATAAGTACCCTGCTCTGCTATA

[0166] TAGAGGTCGCAACTCGCTGGCCATAGATCCATTGATTGATCGGACGGACGCGCGTCTCCGGTCCCGTCCGTAATAACACTGATCCGATCCA

[0167] CGCCGGCCGGCGGTTTAAACATGGCCTCCATCGCCATCCCGGCCGCCCTGGCTGGCACTCTTGGCTACGTGACGTACAACGTCGCCAACCC

[0168] CGACATCCCGGCCTCCGAGAAGGTCCCCGCCTACTTCATGCAAGTGGAGTACTGGGGCCCCACCATCGGCACCATCGGCTACCTGCTGTTC

[0169] ATCTACTTCGGCAAGCGCATCATGCAAAACAGGTCCCAACCGTTCGGCCTTAAGAATGCCATGCTGGTCTACAACTTCTACCAGACCTTCT

[0170] TCAACTCCTACTGCATCTACCTCTTCGTGACCTCTCATAGGGCCCAGGGCCTCAAGGTGTGGGGCAATATCCCGGACATGACCGCCAACTC

[0171] CTGGGGCATCTCCCAGGTCATCTGGCTCCACTACAACAACAAGTACGTGGAGCTGCTGGACACCTTCTTCATGGTGATGCGCAAGAAGTTC

[0172] GATCAACTCTCCTTCCTGCACATCTACCACCACACCCTCCTCATCTGGTCCTGGTTCGTGGTGATGAAGCTGGAGCCGGTGGGCGACTGCT

[0173] ACTTCGGCTCCTCCGTGAACACCTTCGTGCACGTGATCATGTACTCCTACTACGGCCTCGCCGCCCTCGGCGTGAACTGCTTCTGGAAGAA

[0174] GTACATCACCCAAATTCAAATGCTCCAATTCTGCATCTGCGCCTCCCACTCTATTTACACCGCCTACGTCCAGAACACCGCGTTCTGGCTC

[0175] CCCTACCTGCAACTTTGGGTTATGGTGAACATGTTCGTCCTGTTCGCCAACTTCTACAGGAAGAGGTACAAGTCCAAGGGCGCCAAGAAGC

[0176] AGTGAGTTTAAACAATCTTGGACTCCCATGTTGGCAAAGGCAACCAAACAAACAATGAATGATCCGCTCCTGCATATGGGGCGGTTTGAGT

[0177] ATTTCAACTGCCATTTGGGCTGAATTGAAGACATGCTCCTGTCAGAAATTCCGTGATCTTACTCAATATTCAGTAATCTCGGCCAATATCC

[0178] TAAATGTGCGTGGCTTTATCTGTCTTTGTATTGTTTCATCAATTCATGTAACGTTTGCTTTTCTTATGAATTTTCAAATAAATTATCAGAT

[0179] CCGGTATGAATTTGGAAACAAATTCAGTACTTTTAAAAAAATTTGTTGTAGGGAGCAAATAATACATAAAATAATTTATGCATTATTTTAT

[0180] TTTTTATTTGTAATAATATGCTTGAAACGATAATTCAGTATGCATGTTGTGCCAGTGTACTACACGGGCGGGGGGAGGGGATTGAGTGGGC

[0181] CAGCGCGGTGCGTAGGGTAGATGGGCTGAAATTGATAACTCAAGTCCGACTAGGTTCTCTTTTTATTTCCCTTCCTTTTCTATTTTCCTTT

[0182] CTTTTAATTTTCATGCTTTCAAACTAAATTCAAATTCGAGTTTTGAATTTCAGCTTCTAAATTGTACACTAAAATTATATGATAAGGTAAC

[0183] CCCTACTATTACTTTTAATTTTTTTATTCTACCCCATATTGTTTACTTAGGGGAGAATAATTGACTTAATCACATTCTTCCTAGGTTTCAA

[0184] TTCTCAATCTTTCAAATCCACATTTTTAGATTTCTATTTTGAATTTAAATACCAGTTTGGATTTAGAGTTCAATTTCAAAATACACAACCA

[0185] AAATACCAGCATGAATGCAAATATATTTTATGTTTATGTATTTACTTTTCTTTTATACTTTGCTCAAAATAGTTATTTTCATGTATGAAAC

[0186] TCAATAAGCAAGGAACTCACGTTATTATATAACCTAATAGGAATAATTTAGGTAACATAATTTATCATCCTCTTGATTTAAAAGAGATATG

[0187] CCTCCAGAATAAGACACATACTAAAAATAACTCTAATATTGAATAACTAAAGTCGTACAAATCTCTACTATTATTCCTATAAAATAATAAA

[0188] GAACTAGCTACAACTTCTTTAAGGCATTATTCAGGGTTTACAGCTTGAGAGGCATGAACCCATCCTGTATACTCCTGGACTTGGAAGACAA

[0189] AATGTCAACCAAAGTGAAAGGTTTTCTTATGGTTGCTGCTAAGAGATAGATTGAACACTAGATCTCTCCTAAGACGTCAGGGCATGCGTTT

[0190] AGACTCCTACACATGCGAAAACTGCATCTTACAGTTGGAAGAAACTATATCTCACCACTTCCTGCGGTGTAACTTTGCCCAAAGATGTTGG

[0191] CTCACTGTTGGAATCACTCCGCCCCGAACTTTGGATCTAACGCTTGCAGTGCTACATATTAGAGCAAGACTAACAATGCCGTGGAGAATGG

[0192] AAGGTATTATAACCATGTCATGGTGCATATGGAAATGTCGAAATAACTGGATATTCGAAAACATACCGCCAACGGTGGCGGCCTGCAAGGA

[0193] AATGTTCAAGACTGAAATGAACTACATCTGCTACCAAGTTAAGCTCGAGACAGGAGCTAAAAGTAGAAACTGGATACAACACTTTGTAACA

[0194] TAGTGACACTCCCCTTTTCCTTTCTTTTACCTTAGAACTATACATACAATCCACATTCAATAAAAATTTGTAGGTACGCCATACACACTAC

[0195] CGGAATCCGGCTCTTTGCCGAGTGTGAGGCGCTTTGTCGAGTGCTTTTTGTCCAGCACTCGGCAAAAAAGTCTTTGCCATGTGCCGCACTC

[0196] GGCAAAGTCCTGCTCTCGGTAACGACCGCGTTTACCGAGAGCAGGACTCTCGACACAGAAATACACTCGACAAAGAAATCTTTGCCGAGAG

[0197] CCAAACACTCGGCGAACGGCAGCGCTCGGCAAAGGGTCGTCAGCCGCCGTCTAAAGCTGACGGTCGTTATCTTTGTCGAGTGCCCCCTCGT

[0198] CCGACACTCAGTAGAGCAAGCTTGCCGAGTGCCATCCTTGGACACTCGATAAAGTATATTTTATTTTTTTTTATTTTGCCAACCAAACTTT

[0199] TTGTGGTATGTTCCTACACTATGTAGATCTACATGTACCATTTTGGCACAATTACAAAAATGTTTTCTATAACTATTAGATTTAGTTCGTT

[0200] TATTTGAATTTCTTCGGAAAATTCACATATGAACTGCAAGTCACTCGAAACATGAAAAACCGTGCATGCAAAATAAATGATATGCATGTTA

[0201] TCTAGCACAAGTTACGACCGAATTCAGAAGCAGACCAGAATCTTCAAGCACCATGCTCACTAAACATGACCGTGAACTTGTTATCCAGTTG

[0202] TTTAAAAATTGTATAAAACACAAATAAAGTCAGAAATTAATGAAACTTGTCCACATGTCATGATATCATATATAGAGGTTGTGATAAAAAT

[0203] TTGATAATGTTTCGGTAAAGTTGTGACGTACTATGTGTAGAAACCTAAGTGACCTACACATAAAATCATAGAGTTTCAATGTAGTTCACTC

[0204] GACAAAGACTTTGTCAAGTGTCCGATAAAAAGTATTCAGCAAAGAAGCCGTTGTCGATTTACTGTTCGTCGAGATCTCTTTGCCGAGTGTC

[0205] ACACTAGGCAAAGTCTTTACGGAGTGTTTTTCAGGCTTTGACACTCGGCAAAGCGCTCGATTCCAGTAGTGACAGTAATTTGCATCAAAAA

[0206] TAGCCGAGAGATTTAAAATGAGTCAACTAATAGACCAACTAATTATTAGCTATTAGTCGTTAGCTTCTTTAATCTAAGCTAAAACCAACTA

[0207] ATAGCTTATTTGTTGAATTACAATTAGCTCAACGGAATTCTCTGTTTTTTCTATAAAAAAAAGGGAAACTGCCCCTCATTTACAGCAAACT

[0208] GTCCGCTGCCTGTCGTCCAGATACAATGAACGTACCTAGTAGGAACTCTTTTACACGCTCGGTCGCTCGCCGCGGATCGGAGTCCCAGGAA

[0209] CACGACACCACTGTGGAACACGACAAAGTCTGCTCAGAGGCGGCCACACCCTGGCGTGCACCGAGCCGGAGCCCGGATAAGCACGGTAAGG

[0210] AGAGTACGGCGGGACGTGGCGACCCGTGTGTCTGCTGCCACGCAGCCTTCCTCCACGTAGCCGCGCGGCCGCGCCACGTACCAGGGCCCGG

[0211] CGCTGGTATAAATGCGCGCCACCTCCGCTTTAGTTCTGCATACAGCCAACCCAACACACACCCGAGCATATCACAGTGACAGACACTACAC

[0212] GTTAATTAAATGGAGTTCGCCCAGCCGCTGGTGGCCATGGCCCAGGAGCAGTACGCGGCCATCGACGCCGTGGTGGCCCCAGCTATCTTCT

[0213] CCGCCACCGACAGCATCGGCTGGGGCCTGAAGCCGATCAGCTCTGCCACCAAGGACCTGCCGCTGGTTGAGAGCCCAACGCCTCTTATCCT

[0214] GTCCCTGCTTGCCTACTTCGCCATTGTCGGCAGCGGCCTGGTCTACAGGAAGGTGTTCCCAAGGACCGTGAAGGGCCAGGACCCTTTCCTT

[0215] CTGAAGGCCCTCATGCTCGCCCACAATGTCTTCCTCATTGGCCTCTCCCTGTACATGTGCCTGAAGCTGGTGTACGAGGCGTACGTGAACA

[0216] AGTACTCATTCTGGGGCAACGCGTACAACCCGGCCCAGACCGAGATGGCCAAGGTGATCTGGATTTTCTACGTGTCCAAGATCTACGAGTT

[0217] CATGGATACCTTCATTATGCTGCTGAAGGGCAACGTTAACCAGGTGTCTTTCCTGCACGTGTACCACCACGGCTCCATCTCCGGCATCTGG

[0218] TGGATGATTACCTACGCCGCCCCGGGCGGCGACGCTTACTTCTCTGCCGCCCTGAACTCCTGGGTGCACGTTTGCATGTACACCTACTACT

[0219] TCATGGCGGCTGTGCTTCCGAAGGACGAGAAGACCAAGAGGAAGTACCTCTGGTGGGGCAGGTACCTGACGCAGATGCAAATGTTCCAGTT

[0220] CTTCATGAACCTGCTGCAAGCCGTGTACCTGCTGTACTCTTCCTCCCCGTACCCAAAGTTCATCGCCCAACTGCTCGTGGTGTACATGGTG

[0221] ACCCTGCTCATGCTCTTCGGCAACTTCTACTACATGAAGCACCACGCCTCTAAGTGATTAATTAATCCCGATCGTTCAAACATTTGGCAAT

[0222] AAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACAT

[0223] GTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGC

[0224] GCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGTcgattaaaaatcccaattatatttggtctaatttagtt

[0225] tggtattgagtaaaacaaattcgaaccaaaccaaaatataaatatatagtttttatatatatgcctttaagactttttatagaattttctt

[0226] taaaaaatatctagaaatatttgcgactcttctggcatgtaatatttcgttaaatatgaagtgctccatttttattaactttaaataattg

[0227] gttgtacgatcactttcttatcaagtgttactaaaatgcgtcaatctctttgttcttccatattcatatgtcaaaatctatcaaaattctt

[0228] atatatctttttcgaatttgaagtgaaatttcgataatttaaaattaaatagaacatatcattatttaggtatcatattgatttttatact

[0229] taattactaaatttggttaactttgaaagtgtacatcaacgaaaaattagtcaaacgactaaaataaataaatatcatgtgttattaagaa

[0230] aattctcctataagaatattttaatagatcatatgtttgtaaaaaaaattaatttttactaacacatatatttacttatcaaaaatttgac

[0231] aaagtaagattaaaataatattcatctaacaaaaaaaaaaccagaaaatgctgaaaacccggcaaaaccgaaccaatccaaaccgatatag

[0232] ttggtttggtttgattttgatataaaccgaaccaactcggtccatttgcacccctaatcataatagctttaatatttcaagatattattaa

[0233] gttaacgttgtcaatatcctggaaattttgcaaaatgaatcaagcctatatggctgtaatatgaatttaaaagcagctcgatgtggtggta

[0234] atatgtaatttacttgattctaaaaaaatatcccaagtattaataatttctgctaggaagaaggttagctacgatttacagcaaagccaga

[0235] atacaaagaaccataaagtgattgaagctcgaaatatacgaaggaacaaatatttttaaaaaaatacgcaatgacttggaacaaaagaaag

[0236] tgatatattttttgttcttaaacaagcatcccctctaaagaatggcagttttcctttgcatgtaactattatgctcccttcgttacaaaaa

[0237] ttttggactactattgggaacttcttctgaaaatagtGtcactggattttggttttaggaattagaaattttattgatagaagtattttac

[0238] aaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataagaaccctaattcccttatctgggaactactca

[0239] cacattattctggagaaaaatagagagagatagatttgtagagagagactggtgatttttgcggacGGGTCCCtcactgcatcttcttctc

[0240] tggggcgtgggcgacgttgtccaggttggcgaaggtgtcggccatggcctcgaagtagccgcgaacgtcgtagtgcaggccgtgcttctcg

[0241] aacagctgcttgacgcgtggggcgatcttcgggtgccggaactgcggcatggacgggtacagatgatgctcgatctggtagttgaggtagg

[0242] acatccaccagtcgcaccaccaggacggagagcaattggtagtgtggttggcggcgtactccacccaagtagcgtgctcgttcggctccac

[0243] aaccgggagatgggtgtgggaaacggcgaaattgcagaagatgtacatggcgcccagttgcacgtacagaaggtagcaggcgagcacgtag

[0244] ccggcgccgtagttggcggccaggtagccaaccaggccgtacctgatgccgagcatcgccagctcgtcgtagtgcttggtcctcagcatgt

[0245] gcctcgggtgcaggtacagctgccagccgagggccaccagcagggtggtgactggggcgaacagcttggcctgcatggacagccacgcctt

[0246] catggccggggacttcaccttggccgcgatcctctcgtggaaggccaccagcggcagggtgtccaggtccacgtcgtgctgcagcttctgg

[0247] ggggtcgcatggtgcttgttgtgctggttcctccaccaagcgccggacatgccgcagcccaggccgtagcaggcgacctggatcgccctgt

[0248] cgaaggcaatgttgccggtcagagagtaatggccgccctcatgcataagccagccgcagcggccctgcacaacgcccagcatggcaatgcc

[0249] ggcgaaggtgtagccgtgccaaatcagggcggcgccggcaacgtgcatggcgataacctcggccagtctgtaggcgacgtgcggcagggac

[0250] ggctcgaacatgccctcggcctccagttgctttgtgaactcttggaagtcggcgatcagatcagcgcggcggggggagtagcccttgtgga

[0251] ctggcctggacggcaggctcttcagcatcttgtcggccttcgcggaccgcacgtggaactgcttgtaggcgtcggtggcgtcggtgccgac

[0252] ttggtaggcgatgatcttgccgcccgggtggcgcttcacgaagttggtcacgtcgtaggcccggtcgccgatcaccagctccttcttgtcg

[0253] tgctcctgcggggtgtccacctcgtgaagctgagcggacggcggggcggcgtaggagtaggagtcccttggcggcatGGGTCCCctgcgag

[0254] tgcgagtgtgcgttcgatgcgagggttcgaagcgagctgcggcgtatatgaagaggtggcgcggcgagggtcgcagccatgcgcgccgcca

[0255] ggtggaggccgggccgcgtacgtggcggggcgaaggcgatgtggagcgcgcgcgcgcgctgcagtgctaccgcactcggccgcatccgtgc

[0256] agctgccgccgtgtgcttgcgtgcgtgcgtgcatgctagctcgctgctgggatgcctgcggcgaagcgacagcggtgattgggatggggac

[0257] aacacggagcagatggagctgcacgtagcgacgcggggctttttcagagagtgctttttttcccaaagatttctgataatctggattctta

[0258] aaaaatagctgttacgacaatttttatacgatttatgtgctaaagaagacaaaggagtctacgcgcagcatcacattcatactatcacgac

[0259] gattcgatagattctatatttagatgtaatttttatataaacgattctaacaaaaatagactatgaaaagcaaaacatttagctagcagaa

[0260] gctgattccgacgactcgaaactagctaagggcccgttcgattctgaggaattggccgtccggaactattcctagccggattggttatcta

[0261] atttatataacatttgattagctggaacaattccgggatgaattccgagtcaaacgaacaggccctaaaagctgcagagccagcgtccatc

[0262] tcatatgatttgagcaatattatcaattattcgggtcgggtgtgcttcagcggtgaagattctcggggcctgctgaacaaataaataaaga

[0263] ggcaaacactcttcgaccgcgtataaaaggactcaagcaaaggctctagtcgtttatagttgcttgtagtacttcaactttatccgtgtaa

[0264] tccaagagtagaaagttcttggatgacagttgcgtggcatggccgtaatacaattgcgttgctcttggatgacagtggctcaatctttaca

[0265] gagcatgatctcaaaactaacctgctttggaatatgttcaaatgtcgcttgggatcctccgattttgtggataatgtctttgatctttcta

[0266] gtttgttgctctgccgcaatgacttgcattggttagatgagcctttttcaaagcaagaaattgatagtattgtggcgtcccttccttctga

[0267] taaatccccgggacctgatgggtttaataccaactttatcaaaaaaatgttgtccgattatttcccaggacttctatgacttatgtgacca

[0268] attttaccacggggatatttgtcttcgaagcatcaatggttcttatattgtcctgattccgaagaaggataatgctagtttagtgggcgat

[0269] ttcagaccaatttcgcttctgaataatagtatgaaaatcatcactaagctgctggctaaccggttacagacagtgatgacttcccttgttc

[0270] acaaaaatcaatatggcttcatcaaagaaagaaccattcaggattgtctggcctgggcatttgaatatattcatctttgtcatatttcaaa

[0271] aaaagagattattgtgctcaaattggattttgaaaaggcttttgattctcttgagcatgagttgattcttcaggtaatgttgcatagaggc

[0272] tttgggcccagatggatgagctggattagggatattcttcggtctagcacgtcatcagtccttcttaatggtgttcctgggaaaacctttc

[0273] actacaagcgtggggttaggcagggagatcccctctcgcctcttctttttgttctcgcggcggatctgttacagagcatcatcaataaagc

[0274] gcggcagcaagaccttctcaagttacccctggccgagaattgtggtcaagattttccgatagttcaatatgcggatgacacactactgata

[0275] atggaagcttgccctagacagctattttttctcagagccgttctgaactcttttgcaacttcgacggggttgaaggtgaattacaacaaat

[0276] caagtatgtaccccatcaatgtcagtcctgctaaaatggcgatcctagcaggaaccctcaactgtcagataggttcaatgccctttaccta

[0277] tcttggtgttccgcttggtctatcaaagcctaaaatctgccactttttaccgctcattcataggattcaaaagagattatcatgcacctct

[0278] gccctcctctcccaggctggcaggcttgagcttgttaactcggtgttctcagctctcccgacctttttgatgtgcacactgaaaattccgg

[0279] ttaccacggtaaagaagattgattcttatcggaaacactgtctttggagaggaaacgacgtcaattcaaagaaacctgctctagctacttg

[0280] gagtatgattacacagactaaaaaaatgggggcctgggagtggtaagattagagactcacaataaagccttgcttctgaagtttttgcaca

[0281] agtttttcaacaatcatgatattccctgggttaacctggtttggagcaactattacaggacagtcaggctacctggttgctcaaaaattgg

[0282] ctccttttggtggaaaagcttgcttactcttgtccaagattacaagggactggctgccccaactatcggggatggaagaaccattcttttc

[0283] tgggaagatatgtggaataggggcatcccggctcatcaatatcctgagttattttcctttgcttgcaacagcaaacttaccatcaaagaag

[0284] ctctccaaaaggaacaacttattgaaatttttcagctacctctgtcggtgcaagcttatgaacaatttctagacttagacgcaacttgggg

[0285] ccaaatcatggtggccaatacaaatgatgcttggaaactcatttggggagccgataatttctctacaaagaaaacttatagacatttgatg

[0286] ggtcaggctcaggttcaccagatcttcagatcgcGatctgataatttatttgaaaattcataagaaaagcaaacgttacatgaattgatga

[0287] aacaatacaaagacagataaagccacgcacatttaggatattggccgagattactgaatattgagtaagatcacggaatttctgacaggag

[0288] catgtcttcaattcagcccaaatggcagttgaaatactcaaaccgccccatatgcaggagcggatcattcattgtttgtttggttgccttt

[0289] gccaacatgggagtccaagattCCTGCAGGtcagtgcgccttctcggccttgccattcacgtagtaatgttggccaaccttgtccaggttg

[0290] ctgaaagtggccttccaggcgccgtagtaggagagcaccttgtagttcaggccccacttcttggcgaacggcacgaacctgcgagacacct

[0291] ccggctggcggaactggggcatgtccgggaaaaggtggtggatgacttggcagttgaggtagcccatgagccagttgacgtagccgcggga

[0292] cgggtcgatgtcaacggtgtggtccacggcgtaattgacccaggaaaggtgcttgtcagaggggaccaccggcaggtgggtatgggaggtg

[0293] gagaagtgcgcgaacaggtacatgtaggcgatccagttgccgaaggtgaaccaccagtaagccaccggccaggagtagccggtcgccagct

[0294] tgatgacggcggtcctcaccacgtggctaacaagcatccaggacgcctcctcgtagttcttcttcctaagcacctgcctcggatgcagcac

[0295] gtagatccagaaagcctgcacgagcaggccggaggtcaccggcacgaaggtccacgcctgcagcctagcccaggccctgctgaagcccctg

[0296] gggcggttgtcctcaacggccgtgttgaagaaggccacggctggggtcgtgtccagatccatatcgtgtctcaccttctgcggggtcgcgt

[0297] ggtgcttgttatgcatttggttccacatctcgccggaggtagacaggccgaagccgcaggtcatggcctgcagcctcttgtcaacgtacac

[0298] gctgccggtcagggagttatggccgccctcgtgctgcacccagccgcacctggcgccgaagaaggcgccgtacaccacgctggcaataatc

[0299] gggtagccggcgtacatcagggcggtgcccagggcgaaggtcgcaagcagctccagcagcctgtacgccacgtgggtaatggagggcttga

[0300] agaagccgtccctctccagctcggccctccacctggcgaagtcctccagcatcggcgcgtcctcggactccgaccgcttgatctcagccgg

[0301] cctagacggcagggcgcgcagcatcttccacgccttcaggctgcgcatatggaactccttgaaagcctcggtcgcgtccgcgccggtgttg

[0302] gccagcatgtagaaaatcacggagccgcccgggtgcttgaagttggtcacgtcgtactccacgtcctccaccctcacccagcgtgtctcga

[0303] aggtggcggccagctcgtgtggctccagggtcttcaggtccaccggggcggtggaagcgtccttggcgtccagcgcctccgcggaggactt

[0304] ggacctggtcagcggggaccttggggaggacctgccgtcggtcttcggcgggcacatCCTGCAGGATTCCGGCCGGCTCTGCTGCTTGTGC

[0305] TTGGTCGACTACTGATGTGGGATGAGCGTCAGATCGTATGCTGGATGACCCTGCCTGCTTGTTGGCTCGCAGATATAGGCGCGGCCGGGCG

[0306] CGCGGCCGGCGGTGGACCGTGGACGGCGCGCGCATGCAAGAGCGGCGACGCGTGGCGAGCTGCGGCGGCCGCGCATGCGCACGTGGCTGCC

[0307] CGCACGGGCTGCATGCGCGCCAGGTCAGCTAGGGGCAGCACGCTGAGCCGAGTGCGTGCCGTACGTAGCGTCGCCAGCAGCTGATTCTAAC

[0308] TTTCTGTTCTAAACTTTCTAGGTGCATGGTACCGATCCACCCACCCACCCCTCCTCGCCTGTCTGCCACGCACGGGATCGGAGGAGGTTGT

[0309] CCTTGACGTCGTCTCGAGTCGACGACGAGCTCGCAGCACCGGCCGCTAGCTGGCCTCACGCGGTGCGGTGGCAGCAGGTGGCAGGGAGCGA

[0310] GCCGCCACGTGCCGCGCTGCCACGTGAGTATAAGTACCCTGCTCTGCTATATAGAGCTCGCAACTCGCTGGCCATAGATCCATTGATTGAT

[0311] CGGACGGACGCGCGTCTCCGGTCCCGTCCGTAATAACACTGATCCGATCCACGCCGGCCGGCGGCCCGGGCATGCCGCCAAGCGCCGCTAA

[0312] GCAGATGGGCGCCTCCACCGGCGTGCACGCTGGCGTGACTGACTCCTCCGCCTTCACCAGGAAGGACGTGGCCGACAGGCCGGACCTGACC

[0313] ATCGTGGGCGACTCCGTGTACGATGCCAAGGCGTTTCGCTCCGAGCACCCGGGCGGCGCTCATTTCGTTTCCCTCTTCGGCGGCCGCGACG

[0314] CCACCGAGGCTTTCATGGAGTACCACCGCAGGGCGTGGCCTAAGTCCAGGATGTCCAGGTTCCACGTGGGCTCCCTTGCGTCCACCGAGGA

[0315] GCCGGTGGCCGCTGATGAGGGCTACCTGCAGCTGTGCGCGAGGATTGCCAAGATGGTGCCGAGCGTGTCCTCCGGCTTCGCGCCAGCTTCC

[0316] TACTGGGTCAAGGCTGGCCTCATTCTGGGCTCTGCCATTGCCCTGGAGGCGTATATGCTGTACGCCGGCAAGAGGCTGCTGCCGTCCATCG

[0317] TGCTGGGCTGGCTTTTCGCCCTGATCGGCCTGAATATCCAACATGACGCCAACCACGGCGCCCTGTCCAAGAGCGCCTCCGTGAACCTGGC

[0318] CCTGGGCCTGTGCCAGGATTGGATCGGCGGCTCAATGATCCTCTGGCTGCAGGAGCACGTGGTGATGCACCACCTGCACACCAACGACGTC

[0319] GACAAGGACCCGGACCAAAAGGCCCATGGCGCCCTCAGGCTCAAGCCGACCGACGCTTGGTCCCCAATGCACTGGCTGCAGCACCTGTACC

[0320] TGCTCCCAGGCGAGACCATGTACGCCTTCAAGCTCCTCTTCCTCGACATTTCCGAGCTGGTGATGTGGAGATGGGAGGGCGAGCCGATCTC

[0321] CAAGCTCGCTGGCTACCTCTTCATGCCCTCTCTGCTGCTGAAGCTGACCTTCTGGGCCAGGTTCGTCGCCCTGCCGCTGTACCTCGCCCCG

[0322] TCTGTGCACACCGCGGTGTGCATCGCCGCCACCGTTATGACCGGCTCCTTCTACCTCGCCTTCTTCTTCTTCATCTCTCACAATTTCGAGG

[0323] GCGTCGCCTCCGTGGGCCCCGATGGCTCCATTACTTCCATGACGCGCGGCGCCTCCTTCCTGAAGCGCCAGGCTGAGACCTCCTCCAACGT

[0324] GGGCGGCCCGCTGCTCGCTACCCTGAATGGCGGCCTTAATTACCAAATTGAGCACCACCTGTTCCCGAGAGTGCACCACGGCTTCTACCCG

[0325] AGACTCGCCCCGCTGGTCAAGGCCGAGCTGGAGGCTCGCGGCATCGAGTACAAGCATTACCCGACCATCTGGAGCAACCTGGCCTCCACCC

[0326] TTAGGCATATGTACGCGCTCGGCAGGAGGCCCAGGTCCAAGGCTGAGTGAGCCCGGGCTCCCGATCGTTCAAACATTTGGCAATAAAGTTT

[0327] CTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGC

[0328] ATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACT

[0329] AGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG

[0330] SEQ ID NO.5:

[0331] TTGGTTTCCCCAGCAGTACTCTCAAACTGTGGTTGCTTTATAAACTAGAGTTTTCCTCCGATTTTTTTTTTtGCATGTGGCATCTCTGTTA

[0332] It should be noted that the "t" in the sequence in line seems to be an incorrect character. It might be a typo. If this is a real DNA sequence, it should probably be a consistent nucleotide base (A, T, C, or G).TTTTTTATTCATTTAAAATGTGGGGGTCCTTTAAAAACAAAATTCTGTGCCCAGTCCTCTAGTTAAAAGCATAACAAGGATATAGAGATTT

[0333] TGTTGGTCTTAGCTCTTAAGTAAGAGCACACTTTAAAGAATTGAGACATAAACATAAACGGAAGGCAGAGATATGGTGCAGGGCTGCAGGC

[0334] TATATTACCCAAAGCATCCAGCTGTTTCTTTTTGCCTGACCCAGGAGGACGCCCTCTACGCTTGCCGTCGGGGTTaGGGGTAGACCCGCCT

[0335] CCACCGGACTGGGCACCCGTCGcTTCAGTGttgtggtgtaaacaaattgacgcttagacaacttaataacacattgcggacgtttttaatg

[0336] tactgaattaacgccgaattaattcgggggatctggattttagtactggattttggttttaggaattagaaattttattgatagaagtatt

[0337] ttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattcccttatctgggaacta

[0338] ctcacacattattatggagaaactcgaaattcgagctcagtcaaatctcggtgacgggcaggaccggacggggcggtaccggcaggctgaa

[0339] gtccagctgccagaaacccacgtcatgccagttcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatatccgagcgcctcg

[0340] tgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccctgtgcctccagggacttcagcaggtgggtgt

[0341] agagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggtcgactcggccgtccagtcgtaggcgttgcgtgccttcca

[0342] ggggcccgcgtaggcgatgccggcgacctcgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtcgtccgtc

[0343] cactcctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcagaccgccggcatgtccg

[0344] cctcggtggcacggcggatgtcggccgggcgtcgttctgggctcatggtagactcgatcctctagagtcgacctgcagaagtaacaccaaa

[0345] caacagggtgagcatcgacaaaagaaacagtaccaagcaaataaatagcgtatgaaggcagggctaaaaaaatccacatatagctgctgca

[0346] tatgccatcatccaagtatatcaagatcaaaataattataaaacatacttgtttattataatagataggtactcaaggttagagcatatga

[0347] atagatgctgcatatgccatcatgtatatgcatcagtaaaacccacatcaacatgtatacctatcctagatcgatatttccatccatctta

[0348] aactcgtaactatgaagatgtatgacacacacatacagttccaaaattaataaatacaccaggtagtttgaaacagtattctactccgatc

[0349] tagaacgaatgaacgaccgcccaaccacaccacatcatcacaaccaagcgaacaaaaagcatctctgtatatgcatcagtaaaacccgcat

[0350] caacatgtatacctatcctagatcgatatttccatccatcatcttcaattcgtaactatgaatatgtatggcacacacatacagatccaaa

[0351] attaataaatccaccaggtagtttgaaacagaattctactccgatctagaacgaccgcccaaccagaccacatcatcacaaccaagacaaa

[0352] aaaaagcatgaaaagatgacccgacaaacaagtgcacggcatatattgaaataaaggaaaagggcaaaccaaaccctatgcaacgaaacaa

[0353] aaaaaatcatgaaatcgatcccgtctgcggaacggctagagccatcccaggattccccaaagagaaacactggcaagttagcaatcagaac

[0354] gtgtctgacgtacaggtcgcatccgtgtacgaacgctagcagcacggatctaacacaaacacggatctaacacaaacatgaacagaagtag

[0355] aactaccgggccctaaccatggaccggaacgccgatctagagaaggtagagagggggggggggaggacgagcggcgtaccttgaagcggag

[0356] gtgccgacgggtggatttgggggagatctggttgtgtgtgtgtgcgctccgaacaacacgaggttggggaaagagggtgtggagggggtgt

[0357] ctatttattacggcgggcgaggaagggaaagcgaaggagcggtgggaaaggaatcccccgtagctgccggtgccgtgagaggaggaggagg

[0358] ccgcctgccgtgccggctcacgtctgccgctccgccacgcaatttctggatgccgacagcggagcaagtccaacggtggagcggaactctc

[0359] gagaggggtccagaggcagcgacagagatgccgtgccgtctgcttcgcttggcccgacgcgacgctgctggttcgctggttggtgtccgtt

[0360] agactcgtcgacggcgtttaacaggctggcattatctactcgaaacaagaaaaatgtttccttagtttttttaatttcttaaagggtattt

[0361] gtttaatttttagtcactttattttattctattttatatctaaattattaaataaaaaaactaaaatagagttttagttttcttaatttag

[0362] aggctaaaatagaataaaatagatgtactaaaaaaattagtctataaaaaccattaaccctaaaccctaaatggatgtactaataaaatgg

[0363] atgaagtattatataggtgaagctatttgcaaaaaaaaaggagaacacatgcacactaaaaagataaaactgtagagtcctgttgtcaaaa

[0364] tactcaattgtcctttagaccatgtctaactgttcatttatatgattctctaaaacactgatattattgtagtactatagattatattatt

[0365] cgtagagtaaagtttaaatatatgtataaagatagataaactgcacttcaaacaagtgtgacaaaaaaaatatgtggtaattttttataac

[0366] ttagacatgcaatgctcattatctctagagaggggcacgaccgggtcacgctgcactgcaggcatgcaagcttatggcgcgccttcccggg

[0367] atactagtgcgtttGtcactggattttggttttaggaattagaaattttattgatagaagtattttacaaatacaaatacatactaagggt

[0368] ttcttatatgctcaacacatgagcgaaaccctataagaaccctaattcccttatctgggaactactcacacattattctggagaaaaatag

[0369] agagagatagatttgtagagagagactggtgatttttgcggacAGGCCTtcaggtatccttcggcttgacgcccacgttattgcagttcct

[0370] gaacatgtaaacgccgtcatgattctccacgaactggcagctcctccaggtcttccagagggacacccacatgttctcgtcggtgtgcctg

[0371] tagtgctcgcccatcaccttcttgatgcactcggtggcctccctggcgtggtagaatgggatcctggacacgtagtggtggaggacatggg

[0372] tctcgatgatgtcgtggaaaatgatgcccaggatgccgaactccctgtcgatggtagccgcggcgcccttcgcgaacgtccactcctgggc

[0373] gtcgtagtggggcatggaggagtcggtgtgctggaggaacgtcacgaagacgagccagtggttcaccagaatccaggggcagaaccaggtg

[0374] atgaaggtcggccagaagccgaaaaccttgtaggcggtgtacacggaggtgagggtggccaggatgccaaggtcggacaggacgatgtacc

[0375] agtagtccttcttgtcgaacacgggggaggatggccagtagtgggagcggaagaactttgacacgcctgggtacggctggccggtggcgtt

[0376] cgtggcaaggtagagggacaggccgcccagttgctggaacaggagcgcgaaaacgctgtagattggggtctcctcggcgatgtcgtgcagg

[0377] gaggtaacctgatgcttctccttgaactcctccgcggtgtacggcacgaacaccatgtccctggtcatatggccggtggccttgtggtgct

[0378] tggcgtgggagaacttccaggagaagtacgggaccataaccagggaatgcagcacccagcccaccgtgtcgttcacccagccgtagttgga

[0379] gaaggcggagtggccgcactcgtggccaaggatccaaatgccgaagccgaagcaagagatggagaacacgtaggcggaccaggccgcgaac

[0380] ctgaggaactcgttcggcaggagcgggatgtaggtcaggcccacgtaggcgatggcggagatcgccacgatgtcgcgcaccacgtaggaca

[0381] tgctcttcaccaggcttctctcgtagcagtgctttgggatggcgtccaggatgtccttgatggtgtagtccggcaccttgaacacgttgcc

[0382] gaaggtgtcgatggcggtcttctgctgcttgaaggaggccacgttgccgctcctcctcacggtcttggtggagccctccaggatctcggag

[0383] ccggacacggtcaccttggacatAGGCCTATTCCGGCCGGCTCTGCTGCTTGTGCTTGGTCGACTACTGATGTGGGATGAGCGTCAGATCG

[0384] TCATGCATGCATGACCCTGCCTGCTTGTTGGCTCGCAGATATAGGCGCGGCCGGGCGCGCGGCCGGCGTTTGTCATGGCTGAGTCATGACC

[0385] GTGGGTTTGTCATGGCTGAGTCATGACCGTGGGTTTGTCATGGCTGAGTCATGACCGTGGGTTTGTCATGGCTGAGTCATGACCGTGGGTT

[0386] TGTCATGGCTGAGTCATGCGGCGCGCTTGACGTGTAAAGTAGCGGCGACGCGTGGCGAGCTGCGGCGGCGGCGCATGCGTACGTGCAACAA

[0387] ACTGCCCGCACGGGCTGCATGCGCGCCAGGTCAGCTAGGGGCAGCACGCTGAGCCGAGTGCGTGCCGTACGAAGCGTCGCCAGCAGGTGAT

[0388] TCTAACTTTAGTTTGTTGCACGTACACTAAACTTTCTAGGTGACCTTTACACATGTGTACCGATCCACCCACCCACCCCTCCTCGCCTGTC

[0389] ATGACTCAGCCATGACAAACGCTAACCATGACTCAGCCATGACAAACGGAGGCCATGACTCAGCCATGACAAACGGTATCCATGACTCAGC

[0390] CATGACAAACGCATGCATGACTCAGCCATGACAAACGGGATCGGAGGAGGTTGTCCTTGACGTCGTCTCGAGTCGACGACGAGGTCGCAGC

[0391] ACCGGGCATGCATGAGCCTCACGCGGTGCGGTGGCAGCAGGTGGCAGGGAGCGAGCCGCCACGTGCCGCGCTGCCACGTGAGTATAAGTAC

[0392] CCTGCTCTGCTATATAGAGGTCGCAACTCGCTGGCCATAGATCCATTGATTGATCGGACGGACGCGCGTCTCCGGTCCCGTCCGTAATAAC

[0393] ACTGATCCGATCCACGCCGGCCGGCGGTTTAAACATGGCCTCCATCGCCATCCCGGCCGCCCTGGCTGGCACTCTTGGCTACGTGACGTAC

[0394] AACGTCGCCAACCCCGACATCCCGGCCTCCGAGAAGGTCCCCGCCTACTTCATGCAAGTGGAGTACTGGGGCCCCACCATCGGCACCATCG

[0395] GCTACCTGCTGTTCATCTACTTCGGCAAGCGCATCATGCAAAACAGGTCCCAACCGTTCGGCCTTAAGAATGCCATGCTGGTCTACAACTT

[0396] CTACCAGACCTTCTTCAACTCCTACTGCATCTACCTCTTCGTGACCTCTCATAGGGCCCAGGGCCTCAAGGTGTGGGGCAATATCCCGGAC

[0397] ATGACCGCCAACTCCTGGGGCATCTCCCAGGTCATCTGGCTCCACTACAACAACAAGTACGTGGAGCTGCTGGACACCTTCTTCATGGTGA

[0398] TGCGCAAGAAGTTCGATCAACTCTCCTTCCTGCACATCTACCACCACACCCTCCTCATCTGGTCCTGGTTCGTGGTGATGAAGCTGGAGCC

[0399] GGTGGGCGACTGCTACTTCGGCTCCTCCGTGAACACCTTCGTGCACGTGATCATGTACTCCTACTACGGCCTCGCCGCCCTCGGCGTGAAC

[0400] TGCTTCTGGAAGAAGTACATCACCCAAATTCAAATGCTCCAATTCTGCATCTGCGCCTCCCACTCTATTTACACCGCCTACGTCCAGAACA

[0401] CCGCGTTCTGGCTCCCCTACCTGCAACTTTGGGTTATGGTGAACATGTTCGTCCTGTTCGCCAACTTCTACAGGAAGAGGTACAAGTCCAA

[0402] GGGCGCCAAGAAGCAGTGAGTTTAAACAATCTTGGACTCCCATGTTGGCAAAGGCAACCAAACAAACAATGAATGATCCGCTCCTGCATAT

[0403] GGGGCGGTTTGAGTATTTCAACTGCCATTTGGGCTGAATTGAAGACATGCTCCTGTCAGAAATTCCGTGATCTTACTCAATATTCAGTAAT

[0404] CTCGGCCAATATCCTAAATGTGCGTGGCTTTATCTGTCTTTGTATTGTTTCATCAATTCATGTAACGTTTGCTTTTCTTATGAATTTTCAA

[0405] ATAAATTATCAGATCCGGTATGAATTTGGAAACAAATTCAGTACTTTTAAAAAAATTTGTTGTAGGGAGCAAATAATACATAAAATAATTT

[0406] ATGCATTATTTTATTTTTTATTTGTAATAATATGCTTGAAACGATAATTCAGTATGCATGTTGTGCCAGTGTACTACACGGGCGGGGGGAG

[0407] GGGATTGAGTGGGCCAGCGCGGTGCGTAGGGTAGATGGGCTGAAATTGATAACTCAAGTCCGACTAGGTTCTCTTTTTATTTCCCTTCCTT

[0408] TTCTATTTTCCTTTCTTTTAATTTTCATGCTTTCAAACTAAATTCAAATTCGAGTTTTGAATTTCAGCTTCTAAATTGTACACTAAAATTA

[0409] TATGATAAGGTAACCCCTACTATTACTTTTAATTTTTTTATTCTACCCCATATTGTTTACTTAGGGGAGAATAATTGACTTAATCACATTC

[0410] TTCCTAGGTTTCAATTCTCAATCTTTCAAATCCACATTTTTAGATTTCTATTTTGAATTTAAATACCAGTTTGGATTTAGAGTTCAATTTC

[0411] AAAATACACAACCAAAATACCAGCATGAATGCAAATATATTTTATGTTTATGTATTTACTTTTCTTTTATACTTTGCTCAAAATAGTTATT

[0412] TTCATGTATGAAACTCAATAAGCAAGGAACTCACGTTATTATATAACCTAATAGGAATAATTTAGGTAACATAATTTATCATCCTCTTGAT

[0413] TTAAAAGAGATATGCCTCCAGAATAAGACACATACTAAAAATAACTCTAATATTGAATAACTAAAGTCGTACAAATCTCTACTATTATTCC

[0414] TATAAAATAATAAAGAACTAGCTACAACTTCTTTAAGGCATTATTCAGGGTTTACAGCTTGAGAGGCATGAACCCATCCTGTATACTCCTG

[0415] GACTTGGAAGACAAAATGTCAACCAAAGTGAAAGGTTTTCTTATGGTTGCTGCTAAGAGATAGATTGAACACTAGATCTCTCCTAAGACGT

[0416] CAGGGCATGCGTTTAGACTCCTACACATGCGAAAACTGCATCTTACAGTTGGAAGAAACTATATCTCACCACTTCCTGCGGTGTAACTTTG

[0417] CCCAAAGATGTTGGCTCACTGTTGGAATCACTCCGCCCCGAACTTTGGATCTAACGCTTGCAGTGCTACATATTAGAGCAAGACTAACAAT

[0418] GCCGTGGAGAATGGAAGGTATTATAACCATGTCATGGTGCATATGGAAATGTCGAAATAACTGGATATTCGAAAACATACCGCCAACGGTG

[0419] GCGGCCTGCAAGGAAATGTTCAAGACTGAAATGAACTACATCTGCTACCAAGTTAAGCTCGAGACAGGAGCTAAAAGTAGAAACTGGATAC

[0420] AACACTTTGTAACATAGTGACACTCCCCTTTTCCTTTCTTTTACCTTAGAACTATACATACAATCCACATTCAATAAAAATTTGTAGGTAC

[0421] GCCATACACACTACCGGAATCCGGCTCTTTGCCGAGTGTGAGGCGCTTTGTCGAGTGCTTTTTGTCCAGCACTCGGCAAAAAAGTCTTTGC

[0422] CATGTGCCGCACTCGGCAAAGTCCTGCTCTCGGTAACGACCGCGTTTACCGAGAGCAGGACTCTCGACACAGAAATACACTCGACAAAGAA

[0423] ATCTTTGCCGAGAGCCAAACACTCGGCGAACGGCAGCGCTCGGCAAAGGGTCGTCAGCCGCCGTCTAAAGCTGACGGTCGTTATCTTTGTC

[0424] GAGTGCCCCCTCGTCCGACACTCAGTAGAGCAAGCTTGCCGAGTGCCATCCTTGGACACTCGATAAAGTATATTTTATTTTTTTTTATTTT

[0425] GCCAACCAAACTTTTTGTGGTATGTTCCTACACTATGTAGATCTACATGTACCATTTTGGCACAATTACAAAAATGTTTTCTATAACTATT

[0426] AGATTTAGTTCGTTTATTTGAATTTCTTCGGAAAATTCACATATGAACTGCAAGTCACTCGAAACATGAAAAACCGTGCATGCAAAATAAA

[0427] TGATATGCATGTTATCTAGCACAAGTTACGACCGAATTCAGAAGCAGACCAGAATCTTCAAGCACCATGCTCACTAAACATGACCGTGAAC

[0428] TTGTTATCCAGTTGTTTAAAAATTGTATAAAACACAAATAAAGTCAGAAATTAATGAAACTTGTCCACATGTCATGATATCATATATAGAG

[0429] GTTGTGATAAAAATTTGATAATGTTTCGGTAAAGTTGTGACGTACTATGTGTAGAAACCTAAGTGACCTACACATAAAATCATAGAGTTTC

[0430] AATGTAGTTCACTCGACAAAGACTTTGTCAAGTGTCCGATAAAAAGTATTCAGCAAAGAAGCCGTTGTCGATTTACTGTTCGTCGAGATCT

[0431] CTTTGCCGAGTGTCACACTAGGCAAAGTCTTTACGGAGTGTTTTTCAGGCTTTGACACTCGGCAAAGCGCTCGATTCCAGTAGTGACAGTA

[0432] ATTTGCATCAAAAATAGCCGAGAGATTTAAAATGAGTCAACTAATAGACCAACTAATTATTAGCTATTAGTCGTTAGCTTCTTTAATCTAA

[0433] GCTAAAACCAACTAATAGCTTATTTGTTGAATTACAATTAGCTCAACGGAATTCTCTGTTTTTTCTATAAAAAAAAGGGAAACTGCCCCTC

[0434] ATTTACAGCAAACTGTCCGCTGCCTGTCGTCCAGATACAATGAACGTACCTAGTAGGAACTCTTTTACACGCTCGGTCGCTCGCCGCGGAT

[0435] CGGAGTCCCAGGAACACGACACCACTGTGGAACACGACAAAGTCTGCTCAGAGGCGGCCACACCCTGGCGTGCACCGAGCCGGAGCCCGGA

[0436] TAAGCACGGTAAGGAGAGTACGGCGGGACGTGGCGACCCGTGTGTCTGCTGCCACGCAGCCTTCCTCCACGTAGCCGCGCGGCCGCGCCAC

[0437] GTACCAGGGCCCGGCGCTGGTATAAATGCGCGCCACCTCCGCTTTAGTTCTGCATACAGCCAACCCAACACACACCCGAGCATATCACAGT

[0438] GACAGACACTACACGTTAATTAAATGGAGTTCGCCCAGCCGCTGGTGGCCATGGCCCAGGAGCAGTACGCGGCCATCGACGCCGTGGTGGC

[0439] CCCAGCTATCTTCTCCGCCACCGACAGCATCGGCTGGGGCCTGAAGCCGATCAGCTCTGCCACCAAGGACCTGCCGCTGGTTGAGAGCCCA

[0440] ACGCCTCTTATCCTGTCCCTGCTTGCCTACTTCGCCATTGTCGGCAGCGGCCTGGTCTACAGGAAGGTGTTCCCAAGGACCGTGAAGGGCC

[0441] AGGACCCTTTCCTTCTGAAGGCCCTCATGCTCGCCCACAATGTCTTCCTCATTGGCCTCTCCCTGTACATGTGCCTGAAGCTGGTGTACGA

[0442] GGCGTACGTGAACAAGTACTCATTCTGGGGCAACGCGTACAACCCGGCCCAGACCGAGATGGCCAAGGTGATCTGGATTTTCTACGTGTCC

[0443] AAGATCTACGAGTTCATGGATACCTTCATTATGCTGCTGAAGGGCAACGTTAACCAGGTGTCTTTCCTGCACGTGTACCACCACGGCTCCA

[0444] TCTCCGGCATCTGGTGGATGATTACCTACGCCGCCCCGGGCGGCGACGCTTACTTCTCTGCCGCCCTGAACTCCTGGGTGCACGTTTGCAT

[0445] GTACACCTACTACTTCATGGCGGCTGTGCTTCCGAAGGACGAGAAGACCAAGAGGAAGTACCTCTGGTGGGGCAGGTACCTGACGCAGATG

[0446] CAAATGTTCCAGTTCTTCATGAACCTGCTGCAAGCCGTGTACCTGCTGTACTCTTCCTCCCCGTACCCAAAGTTCATCGCCCAACTGCTCG

[0447] TGGTGTACATGGTGACCCTGCTCATGCTCTTCGGCAACTTCTACTACATGAAGCACCACGCCTCTAAGTGATTAATTAATCCCGATCGTTC

[0448] AAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCAT

[0449] GTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAA

[0450] ACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGTcgattaaaaatcccaattatattt

[0451] ggtctaatttagtttggtattgagtaaaacaaattcgaaccaaaccaaaatataaatatatagtttttatatatatgcctttaagactttt

[0452] tatagaattttctttaaaaaatatctagaaatatttgcgactcttctggcatgtaatatttcgttaaatatgaagtgctccatttttatta

[0453] actttaaataattggttgtacgatcactttcttatcaagtgttactaaaatgcgtcaatctctttgttcttccatattcatatgtcaaaat

[0454] ctatcaaaattcttatatatctttttcgaatttgaagtgaaatttcgataatttaaaattaaatagaacatatcattatttaggtatcata

[0455] ttgatttttatacttaattactaaatttggttaactttgaaagtgtacatcaacgaaaaattagtcaaacgactaaaataaataaatatca

[0456] tgtgttattaagaaaattctcctataagaatattttaatagatcatatgtttgtaaaaaaaattaatttttactaacacatatatttactt

[0457] atcaaaaatttgacaaagtaagattaaaataatattcatctaacaaaaaaaaaaccagaaaatgctgaaaacccggcaaaaccgaaccaat

[0458] ccaaaccgatatagttggtttggtttgattttgatataaaccgaaccaactcggtccatttgcacccctaatcataatagctttaatattt

[0459] caagatattattaagttaacgttgtcaatatcctggaaattttgcaaaatgaatcaagcctatatggctgtaatatgaatttaaaagcagc

[0460] tcgatgtggtggtaatatgtaatttacttgattctaaaaaaatatcccaagtattaataatttctgctaggaagaaggttagctacgattt

[0461] acagcaaagccagaatacaaagaaccataaagtgattgaagctcgaaatatacgaaggaacaaatatttttaaaaaaatacgcaatgactt

[0462] ggaacaaaagaaagtgatatattttttgttcttaaacaagcatcccctctaaagaatggcagttttcctttgcatgtaactattatgctcc

[0463] cttcgttacaaaaattttggactactattgggaacttcttctgaaaatagtGtcactggattttggttttaggaattagaaattttattga

[0464] tagaagtattttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataagaaccctaattcccttat

[0465] ctgggaactactcacacattattctggagaaaaatagagagagatagatttgtagagagagactggtgatttttgcggacGGGTCCCtcac

[0466] tgcatcttcttctctggggcgtgggcgacgttgtccaggttggcgaaggtgtcggccatggcctcgaagtagccgcgaacgtcgtagtgca

[0467] ggccgtgcttctcgaacagctgcttgacgcgtggggcgatcttcgggtgccggaactgcggcatggacgggtacagatgatgctcgatctg

[0468] gtagttgaggtaggacatccaccagtcgcaccaccaggacggagagcaattggtagtgtggttggcggcgtactccacccaagtagcgtgc

[0469] tcgttcggctccacaaccgggagatgggtgtgggaaacggcgaaattgcagaagatgtacatggcgcccagttgcacgtacagaaggtagc

[0470] aggcgagcacgtagccggcgccgtagttggcggccaggtagccaaccaggccgtacctgatgccgagcatcgccagctcgtcgtagtgctt

[0471] ggtcctcagcatgtgcctcgggtgcaggtacagctgccagccgagggccaccagcagggtggtgactggggcgaacagcttggcctgcatg

[0472] gacagccacgccttcatggccggggacttcaccttggccgcgatcctctcgtggaaggccaccagcggcagggtgtccaggtccacgtcgt

[0473] gctgcagcttctggggggtcgcatggtgcttgttgtgctggttcctccaccaagcgccggacatgccgcagcccaggccgtagcaggcgac

[0474] ctggatcgccctgtcgaaggcaatgttgccggtcagagagtaatggccgccctcatgcataagccagccgcagcggccctgcacaacgccc

[0475] agcatggcaatgccggcgaaggtgtagccgtgccaaatcagggcggcgccggcaacgtgcatggcgataacctcggccagtctgtaggcga

[0476] cgtgcggcagggacggctcgaacatgccctcggcctccagttgctttgtgaactcttggaagtcggcgatcagatcagcgcggcgggggga

[0477] gtagcccttgtggactggcctggacggcaggctcttcagcatcttgtcggccttcgcggaccgcacgtggaactgcttgtaggcgtcggtg

[0478] gcgtcggtgccgacttggtaggcgatgatcttgccgcccgggtggcgcttcacgaagttggtcacgtcgtaggcccggtcgccgatcacca

[0479] gctccttcttgtcgtgctcctgcggggtgtccacctcgtgaagctgagcggacggcggggcggcgtaggagtaggagtcccttggcggcat

[0480] GGGTCCCctgcgagtgcgagtgtgcgttcgatgcgagggttcgaagcgagctgcggcgtatatgaagaggtggcgcggcgagggtcgcagc

[0481] catgcgcgccgccaggtggaggccgggccgcgtacgtggcggggcgaaggcgatgtggagcgcgcgcgcgcgctgcagtgctaccgcactc

[0482] ggccgcatccgtgcagctgccgccgtgtgcttgcgtgcgtgcgtgcatgctagctcgctgctgggatgcctgcggcgaagcgacagcggtg

[0483] attgggatggggacaacacggagcagatggagctgcacgtagcgacgcggggctttttcagagagtgctttttttcccaaagatttctgat

[0484] aatctggattcttaaaaaatagctgttacgacaatttttatacgatttatgtgctaaagaagacaaaggagtctacgcgcagcatcacatt

[0485] catactatcacgacgattcgatagattctatatttagatgtaatttttatataaacgattctaacaaaaatagactatgaaaagcaaaaca

[0486] tttagctagcagaagctgattccgacgactcgaaactagctaagggcccgttcgattctgaggaattggccgtccggaactattcctagcc

[0487] ggattggttatctaatttatataacatttgattagctggaacaattccgggatgaattccgagtcaaacgaacaggccctaaaagctgcag

[0488] agccagcgtccatctcatatgatttgagcaatattatcaattattcgggtcgggtgtgcttcagcggtgaagattctcggggcctgctgaa

[0489] caaataaataaagaggcaaacactcttcgaccgcgtataaaaggactcaagcaaaggctctagtcgtttatagttgcttgtagtacttcaa

[0490] ctttatccgtgtaatccaagagtagaaagttcttggatgacagttgcgtggcatggccgtaatacaattgcgttgctcttggatgacagtg

[0491] gctcaatctttacagagcatgatctcaaaactaacctgctttggaatatgttcaaatgtcgcttgggatcctccgattttgtggataatgt

[0492] ctttgatctttctagtttgttgctctgccgcaatgacttgcattggttagatgagcctttttcaaagcaagaaattgatagtattgtggcg

[0493] tcccttccttctgataaatccccgggacctgatgggtttaataccaactttatcaaaaaaatgttgtccgattatttcccaggacttctat

[0494] gacttatgtgaccaattttaccacggggatatttgtcttcgaagcatcaatggttcttatattgtcctgattccgaagaaggataatgcta

[0495] gtttagtgggcgatttcagaccaatttcgcttctgaataatagtatgaaaatcatcactaagctgctggctaaccggttacagacagtgat

[0496] gacttcccttgttcacaaaaatcaatatggcttcatcaaagaaagaaccattcaggattgtctggcctgggcatttgaatatattcatctt

[0497] tgtcatatttcaaaaaaagagattattgtgctcaaattggattttgaaaaggcttttgattctcttgagcatgagttgattcttcaggtaa

[0498] tgttgcatagaggctttgggcccagatggatgagctggattagggatattcttcggtctagcacgtcatcagtccttcttaatggtgttcc

[0499] tgggaaaacctttcactacaagcgtggggttaggcagggagatcccctctcgcctcttctttttgttctcgcggcggatctgttacagagc

[0500] atcatcaataaagcgcggcagcaagaccttctcaagttacccctggccgagaattgtggtcaagattttccgatagttcaatatgcggatg

[0501] acacactactgataatggaagcttgccctagacagctattttttctcagagccgttctgaactcttttgcaacttcgacggggttgaaggt

[0502] gaattacaacaaatcaagtatgtaccccatcaatgtcagtcctgctaaaatggcgatcctagcaggaaccctcaactgtcagataggttca

[0503] atgccctttacctatcttggtgttccgcttggtctatcaaagcctaaaatctgccactttttaccgctcattcataggattcaaaagagat

[0504] tatcatgcacctctgccctcctctcccaggctggcaggcttgagcttgttaactcggtgttctcagctctcccgacctttttgatgtgcac

[0505] actgaaaattccggttaccacggtaaagaagattgattcttatcggaaacactgtctttggagaggaaacgacgtcaattcaaagaaacct

[0506] gctctagctacttggagtatgattacacagactaaaaaaatgggggcctgggagtggtaagattagagactcacaataaagccttgcttct

[0507] gaagtttttgcacaagtttttcaacaatcatgatattccctgggttaacctggtttggagcaactattacaggacagtcaggctacctggt

[0508] tgctcaaaaattggctccttttggtggaaaagcttgcttactcttgtccaagattacaagggactggctgccccaactatcggggatggaa

[0509] gaaccattcttttctgggaagatatgtggaataggggcatcccggctcatcaatatcctgagttattttcctttgcttgcaacagcaaact

[0510] taccatcaaagaagctctccaaaaggaacaacttattgaaatttttcagctacctctgtcggtgcaagcttatgaacaatttctagactta

[0511] gacgcaacttggggccaaatcatggtggccaatacaaatgatgcttggaaactcatttggggagccgataatttctctacaaagaaaactt

[0512] atagacatttgatgggtcaggctcaggttcaccagatcttcagatcgcGatctgataatttatttgaaaattcataagaaaagcaaacgtt

[0513] acatgaattgatgaaacaatacaaagacagataaagccacgcacatttaggatattggccgagattactgaatattgagtaagatcacgga

[0514] atttctgacaggagcatgtcttcaattcagcccaaatggcagttgaaatactcaaaccgccccatatgcaggagcggatcattcattgttt

[0515] gtttggttgcctttgccaacatgggagtccaagattCCTGCAGGtcagtgcgccttctcggccttgccattcacgtagtaatgttggccaa

[0516] ccttgtccaggttgctgaaagtggccttccaggcgccgtagtaggagagcaccttgtagttcaggccccacttcttggcgaacggcacgaa

[0517] cctgcgagacacctccggctggcggaactggggcatgtccgggaaaaggtggtggatgacttggcagttgaggtagcccatgagccagttg

[0518] acgtagccgcgggacgggtcgatgtcaacggtgtggtccacggcgtaattgacccaggaaaggtgcttgtcagaggggaccaccggcaggt

[0519] gggtatgggaggtggagaagtgcgcgaacaggtacatgtaggcgatccagttgccgaaggtgaaccaccagtaagccaccggccaggagta

[0520] gccggtcgccagcttgatgacggcggtcctcaccacgtggctaacaagcatccaggacgcctcctcgtagttcttcttcctaagcacctgc

[0521] ctcggatgcagcacgtagatccagaaagcctgcacgagcaggccggaggtcaccggcacgaaggtccacgcctgcagcctagcccaggccc

[0522] tgctgaagcccctggggcggttgtcctcaacggccgtgttgaagaaggccacggctggggtcgtgtccagatccatatcgtgtctcacctt

[0523] ctgcggggtcgcgtggtgcttgttatgcatttggttccacatctcgccggaggtagacaggccgaagccgcaggtcatggcctgcagcctc

[0524] ttgtcaacgtacacgctgccggtcagggagttatggccgccctcgtgctgcacccagccgcacctggcgccgaagaaggcgccgtacacca

[0525] cgctggcaataatcgggtagccggcgtacatcagggcggtgcccagggcgaaggtcgcaagcagctccagcagcctgtacgccacgtgggt

[0526] aatggagggcttgaagaagccgtccctctccagctcggccctccacctggcgaagtcctccagcatcggcgcgtcctcggactccgaccgc

[0527] ttgatctcagccggcctagacggcagggcgcgcagcatcttccacgccttcaggctgcgcatatggaactccttgaaagcctcggtcgcgt

[0528] ccgcgccggtgttggccagcatgtagaaaatcacggagccgcccgggtgcttgaagttggtcacgtcgtactccacgtcctccaccctcac

[0529] ccagcgtgtctcgaaggtggcggccagctcgtgtggctccagggtcttcaggtccaccggggcggtggaagcgtccttggcgtccagcgcc

[0530] tccgcggaggacttggacctggtcagcggggaccttggggaggacctgccgtcggtcttcggcgggcacatCCTGCAGGATTCCGGCCGGC

[0531] TCTGCTGCTTGTGCTTGGTCGACTACTGATGTGGGATGAGCGTCAGATCGTATGCTGGATGACCCTGCCTGCTTGTTGGCTCGCAGATATA

[0532] GGCGCGGCCGGGCGCGCGGCCGGCGGTGGACCGTGGACGGCGCGCGCATGCAAGAGCGGCGACGCGTGGCGAGCTGCGGCGGCCGCGCATG

[0533] CGCACGTGGCTGCCCGCACGGGCTGCATGCGCGCCAGGTCAGCTAGGGGCAGCACGCTGAGCCGAGTGCGTGCCGTACGTAGCGTCGCCAG

[0534] CAGCTGATTCTAACTTTCTGTTCTAAACTTTCTAGGTGCATGGTACCGATCCACCCACCCACCCCTCCTCGCCTGTCTGCCACGCACGGGA

[0535] TCGGAGGAGGTTGTCCTTGACGTCGTCTCGAGTCGACGACGAGCTCGCAGCACCGGCCGCTAGCTGGCCTCACGCGGTGCGGTGGCAGCAG

[0536] GTGGCAGGGAGCGAGCCGCCACGTGCCGCGCTGCCACGTGAGTATAAGTACCCTGCTCTGCTATATAGAGCTCGCAACTCGCTGGCCATAG

[0537] ATCCATTGATTGATCGGACGGACGCGCGTCTCCGGTCCCGTCCGTAATAACACTGATCCGATCCACGCCGGCCGGCGGCCCGGGCATGCCG

[0538] CCAAGCGCCGCTAAGCAGATGGGCGCCTCCACCGGCGTGCACGCTGGCGTGACTGACTCCTCCGCCTTCACCAGGAAGGACGTGGCCGACA

[0539] GGCCGGACCTGACCATCGTGGGCGACTCCGTGTACGATGCCAAGGCGTTTCGCTCCGAGCACCCGGGCGGCGCTCATTTCGTTTCCCTCTT

[0540] CGGCGGCCGCGACGCCACCGAGGCTTTCATGGAGTACCACCGCAGGGCGTGGCCTAAGTCCAGGATGTCCAGGTTCCACGTGGGCTCCCTT

[0541] GCGTCCACCGAGGAGCCGGTGGCCGCTGATGAGGGCTACCTGCAGCTGTGCGCGAGGATTGCCAAGATGGTGCCGAGCGTGTCCTCCGGCT

[0542] TCGCGCCAGCTTCCTACTGGGTCAAGGCTGGCCTCATTCTGGGCTCTGCCATTGCCCTGGAGGCGTATATGCTGTACGCCGGCAAGAGGCT

[0543] GCTGCCGTCCATCGTGCTGGGCTGGCTTTTCGCCCTGATCGGCCTGAATATCCAACATGACGCCAACCACGGCGCCCTGTCCAAGAGCGCC

[0544] TCCGTGAACCTGGCCCTGGGCCTGTGCCAGGATTGGATCGGCGGCTCAATGATCCTCTGGCTGCAGGAGCACGTGGTGATGCACCACCTGC

[0545] ACACCAACGACGTCGACAAGGACCCGGACCAAAAGGCCCATGGCGCCCTCAGGCTCAAGCCGACCGACGCTTGGTCCCCAATGCACTGGCT

[0546] GCAGCACCTGTACCTGCTCCCAGGCGAGACCATGTACGCCTTCAAGCTCCTCTTCCTCGACATTTCCGAGCTGGTGATGTGGAGATGGGAG

[0547] GGCGAGCCGATCTCCAAGCTCGCTGGCTACCTCTTCATGCCCTCTCTGCTGCTGAAGCTGACCTTCTGGGCCAGGTTCGTCGCCCTGCCGC

[0548] TGTACCTCGCCCCGTCTGTGCACACCGCGGTGTGCATCGCCGCCACCGTTATGACCGGCTCCTTCTACCTCGCCTTCTTCTTCTTCATCTC

[0549] TCACAATTTCGAGGGCGTCGCCTCCGTGGGCCCCGATGGCTCCATTACTTCCATGACGCGCGGCGCCTCCTTCCTGAAGCGCCAGGCTGAG

[0550] ACCTCCTCCAACGTGGGCGGCCCGCTGCTCGCTACCCTGAATGGCGGCCTTAATTACCAAATTGAGCACCACCTGTTCCCGAGAGTGCACC

[0551] ACGGCTTCTACCCGAGACTCGCCCCGCTGGTCAAGGCCGAGCTGGAGGCTCGCGGCATCGAGTACAAGCATTACCCGACCATCTGGAGCAA

[0552] CCTGGCCTCCACCCTTAGGCATATGTACGCGCTCGGCAGGAGGCCCAGGTCCAAGGCTGAGTGAGCCCGGGCTCCCGATCGTTCAAACATT

[0553] TGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAA

[0554] TTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAAT

[0555] ATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG

[0556] SEQ ID NO.6:

[0557] CCAGCAGTACTCTCAAACTGTGG

[0558] SEQ ID NO.7:

[0559] TCCTAAAACCAAAATCCAGTA

Claims

1. A nucleic acid molecule for detecting corn transformation event O-3-M1, characterized in that The sequence of the nucleic acid molecule is any one of the following i)-iv): i) the sequence shown in SEQ ID NO.1, or its reverse complementary sequence; ii) the sequence shown in SEQ ID NO.2, or its reverse complementary sequence; iii) the sequence shown in SEQ ID NO.3 and / or SEQ ID NO.4, or the reverse complementary sequence thereof; iv) the sequence shown in SEQ ID NO.5, or its reverse complementary sequence. The corn transformation event O-3-M1 has been deposited in the China Center for Type Culture Collection (CCTCC) in the form of seeds with the number CCTCC NO: P202428, and the deposit date is October 30, 2024.

2. A probe for detecting maize transformation event O-3-M1, characterized in that: It includes the sequence shown by SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or the reverse complementary sequence thereof.

3. A primer pair for detecting maize transformation event O-3-M1, characterized in that: The amplification product of the primer pair comprises the sequence of claim 2; Optionally, the primer pair is the sequence shown by SEQ ID NO.6 and SEQ ID NO.

7.

4. A kit or microarray for detecting maize transformation event O-3-M1, characterized in that: Comprising the probe according to claim 2 and / or the primer pair according to claim 3.

5. A method for detecting corn transformation event O-3-M1, characterized in that The method comprises using any of the following to detect whether the conversion event exists in the sample to be tested: i) the probe according to claim 2; ii) the primer pair according to claim 3; iii) the probe according to claim 2 and the primer pair according to claim 3; iv) The kit or microarray according to claim 4.

6. A method for breeding corn, characterized in that: The method comprises the following steps: 1) obtaining corn containing the nucleic acid molecule according to claim 1; 2) subjecting the corn obtained in step 1) to pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, selfing or hybridization or a combination thereof to obtain corn plants, seeds, plant cells, offspring plants or plant parts; and optionally, 3) Identifying the DHA content of the offspring plants obtained in step 2), and using the method of claim 5 to detect whether the transformation event exists therein.

7. Products made from the corn plants, seeds, plant cells, progeny plants or plant parts obtained by the method of claim 6, including food, feed or industrial raw materials.

8. A method for increasing the DHA content of corn, characterized in that: The method comprises planting at least one transgenic corn plant in the soil, wherein the genome of the transgenic corn plant comprises nucleotides 3291-20443 of SEQ ID NO.5, or the genome of the transgenic corn plant comprises SEQ ID NO.5; and the transgenic corn plant has a quality improvement trait rich in DHA.

Images