Rapid construction kit for endothelin converting enzyme ECE1 knock-down plasmid and application of rapid construction kit
The construction of the endothelin converting enzyme ECE1 knockdown plasmid was solved through high-fidelity PCR and seamless cloning technology, and the problem of long construction time and low efficiency in the existing technology was solved, and efficient and stable ECE1 knockdown was achieved, which improved the experimental efficiency and plasmid stability.
Patent Information
- Application Number
- CN202510428749.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art has problems of long-term, low efficiency, non-specific effects and off-target effects when constructing the endothelin converting enzyme ECE1 knockdown plasmid, making it difficult to achieve long-term stable gene knockdown.
High-fidelity PCR reagent and seamless cloning technology were used to perform high-fidelity amplification of the ECE1 gene through High-Fidelity DNA Polymerase, and the ECE1 gene fragment was ligated to a linearized vector using T4 DNA ligase, combining puromycin resistance screening, simplifying the experimental operation process and improving construction efficiency and accuracy.
The time for plasmid construction was significantly shortened, the experimental efficiency was improved, the stability and reliability of the recombinant plasmid were ensured, and the effective knockdown of ECE1 was verified at the mRNA level.
Smart Images

Figure CN120174015A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of molecular biology and genetic engineering, and particularly to a kit for rapidly constructing an endothelin converting enzyme ECE1 knockdown plasmid and its application. Background Art
[0002] Endothelin (ET) is a polypeptide composed of 21 amino acids, which is mainly secreted by vascular endothelial cells and has the effect of constricting blood vessels. The endothelin family includes 3 members, namely endothelin 1 (ET-1), endothelin 2 (ET-2) and endothelin 3 (ET-3), and their distributions and physiological functions are different. Endothelin receptors include two types, endothelin A receptor (ETA) and endothelin B receptor (ETB). ETA is expressed in muscle cells and mainly binds to ET-1 and ET-2; ETB is expressed in endothelial cells, epidermal cells, nerve cells, endocrine cells, etc. and can bind to 3 endothelins. Among the endothelin family, the effect of ET-1 on the cardiovascular system is particularly prominent. Recent studies have shown that ET-1 is involved in the pathophysiological processes of various diseases such as pulmonary hypertension, breast cancer, colorectal cancer, and gastric cancer. Endothelin converting enzyme-1 (ECE-1) inhibitors and endothelin receptor antagonists have begun to treat the above diseases.
[0003] Recent studies have shown that the endothelin system is widely involved in all stages of tumorigenesis and development, including mitosis promotion, apoptosis inhibition, bone remodeling promotion and new blood vessel formation. Neuroblastoma (NB) is the most common intracranial solid tumor in children. It is often in the advanced stage when discovered, prone to metastasis. Even high-risk NB children receive intensive treatment, recurrence or metastasis may still occur, and the treatment effect is poor. At present, the pathogenesis and treatment of NB have become the hotspots and difficulties in the research of pediatric solid malignant tumors. In recent years, with the progress of various technical means such as single-cell sequencing, many progress have been made in the research on the pathogenesis and treatment methods of NB.
[0004] Traditional gene knockdown methods usually rely on RNA interference (RNAi) techniques, such as small interfering RNA (siRNA) and short hairpin RNA (shRNA). Although these methods can effectively inhibit the expression of target genes to a certain extent, they have some limitations, such as non-specific effects, off-target effects, and difficulty in achieving long-term and stable gene knockdown. In addition, constructing a plasmid vector for stable expression of shRNA requires complex cloning steps and a long time.
[0005] In order to overcome these limitations, the present invention aims to provide a rapid, simple and efficient kit for constructing an ECE1 knockdown plasmid. Simplify the experimental operation process and improve the construction efficiency and accuracy. Summary of the Invention
[0006] The object of the present invention is to solve the disadvantages existing in the prior art, and to provide a kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid and its application.
[0007] To achieve the above object, the present invention adopts the following technical solutions:
[0008] A kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid, comprising:
[0009] High-fidelity PCR reagents: including High-Fidelity DNA Polymerase, buffer and dNTPs, for amplifying the ECE1 gene;
[0010] Double digestion reagents: including AgeII, EcoRI and their buffers, for linearizing the vector;
[0011] T4 DNA ligase and buffer: for ligating the ECE1 gene with the vector;
[0012] Competent bacteria DH5α: for transforming the ligation product to obtain the recombinant plasmid;
[0013] Plasmid extraction kit: for extracting the plasmid;
[0014] Transfection reagent lipo293 TM : for transfecting the plasmid into cells;
[0015] Resistance screening reagent: puromycin, for screening the stable transfected cell line.
[0016] Preferably: The method for constructing the ECE1 knockdown plasmid of the kit includes the following steps:
[0017] S1: Obtaining, amplifying and identifying the ECE1 gene;
[0018] S2: Construction of the linearized vector;
[0019] S3: Construction of the ECE1 knockdown lentiviral plasmid by seamless cloning technology;
[0020] S4: Bacterial transformation;
[0021] S5: Plasmid extraction and identification.
[0022] Preferably: In the above S1, it specifically includes the following steps:
[0023] Using High-Fidelity DNA Polymerase. Use a 50 μl reaction system of high-fidelity PCR to perform nested PCR specific amplification. Amplify the oligo that characterizes the ECE1 gene by PCR;
[0024] The upstream primer of the oligo is:
[0025] 5'-CCGGGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCATCGGC TTTTT-3',
[0026] The downstream primer is:
[0027] 5'-AATTAAAAAGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCA TCGGC-3';
[0028] The amplification conditions are: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 60 seconds, for a total of 33 cycles; finally, extension at 72°C for 3 minutes and preservation at 4°C; identify by 1% agarose gel electrophoresis, run the gel at a constant voltage of 120V for 30 minutes, and perform ultraviolet development identification; finally, perform gel extraction to obtain the DNA of the ECE1 gene.
[0029] Preferably: In S2, the following steps are specifically included:
[0030] Double-digest the adeno-associated virus vector with AgeI I and EcoRI. The enzyme digestion system: The total amount of Tet-plKO vector is 5 μg, 2 μl of each of AgeI I and EcoRI, 5 μl of 10xRcutSmart, and make up to 50 μl with DEPC water. React at 37°C for 4 hours; identify by 2% agarose gel electrophoresis, run the gel at a constant voltage of 120V for 30 minutes, and perform ultraviolet development identification; finally, perform gel extraction to obtain the digested vector.
[0031] Preferably: In S3, the following steps are specifically included:
[0032] Use the T4 ligation method to ligate the ECE1 oligo to the vector gap. The T4 ligation system: 1 μl of ECE1 oligo, 1 μl of the vector recovered after double-digestion of Tet-plKO, 1 μl of T4 DNA Ligase, 1 μl of 10x T4 Ligase Buffer, and make up to a total volume of 10 μl with DEPC water; incubate at 16°C for 16 hours.
[0033] Preferably: In S4, the following steps are specifically included:
[0034] Add 10 μl of the ligation product to 50 μl of competent bacteria DH5α, place on ice for 30 min, heat shock at 42°C for 90 s, immediately place on ice for 3 min, add 300 μl of LB liquid medium, culture in a shaker at 37°C for 1 h, spread the centrifuged bacteria on an ampicillin LB solid medium, incubate at 37°C for 16 h, pick a monoclonal colony and inoculate it into 3 ml of ampicillin LB liquid medium, and culture at 37°C for 14 - 16 h.
[0035] Preferably: In S5, the following steps are specifically included:
[0036] Extract the plasmid using a plasmid extraction kit, identify it by digestion with XhoI enzyme and sequence it, and then obtain the target plasmid for subsequent transfection.
[0037] Preferably: In the application of the kit, it includes the packaging of recombinant lentivirus, the infection of BE-2 cell line with lentivirus and resistance screening, and the verification of knockdown at the mRNA level. Among them, the packaging of the recombinant lentivirus is specifically as follows:
[0038] Before transfection, inoculate 293T cells into a culture dish. When the cell density reaches a confluence rate of 70% - 80%, subsequent transfection can be carried out; use lipo293 TM Co-transfect the vector plasmid carrying the target gene and the helper plasmid into 293T cells for packaging. Collect the virus culture supernatant at 24 h and 48 h after transfection respectively, remove cell debris. After placing the collected virus stock solution in a centrifuge tube, add the co-infection reagent polybrene.
[0039] Preferably: The infection of BE-2 cell line with lentivirus and resistance screening are specifically as follows:
[0040] Digest BE-2 cells and inoculate them into a 6-well plate, 2 ml per well; when the cell confluence rate is about 60%, discard the original medium, add the treated virus solution for the infection step. After 48 h of infection, discard the original medium, and replace it with a 10% FBS complete medium containing puromycin for continued screening culture; after screening for two generations, pick the drug-resistant cells and continue to expand the culture to obtain a stable overexpression cell line.
[0041] Preferably: The verification of knockdown at the mRNA level is specifically as follows:
[0042] Use different concentrations of doxycycline 0 μg / ml, 1 μg / ml, 2 μg / ml to induce the cells for 48 h, then collect the cells to extract RNA and perform QPCR for verification.
[0043] The beneficial effects of the present invention are:
[0044] 1. The present invention uses high-fidelity PCR and seamless cloning techniques, significantly shortening the time for plasmid construction and improving experimental efficiency; High-Fidelity DNA Polymerase is used for PCR amplification to ensure the high fidelity and specificity of the amplification products. High-Fidelity DNA Polymerase is used for PCR amplification to ensure the high fidelity and specificity of the amplification products.
[0045] 2. The present invention ligates the ECE1 gene fragment to the linearized vector through T4 DNA ligase to ensure the stability and reliability of the recombinant plasmid; puromycin, a resistance screening reagent, is provided to facilitate the screening of stable transfected cell lines and verify the knockdown effect at the mRNA level. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 It is a diagram of the control of GFP-positive plasmid infection in BE-2 cells of the present invention;
[0047] Figure 2 It is a schematic diagram of the target fragment of ECE1 of the present invention;
[0048] Figure 3 It is a schematic diagram of the digested knockdown vector of the present invention;
[0049] Figure 4 It is a schematic diagram of the XhoI digestion identification after plasmid synthesis of the present invention;
[0050] Figure 5 It is a schematic diagram of the cell RNA QPCR Result of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0051] The technical solutions of the present invention will be further described in detail below in conjunction with the specific embodiments.
[0052] Example 1:
[0053] A kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid and its application, including: construction of ECE1 knockdown plasmid, packaging of recombinant lentivirus, lentivirus infection of BE-2 cell line and resistance screening, and verification of knockdown at the mRNA level;
[0054] Specifically, the construction of the ECE1 knockdown plasmid includes the following steps:
[0055] (1) Acquisition, amplification and identification of ECE1 gene
[0056] Using High-Fidelity DNA Polymerase (NEB#M0491) For the nested PCR specific amplification in a 50 μl high-fidelity PCR reaction system, amplify the oligo characterizing the ECE1 gene by PCR. The upstream primer of the oligo is: 5'-CCGGGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCATCGGCTTTT T-3', and the downstream primer is: 5'-AATTAAAAAGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCATCGG C-3'. The amplification conditions are as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 60 seconds, for a total of 33 cycles; finally, extension at 72°C for 3 minutes and preservation at 4°C; identify by 1% agarose gel electrophoresis, run the gel at a constant voltage of 120V for 30 minutes, and perform ultraviolet development for identification; finally, perform gel extraction to obtain the DNA of the ECE1 gene.
[0057] (2) Construction of the linearized vector
[0058] Digest the adeno-associated virus vector (Tet-plKO) with AgeI I (NEB) and EcoRI (NEB) by double digestion. The digestion system is as follows: the total amount of the Tet-plKO vector is 5 μg, 2 μl each of AgeI I and EcoRI, 5 μl of 10xRcutSmart, and make up to 50 μl with DEPC water, and react at 37°C for 4 hours. Identify by 2% agarose gel electrophoresis, run the gel at a constant voltage of 120V for 30 minutes, and perform ultraviolet development for identification. Finally, perform gel extraction to obtain the digested vector.
[0059] (3) Construction of the ECE1 knockdown lentiviral plasmid using seamless cloning technology
[0060] Use the T4 ligation method to ligate the ECE1 oligo to the vector gap. The T4 ligation system is as follows: 1 μl of ECE1 oligo, 1 μl of the vector recovered after double digestion of Tet-plKO, 1 μl of T4 DNA Ligase, 1 μl of 10x T4 Ligase Buffer, and make up to the total volume of 10 μl with DEPC water. Incubate at 16°C for 16 hours.
[0061] (4) Bacterial transformation
[0062] Add 10 μl of the ligation product to 50 μl of competent bacteria DH5α, place it on ice for 30 min, heat shock at 42 °C for 90 s, immediately place it on ice for 3 min, add 300 μl of LB liquid medium, culture it on a shaker at 37 °C for 1 h, spread the centrifuged bacteria on solid LB medium containing ampicillin, incubate at 37 °C for 16 h, pick a single colony and inoculate it into 3 ml of LB liquid medium containing ampicillin, and culture it at 37 °C for 14 - 16 h.
[0063] (5) Plasmid extraction and identification: Extract the plasmid using a plasmid extraction kit, identify it by digestion with XhoI enzyme and sequence it, and obtain the target plasmid for subsequent transfection.
[0064] Specifically, the packaging of the recombinant lentivirus is as follows:
[0065] Before transfection, seed 293T cells in a culture dish. When the cell density reaches a confluence rate of 70% - 80%, subsequent transfection can be carried out. Use lipo293 TM Co - transfect the vector plasmid carrying the target gene and the helper plasmids (psPAX2 and pMD2.G) into 293T cells for packaging. Collect the virus culture supernatant at 24 h and 48 h after transfection respectively, remove cell debris. After placing the collected virus stock solution in a centrifuge tube, add the co - infection reagent polybrene (1:1000).
[0066] Specifically, the lentivirus infection of BE - 2 cell line and resistance screening are as follows:
[0067] Digest BE - 2 cells and inoculate them into a 6 - well plate, 2 ml per well; when the cell confluence rate is about 60%, discard the original medium, add the treated virus solution for the infection step. After 48 h of infection, discard the original medium, and replace it with 10% FBS complete medium containing puromycin for continued screening culture; after screening for two generations, pick the drug - resistant cells for further expansion culture to obtain a stable over - expressing cell line.
[0068] Specifically, the verification of knockdown at the mRNA level is as follows:
[0069] Induce cells with different concentrations of doxycycline (0 μg / ml, 1 μg / ml, 2 μg / ml) for 48 h, then collect the cells to extract RNA and perform QPCR for verification.
[0070] As mentioned above, the above are only the preferred specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and all should be covered within the protection scope of the present invention.
Claims
1. A rapid construction kit for knocking down endothelin converting enzyme ECE1, characterized in that: include: High-fidelity PCR reagents: included High-Fidelity DNA Polymerase, buffer, and dNTPs for amplification of the ECE1 gene; Double enzyme digestion reagents: including AgeI I, EcoRI and their buffer, used for linearization of vectors; T4 DNA ligase and buffer: used to connect the ECE1 gene and the vector; Competent bacteria DH5α: used to transform the ligation product and obtain the recombinant plasmid; Plasmid extraction kit: used to extract plasmid; Transfection reagent lipo293 TM : Used to transfect plasmids into cells; Resistance selection reagent: Puromycin, used to select stable cell lines.
2. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 1, characterized in that: The method for constructing the ECE1 knockdown plasmid of the kit comprises the following steps: S1: ECE1 gene acquisition, amplification and identification; S2: Construction of linearized vector; S3: Construction of ECE1 knockdown lentiviral plasmid using seamless cloning technology; S4: bacterial transformation; S5: Plasmid extraction and identification.
3. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 2, characterized in that: The S1 specifically includes the following steps: use High-Fidelity DNA Polymerase 50 μl reaction system was used for nested PCR specific amplification to amplify the oligo that characterizes the ECE1 gene; The upstream primer of oligo is: 5'-CCGGGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCATCGGC TTTTT-3', The downstream primers are: 5'-AATTAAAAAGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCA TCGGC-3'; The amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 55°C for 20 seconds, and extension at 72°C for 60 seconds, for a total of 33 cycles; finally extension at 72°C for 3 minutes and storage at 4°C; identification by 1% agarose gel electrophoresis, running the gel at a constant voltage of 120V for 30 minutes, and identification by ultraviolet development; and finally gel recovery to obtain the DNA of the ECE1 gene.
4. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 2, characterized in that: The S2 specifically includes the following steps: The adeno-associated virus vector was double-digested with AgeII and EcoRI, and the digestion system was as follows: 5ug of Tet-plKO vector, 2ul of AgeII and EcoRI, 5ul of 10xRcutSmart, and DEPC water was added to 50ul. The reaction time was 4h at 37°C. The vector was identified by 2% agarose gel electrophoresis, and the gel was run at a constant voltage of 120V for 30min, followed by UV development for identification. Finally, the gel was recovered to obtain the digested vector.
5. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 2, characterized in that: The S3 specifically includes the following steps: Use T4 ligation to connect ECE1 oligo to the gap in the vector. T4 ligation system: ECE1 oligo 1ul, vector 1ul recovered after Tet-plKO double enzyme digestion, T4 DNA Ligase 1ul, 10x T4 Ligase Buffer 1ul, DEPC water to make up the total volume to 10ul; incubate at 16℃ for 16 hours.
6. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 2, characterized in that: The S4 specifically includes the following steps: Add 10ul of the ligation product to 50μl of competent bacteria DH5α, place on ice for 30min, heat shock at 42℃ for 90s, immediately place on ice for 3min, add 300μl of LB liquid culture medium, culture at 37℃ on a shaker for 1h, spread the centrifuged bacteria on ampicillin LB solid culture medium, incubate at 37℃ for 16h, pick a single clone colony and inoculate it in 3ml of ampicillin LB liquid culture medium, and culture at 37℃ for 14-16h.
7. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 2, characterized in that: The S5 specifically includes the following steps: The plasmid was extracted using a plasmid extraction kit, and the target plasmid for subsequent transfection was obtained after identification with XhoI restriction enzyme digestion and sequencing.
8. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to any one of claims 1 to 7, characterized in that: The application of the kit includes packaging of recombinant lentivirus, infection of BE-2 cell line with lentivirus and resistance screening, and verification of knockdown at the mRNA level, wherein the packaging of the recombinant lentivirus is specifically as follows: Before transfection, 293T cells were seeded in a culture dish, and subsequent transfection was performed when the cell density reached 70% to 80% confluence. TM The vector plasmid and auxiliary plasmid carrying the target gene were co-transfected into 293T cells for packaging. The virus culture supernatant was collected 24h and 48h after transfection, and the cell debris was removed. The collected virus stock solution was placed in a centrifuge tube and the infection-aiding reagent polybrene was added.
9. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 8, characterized in that: The lentivirus-infected BE-2 cell line and resistance screening are specifically as follows: The BE-2 cells were digested and inoculated into a 6-well plate, 2 ml per well; when the cell fusion rate was about 60%, the original culture medium was discarded, and the treated virus solution was added for infection. After 48 hours of infection, the original culture medium was discarded and replaced with 10% FBS complete culture medium containing puromycin for continued screening and culture; after two generations of screening, drug-resistant cells were selected for continued expansion culture to obtain a stably overexpressed cell line.
10. The kit for rapid construction of endothelin converting enzyme ECE1 knockdown plasmid according to claim 8, characterized in that: The verification of knockdown at the mRNA level is as follows: The cells were induced with different concentrations of doxycycline (0ug / ml, 1ug / ml, and 2ug / ml) for 48 hours, and then RNA was extracted from the cells for QPCR verification.