A KASP molecular marker, primer and application thereof related to the double-petal trait of red-flowered strawberry

By developing KASP molecular markers and specific primers related to the double-petal trait of red-flowered strawberry, the problem of rapid identification and selection of double-petal trait in red-flowered strawberry breeding was solved, and rapid screening and breeding efficiency were improved.

CN120138210BActive Publication Date: 2025-09-30SHENYANG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510426871.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-07
Publication Date
2025-09-30
Estimated Expiration
2045-04-07

AI Technical Summary

Technical Problem

The existing technology lacks effective molecular markers for rapid identification and selection of double-petal traits in red-flowered strawberries, resulting in long breeding cycles and low efficiency.

Method used

A KASP molecular marker related to the double-petal trait of red-flowered strawberry and its specific primers were developed. By detecting the SNP site polymorphism at the 34175249bp position on chromosome 6-4, genotype analysis was performed using the KASP kit and specific primers to screen out red-flowered strawberry plants with the double-petal trait.

Benefits of technology

The rapid identification and breeding of the double-petal trait of red-flowered strawberry was achieved, the breeding cycle was shortened, the breeding efficiency was improved, and the foundation was laid for the rapid identification and breeding of red-flowered strawberry varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138210B_ABST
    Figure CN120138210B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of strawberry breeding technology, and more specifically, relates to a KASP molecular marker, primers, and applications thereof associated with the double-petal trait of safflower strawberry. The present invention provides a KASP marker associated with the double-petal trait of safflower strawberry. The KASP marker has a single polymorphism (SNP) located at position 34175249 on chromosomes 6-4, which exhibits a G or A polymorphism. Safflower strawberries with a GG polymorphism at this position exhibit a double-petal trait. The KASP marker described herein is closely associated with the double-petal trait of safflower strawberry and can be used for the rapid identification and breeding of double-petal safflower strawberry varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of strawberry breeding, and more specifically relates to a KASP molecular marker related to the double-petal trait of red strawberry, a primer and an application thereof. Background Art

[0002] Red-flowered strawberry is a new type of ornamental and edible strawberry, derived from an intergeneric hybridization between the white-flowered cultivated strawberry and the red-flowered Potentilla salsa. It has broad application prospects in landscaping and potted ornamental plants. Its outstanding ornamental value, long flowering period, and edible fruit have made it popular among consumers both domestically and internationally. Flower doubleness is a key ornamental trait in ornamental plants. The doubleness of red-flowered strawberry is primarily manifested by an increase in the number of petals in the whorl and the number of petals. Most double flower traits are quantitative, with only a few conforming to the genetic laws of qualitative traits. Double flowers are primarily characterized by an increase in the number of petals, the number of whorls, or the area of ​​the petals. Due to their beautiful flower shape and strong layering, they are highly ornamental and highly valued. Therefore, the breeding of double-flowered varieties has become a key goal in ornamental plant breeding. Breeding red-flowered strawberry varieties with double flowers can fill the gap in my country's native double-flowered varieties, enhance the ornamental value of red-flowered strawberries, significantly shorten the breeding cycle, and increase economic benefits.

[0003] In recent years, molecular biology techniques have advanced rapidly. DNA molecular marker technology has enabled researchers to rapidly select varieties with specific traits, becoming an effective tool for genetic diversity research. Currently, little research has been conducted on the formation of double flowers in red strawberry. Therefore, if molecularly assisted breeding based on double flower formation is to be implemented, it is imperative to identify the genetic loci and key genes that regulate double flower traits in red strawberry and develop relevant molecular markers. Summary of the Invention

[0004] The purpose of the present invention is to provide a KASP molecular marker, primers and applications thereof related to the double-petal trait of red strawberry, so as to solve the above technical problems.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] The present invention provides a KASP molecular marker related to the double-petal trait of red-flowered strawberry. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1. The N at position 150 of the sequence is a SNP site, and the polymorphism is G or A. Red-flowered strawberry with the GG genotype at this site has the double-petal trait.

[0007] The present invention determines the double-petal trait of safflower strawberry by determining the SNP site polymorphism of the gene sequence at the 34175249bp position of chromosome 6-4 of safflower strawberry. When the SNP site of the safflower strawberry gene sequence is detected to be a GG genotype, it is considered that the safflower strawberry has the double-petal trait.

[0008] The present invention also provides specific primers for amplifying the above-mentioned KASP marker, including upstream primers shown as SEQ ID NO.2 and SEQ ID NO.3, and a downstream primer shown as SEQ ID NO.4.

[0009] The present invention also provides a kit for detecting the double-petal trait of red strawberry, characterized in that the kit comprises the above-mentioned specific primers.

[0010] Furthermore, the kit also includes 2×KASP master mix.

[0011] The present invention also provides the use of the KASP marker, the specific primer or the kit in identifying the double-petal trait of red strawberry.

[0012] The present invention also provides the use of the KASP marker, the specific primer or the kit in double-petal red flower strawberry breeding or assisted double-petal red flower strawberry breeding, wherein the breeding is to cultivate red flower strawberries with double petal traits.

[0013] The present invention also provides a method for detecting the double-petal trait of red strawberry, comprising the following steps:

[0014] (1) extracting genomic DNA of the tested red strawberry;

[0015] (2) Using the genomic DNA of the tested red strawberry as a template, amplification was performed using the above-mentioned specific primers;

[0016] (3) Identifying the genotype of the 150th position of the amplified product, when the SNP site of the 150th position of the amplified product is the GG genotype of the red flower strawberry, it is a double flower trait.

[0017] The present invention also provides a method for breeding a double-petal variety of red strawberry, comprising the following steps:

[0018] (1) Screening red strawberry plants with double-petal genotype using the above-mentioned detection method;

[0019] (2) The selected plants are used as parents for hybridization or self-pollination to obtain red-flowered strawberry offspring with stable double-petal characteristics.

[0020] The present invention has the following beneficial effects:

[0021] The present invention provides a KASP marker for identifying the double-petal trait of safflower strawberry. The KASP marker can be used for rapid identification and breeding of double-petal safflower strawberry varieties, laying a foundation for large-scale rapid identification and screening of double-petal safflower strawberries, and contributing to subsequent molecular breeding of safflower strawberries. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the KASP genotyping diagram. The horizontal axis represents the FAM fluorescence ratio, the vertical axis represents the VIC fluorescence ratio, and red dots represent the GG genotype, blue dots represent the AA genotype, and green dots represent the AG genotype. DETAILED DESCRIPTION

[0023] The present invention is described in detail below with reference to specific examples, but these examples should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0024] Example 1: Development of KASP molecular markers.

[0025] 1. KASP marker development: Hybridization was performed using the single-petal red-flowered strawberry variety 'Feihong' as the male parent and the double-petal red-flowered strawberry variety 'Yinghua' as the female parent. Thirty-five plants each of single-petal (6-8 petals) and double-petal (≥15 petals) with similar color were selected from the hybrid offspring to construct two extreme pools. DNA was extracted from fresh leaves of the red-flowered strawberry parent and the offspring of the two extreme pools. Whole-genome resequencing was then performed to identify SNP markers and design KASP molecular markers. The KASP molecular marker sequence is shown in SEQ ID NO. 1, the KASP marker primer sequence set is shown in Table 1, and the PCR amplification system and reaction procedures are shown in Tables 2 and 3.

[0026] SEQ ID NO.1: CAAGGTCTATTAGATTAAGCCCCAGTTGTGTGCCTAAC CGGGATCGATCTGATTGAGCCCAGATAGACCTTGCCAGGCGCCTAAAAGGGTTTATTCGAGAAATGGTTCGAGACTGTACAACTAAACTATAAGCCTGACAACGAGCCATGNATGCATTCACAAATTTATA TAAGCAACTCTCTTGTCAGTGAAGGGCATGGCTCTTCTGAAAATAGAACCGTAGAAAGTGGAAAACCATATGTTTCATCAAAAGCTCCAACTGTTGATTTTCTGGCTGTTCTTGCATGAAATGTGGGGAAA.

[0027] Table 1: Molecular markers and primers related to double petal formation in red strawberry

[0028] Primers 5'-3' SEQ ID NO. F1 GAAGGTGACCAAGTTCATGCTGCCTGACAACGAGCCATGA 2 F2 GAAGGTCGGAGTCAACGGATTGCCTGACAACGAGCCATGG 3 R CTTCACTGACAAGAGAGTTGCTTATATAA 4

[0029] Table 2: PCR reaction system

[0030] Components Addition amount 2×KASP master mix 2.5 μL primer mix 1.25 μL DNA 1.25 μL Total 5μL

[0031] Table 3: PCR amplification system

[0032]

[0033]

[0034] 2. Fluorescence Detection and Analysis: After the PCR amplification cycle, fluorescence values ​​were read using a fluorescence quantitative PCR instrument. The fluorescence readings were analyzed using LGC_OMEGA's genotype reading software (Kluster Caller) to identify allele types. SNP site detection uses the fluorophores FAM and VIC to distinguish between two isogenic loci. The passive reference dye ROX is used to correct for signal differences between wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 4 below.

[0035] Table 4: Fluorescence reading wavelengths

[0036] Fluorophore Excitation light (nm) Emitted light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0037] 3. Interpretation of LGC_OMEGA Gene Analysis Results: The fluorescence readings from the above steps were analyzed using LGC_OMEGA genotype reading software. Samples were clustered based on relative fluorescence values, and genotypes were further determined based on sample clusters and fluorescence patterns.

[0038] 4. KASP molecular marker genotyping verification: The KASP markers obtained by screening were used to perform genotyping verification on single and double red flower strawberry parents and hybrid offspring. The genotypic and phenotypic data are shown in Tables 5 and 6. The typing test results are shown in Tables 5 and 6. Figure 1 As shown, the KASP marker was significantly correlated with the formation of double-petal traits in red-flowered strawberries. Among the 66 red-flowered strawberries verified, 44 double-petaled red-flowered strawberries were successfully detected.

[0039] Table 5: Validation statistics of KASP marker genotypes in red strawberry

[0040]

[0041]

[0042] Table 6: Genotype and phenotypic validation data of KASP markers in red strawberry.

[0043]

[0044]

[0045] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0046] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0047] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A KASP molecular marker related to the double-petal trait of red strawberry, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1. The N at position 150 of the sequence is a SNP site, and the polymorphism is G or A. The red-flowered strawberry with the GG genotype at this site has a double-flower trait.

2. A specific primer for amplifying the KASP marker according to claim 1, characterized in that: It includes upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3, and downstream primers as shown in SEQ ID NO.

4.

3. A kit for detecting petal traits of red strawberry, characterized in that: The kit comprises the specific primer according to claim 2.

4. The kit according to claim 3, wherein The kit also includes 2×KASP mastermix.

5. Use of the specific primers according to claim 2 or the kit according to claim 3 in identifying the double-petal trait of red-flowered strawberry.

6. Use of the specific primers according to claim 2 or the kit according to claim 3 in breeding double-petaled red-flowered strawberries or in assisting breeding of double-petaled red-flowered strawberries, characterized in that: The breeding is to cultivate red-flowered strawberries with double-petal traits.

7. A method for detecting the double-petal trait of red strawberry, characterized in that: The following steps are involved: (1) Extracting genomic DNA from the tested red strawberry; (2) using the genomic DNA of the tested red strawberry as a template and amplifying using the specific primers described in claim 2; (3) Identifying the genotype of the 150th position of the amplified product; when the SNP site at the 150th position of the amplified product is the GG genotype, the red flower strawberry has a double flower trait.

8. A method for breeding double-flowered red strawberry varieties, characterized in that: The following steps are involved: (1) Screening red-flowered strawberry plants with a double-petal genotype using the detection method described in claim 7; (2) The selected plants are used as parents for hybridization or self-pollination to obtain red-flowered strawberry offspring with stable double-petal characteristics.

Citation Information

Patent Citations

  • rooted Hybrid Tea rose with two-tone double flowers, Strawberry RED velvety PURPLE on the obverse, YELLOW Succin on the reverse.

    BE590282A

  • KASP molecular marker related to strawberry petal shedding speed character and application of KASP molecular marker

    CN113186323A