Method for detecting PSC residues in PSC differentiated cells and application

Through the RT-qPCR detection method combined with the generation of standard curves, the problem of different residual sensitivity and high cost of detection of iPSC/ESC in the prior art is solved, and high sensitivity and low cost PSC residual detection is achieved.

CN120174068APending Publication Date: 2025-06-20UNIXELL BIOTECHNOLOGY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510637231.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-19
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The methods for detecting iPSC/ESC residues in the prior art have problems such as varying sensitivity, high detection cost, and complex operation, and an accurate, simple operation and low cost detection method is urgently needed.

Method used

The ESRG gene expression level in cell therapy products was quantitatively detected by RT-qPCR detection method, and a standard curve was formed by combining proportionally prepared PSC lysate and PSC differentiated cell lysate to achieve the detection of PSC residual ratio.

Benefits of technology

This method has higher detection sensitivity, can detect PSC residues with a sensitivity of 0.0001%, and is simple to operate and low cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174068A_ABST
    Figure CN120174068A_ABST
Patent Text Reader

Abstract

The invention relates to a method and a kit for detecting PSC residues in PSC differentiated cells, and is characterized in that the method takes an ESRG gene as a PSC marker, the PSC differentiated cells are ESRG negative cells, and the method comprises preparation of a standard substance and generation of a standard curve, wherein the preparation process of the standard substance comprises the following steps: mixing a PSC lysis solution and a PSC differentiated cell lysis solution in proportion to obtain the standard substance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biomedicine, and specifically to a method and kit for detecting the residual pluripotent stem cells (PSCs) in PSC-differentiated cells, which are used for the quality control and safety evaluation of the residual PSCs in PSC-differentiated cells. Background Art

[0002] At present, there are various methods for detecting the residual iPSC / ESC, such as flow cytometry (1. Kuroda T et al., PLoS ONE, 2012, 7: e37342; 2. Han J et al., Biomaterials, 2016, 105: 66 - 76), RT-qPCR (1. Kuroda T et al., PLoS ONE, 2012, 7: e37342; 2. Kuroda T et al., Methods in Molecular Biology, 2014, 1210: 183 - 192; 3. Sekine K et al., Scientific Reports, 2020, 10: 10293), ddPCR (Kuroda T et al., Regenerative Therapy, 2015, 2: 17 - 23), miRNA marker detection method secreted by PSCs (Pan CJC et al., Scientific Reports, 2016, 6: 32532), and efficient in vitro culture system detection method (Tano K et al., PLoS ONE, 2014, 9: e110496), which have been applied to the detection of undifferentiated hiPSC and ESC residues in cell therapy products.

[0003] However, the sensitivity of the flow cytometry method is low (about 0.01%); the sensitivity of the ddPCR method is high (0.0001%) (Shi H et al., Front Biosci (Landmark Ed), 2022 Aug 11, 27(8): 239), but the reagents used are expensive and the detection cost is high; in the miRNA marker detection method secreted by PSCs, miRNAs are not easy to extract and preserve; in the in vitro culture system, the residual PSCs need to be cultured in a medium suitable for the growth of PSCs for many days, and the state of PSCs has a great influence on the detection results.

[0004] Therefore, there is an urgent need in the art for a method for detecting the proportion of residual PSCs in a sample with high accuracy, low detection cost, and convenient operation. Summary of the Invention

[0005] This application quantitatively detects the expression level of the ESRG gene in cell therapy products through an RT-qPCR detection method, thereby detecting the residual proportion of PSCs in a sample. It is characterized by using a proportionally prepared PSC lysis solution and a cell lysis solution differentiated from PSCs as standards to form a standard curve.

[0006] The technical problem solved by this application is to provide a method and kit for detecting the residual PSCs in cells differentiated from PSCs that are more accurate, simple to operate, and have a lower cost. The beneficial effects are as follows: Compared with the standards of PSCs and cells differentiated from PSCs prepared according to cell ratios by flow cytometry sorting, the method for preparing the standards used in this application has higher detection sensitivity and can detect the residual PSCs with a sensitivity of 0.0001%.

[0007] On the one hand, this application provides a method for detecting the residual PSCs in cells differentiated from PSCs. It is characterized in that the method uses the ESRG gene as a PSC marker, the cells differentiated from PSCs are ESRG-negative cells, and the method includes the preparation of standards and the generation of a standard curve. The process of preparing the standards includes: using a PSC lysis solution and a cell lysis solution differentiated from PSCs, and mixing them in proportion to prepare the standards.

[0008] In some embodiments, the process of preparing the standards is: mixing the PSC lysis solution and the cell lysis solution differentiated from PSCs in different proportions to prepare the standards, and the residual proportions of PSCs in the standards are 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001%, and 0% respectively.

[0009] In some embodiments, the calculation process of the standard curve is as follows:

[0010] 1) Calculate the ΔCT values of the standards with different residual proportions of PSCs, where ΔCT = CT ESRG -CT 内参基因 ;

[0011] 2) Use the ΔCT value of the standard with a 100% residual proportion of PSCs as the control group, and calculate the ΔΔCT values of the standards with different residual proportions of PSCs, where ΔΔCT = ΔCT - ΔCT 100% PSC标准品 ; and

[0012] 3) Use the Log[residual proportion of PSCs (%)] value of the standards as the abscissa and the ΔΔCT value as the ordinate to plot the standard curve and obtain the formula of the standard curve.

[0013] In some embodiments, the formula of the standard curve is:

[0014] ΔΔCT = k × Log[residual proportion of PSCs (%)] + b,

[0015] where k is the slope and b is the intercept.

[0016] In some embodiments, the preparation process of the standard product is as follows:

[0017] 1) Take PSC and ESRG-negative cells, and adjust the cell concentration to 1×10 6 cells per 350 μL. Then add Buffer RL to each and lyse and mix thoroughly to obtain PSC and ESRG-negative cell lysates;

[0018] 2) Mix the PSC lysate and the ESRG-negative cell lysate in proportion to prepare standard products, where the PSC residual ratios are 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001%, and 0% respectively;

[0019] 3) Take 350 μL of each standard product with different PSC residual ratios for total RNA extraction and cDNA reverse transcription.

[0020] In some embodiments, the ESRG-negative cells are optionally selected from: 1) ectoderm-derived cells, including midbrain dopaminergic progenitor cells (mDAP), GABAergic interneuron progenitor cells (GIP), neurons, astrocytes, oligodendrocytes, retinal pigment epithelial cells (RPE), epidermis, hair, and keratinocytes; 2) endoderm-derived cells, including hepatocytes, pancreatic islet β cells, intestinal epithelial cells, and alveolar cells; and 3) mesoderm-derived cells, including hematopoietic cells, endothelial cells, cardiomyocytes, smooth muscle cells, skeletal muscle cells, renal cells, adipocytes, chondrocytes, and osteocytes.

[0021] In some embodiments, the ESRG-negative cells are mDAP or GIP.

[0022] In some embodiments, the preparation process of the standard product is as follows:

[0023] 1) Take PSC and mDAP, or PSC and GIP, and adjust the cell concentration to 1×10 6 cells per 350 μL. Then add Buffer RL to each and lyse and mix thoroughly to obtain PSC and mDAP lysate, or PSC and GIP lysate;

[0024] 2) Mix the PSC lysis solution and the ESRG-negative cell lysis solution in proportion to prepare standards with PSC residual ratios of 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001%, and 0%, respectively.

[0025] 3) Take 350 µL of each standard with different PSC residual ratios for total RNA extraction and cDNA reverse transcription.

[0026] In some embodiments, after extracting total RNA and reverse transcribing cDNA, the method detects by RT-qPCR:

[0027] 1) The expression levels of the ESRG gene and the reference gene in the standards, mDAP D0, and mDAP samples; or

[0028] 2) The expression levels of the ESRG gene and the reference gene in the standards, GIP D0, and GIP samples;

[0029] Wherein D0 is the cells differentiated from PSC with a PSC residual ratio of 100%, i.e., the starting differentiated PSC.

[0030] In some embodiments, the calculation process for the mDAP D0 and mDAP samples, and the GIP D0 and GIP samples is as follows:

[0031] 1) Calculate the ΔCT of the mDAP D0 and mDAP samples, or calculate the ΔCT of the GIP D0 and GIP samples, where ΔCT = CT ESRG - CT 内参基因 ;

[0032] 2) Use the ΔCT value of the mDAP D0 or GIP D0 sample as the control group to calculate the ΔΔCT value of the mDAP or GIP sample. Substitute the ΔΔCT value of the mDAP or GIP sample into the standard curve formula to calculate the residual amount of PSC in the mDAP or GIP sample, where the ΔΔCT of the mDAP or GIP sample = ΔCT - ΔCT mDAP D0或GIP D0 ;

[0033] Wherein mDAP D0 or GIP D0 is mDAP or GIP with a PSC residual ratio of 100%. mDAP is differentiated from mDAP D0 according to the production process of the mDAP neural progenitor cell therapy product, and GIP is differentiated from GIP D0 according to the production process of the GIP neural progenitor cell therapy product.

[0034] In some embodiments, the formula for calculating the PSC residual ratio in the mDAP or GIP sample is:

[0035] .

[0036] In some embodiments, the internal reference gene is arbitrarily selected from ACTB (Actin Beta), GAPDH, and 18s-rRNA.

[0037] In some embodiments, primers are used to detect the expression levels of the ESRG gene and the ACTB gene, and the primers include upstream primers, downstream primers, and probes; wherein,

[0038] 1) ESRG gene: The nucleotide sequence of the upstream primer is as shown in SEQ ID NO:1, the nucleotide sequence of the downstream primer is as shown in SEQ ID NO:2, and the nucleotide sequence of the probe is as shown in SEQ ID NO:3;

[0039] 2) ACTB gene: The nucleotide sequence of the upstream primer is as shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer is as shown in SEQ ID NO:5, and the nucleotide sequence of the probe is as shown in SEQ ID NO:6.

[0040] In some embodiments, wherein,

[0041] 1) ESRG gene: The 5' end of the probe is modified with a 6-FAM fluorophore, and the 3' end is modified with a quencher group,

[0042] 2) ACTB gene: The 5' end of the probe is modified with a VIC fluorophore, and the 3' end is modified with a quencher group,

[0043] The quencher group includes a Minor Groove Binder (MGB), a Black Hole Quencher 1 (BHQ1), and / or a Black Hole Quencher 2 (BHQ2).

[0044] On the other hand, the present application also provides a kit, which contains the standard product prepared by any one of the above methods. The kit further includes upstream primers, downstream primers, and probes for the ESRG gene and the internal reference gene, as well as an instruction manual for the detection method. The standard product is total RNA or reverse-transcribed cDNA extracted after different PSC lysis solutions and cell lysis solutions differentiated from PSC are prepared in proportion, and the PSC residue ratio in the standard product includes 100%, 1%, 0.1%, 0.01%, 0.001%, and 0.0001%.

[0045] Those skilled in the art can easily gain insights into other aspects and advantages of this application from the following detailed description. Only exemplary embodiments of this application are shown and described in the following detailed description. As those skilled in the art will recognize, the content of this application enables those skilled in the art to make changes to the disclosed specific embodiments without departing from the spirit and scope of the invention involved in this application. Accordingly, the descriptions in the drawings and the specification of this application are merely exemplary and not restrictive. Description of the Drawings

[0046] The features and advantages of the invention involved in this application can be better understood by referring to the exemplary embodiments and the drawings described in detail below. A brief description of the drawings is as follows:

[0047] Figure 1 It shows a schematic diagram of the positions of primers and probes in Example 1 of this application;

[0048] Figure 2 It shows an amplification characteristic analysis curve of the primers and probes (applied to the mRNA expression level analysis of ESRG gene and ACTB gene) in Example 1 of this application;

[0049] Figure 3 It shows a specific gel electrophoresis analysis diagram of the primers and probes (applied to the mRNA expression level analysis of ESRG gene and ACTB gene) in Example 1 of this application;

[0050] Figure 4 It shows an analysis diagram of the mRNA expression level of ESRG gene in PSCs of different donors and passages in Example 2 of this application;

[0051] Figure 5 It shows a schematic diagram of the standard curve for the detection of PSC residues in the neural progenitor cell therapy products (mDAP and GIP) in Example 3 of this application;

[0052] Figure 6 It shows an analysis diagram of the expression of ESRG in the neural progenitor cell therapy products (mDAP and GIP) containing different proportions of PSC residues in Example 4 of this application;

[0053] Figure 7 It shows the change of PSC residue levels in the production process of the neural progenitor cell therapy product (mDAP) in Example 5 of this application;

[0054] Figure 8 It shows the results of preparing the PSC residue standard product using flow cytometry sorting method in Example 6 of this application;

[0055] Figure 9Shown are the results of preparing the PSC residual standard by the proportional mixing method using the lysis solution in Example 6 of the present application. Detailed implementation manners

[0056] The following specific embodiments illustrate the implementation manners of the invention of the present application. Those skilled in the art can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.

[0057] Term definitions

[0058] In the present application, the term "ΔΔCT" generally refers to a relative quantitative analysis method commonly used in real-time fluorescence quantitative PCR (qPCR) for comparing the expression differences of target genes in different samples. ΔCT = CT 目的基因 - CT 内参基因 , and ΔΔCT is the difference in ΔCT values between intra-group comparisons, that is, ΔΔCT == ΔCT - ΔCT 对照品 .

[0059] In the present application, the term "pluripotent stem cell" or "PSC" generally refers to a cell with the potential for proliferation and differentiation. Pluripotent stem cells can be functionally defined as the following cells: (1) having the ability to differentiate into different types of cells and, in some cases, generating only a specific cell type, and (2) being able to self-renew for a long time, producing one or more cells that are the same as or different from the original cell type. The sources and preparation methods of pluripotent stem cells are not limited. For example, the pluripotent stem cells can be naturally obtained or artificially modified. For example, the pluripotent stem cells can include embryonic stem cells, induced pluripotent stem cells, etc. Therefore, the term "pluripotency" refers to a cell state with a developmental potential degree lower than or equal to totipotency.

[0060] In the present application, the term "embryonic stem cell" is also called "embryonic stem cell" and can be abbreviated as "ESC". It generally refers to a cell with the characteristics of unlimited proliferation, self-renewal, and multi-directional differentiation. Embryonic stem cells are stem cells obtained from the undifferentiated inner cell mass of the blastocyst (early embryonic stage). Their sources and preparation methods are not limited. Whether in vitro or in vivo environments, embryonic stem cells can be induced to differentiate into almost all cell types of the body. For example, the cell types can be hematopoietic stem cells, nerve cells, cardiomyocytes, etc.

[0061] In this application, the term "induced pluripotent stem cells" or "induced pluripotent stem cells" or "iPSC" or "iPSCs" generally refers to mature cells that are unable to differentiate into somatic cells and return to a state of omnipotence under certain conditions. The omnipotence refers to the ability to differentiate into all types of cells in the body and form a complete embryo or further develop into a new individual. For example, the induced pluripotent stem cells have the ability to differentiate into neural progenitor cells.

[0062] In this application, the term "differentiation" refers to the process by which a cell changes from one cell type to another cell type, particularly a less specialized type of cell to a more specialized type of cell.

[0063] In this application, the terms "include", "comprising", "having", "may", "containing" and their variations are generally intended to be open transitional phrases, terms or words that do not exclude the possibility of additional actions or structures. The term "consisting of..." generally means that no other components (or similarly, features, integers, steps, etc.) can be present. Unless the context clearly dictates otherwise, singular forms such as "a", "an", "the" in English, "a", "a kind" and "said / the" in Chinese generally include plural forms of the referred things.

[0064] In this application, the term "about" generally means approximately, in the region of, roughly, or around. When the term "about" is used to refer to a numerical range, a cutoff value or a specific value is used to indicate that the stated value may differ from the listed value by up to 10%. Thus, the term "about" can be used to cover variations of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a specific value. DETAILED DESCRIPTION OF THE INVENTION

[0066] On the one hand, the present application provides a method for detecting PSC residues in PSC differentiated cells.

[0067] The principle of this detection method is to use the ESRG gene as a PSC marker and the ACTB (Actin Beta) gene as an internal reference gene. At the same time, PSC-differentiated cell samples containing different PSC residual ratios are prepared as standards. After extracting total RNA and reverse transcribing it into cDNA, the expression levels of the ESRG gene and ACTB gene in the standard and mDAP (or GIP) D0 / mDAP (or GIP) samples are detected by RT-qPCR.

[0068] Standard curve calculation process:

[0069] 1) Calculate the ΔCT values of different PSC residual ratio standards (Note: ΔCT = CT ESRG - CT ACTB );

[0070] 2) Take the ΔCT value of the PSC with a PSC residual ratio of 100% as the control group, and calculate the ΔΔCT values of different PSC residual ratio standards (Note: ΔΔCT = ΔCT - ΔCT 100% PSC标准品 );

[0071] 3) Use the standard product Log[PSC residual ratio (%)] value as the abscissa and the ΔΔCT value as the ordinate to plot a standard curve and obtain the formula of the standard curve.

[0072] Calculation method of mDAP (or GIP) D0 / mDAP (or GIP) sample:

[0073] 1) Calculate the ΔCT values of mDAP (or GIP) D0 and mDAP (or GIP) sample (ΔCT = CT ESRG - CT ACTB );

[0074] 2) Take the ΔCT value of the mDAP (or GIP) D0 sample as the control group, calculate the ΔΔCT value of the mDAP (or GIP) sample (Note: ΔΔCT = ΔCT - ΔCT mDAP(或GIP)D0 ), substitute the ΔΔCT value of the mDAP (or GIP) sample into the standard curve formula, and thus calculate the residual amount of PSC in the mDAP (or GIP) sample.

[0075] 3) mDAP (or GIP) D0 is the mDAP (or GIP) with a PSC residual ratio of 100%, and mDAP (or GIP) is differentiated from mDAP (or GIP) D0 according to the production process of the neural progenitor cell therapy product.

[0076] Based on the above methodological principles, the present invention also includes the following content.

[0077] Furthermore, the ESRG gene sequence can be found in NCBI Reference Sequence_NC_000003.12, and the ACTB gene sequence can be found in NCBI Reference Sequence: NC_000007.14. Based on the reference gene sequences, primers for the mRNA expression levels of the ESRG gene and the ACTB gene, including introns, were designed respectively. The primers include upstream primers, downstream primers, and probes. Among them, 1) for the ESRG gene: the nucleotide sequence of the upstream primer is as shown in sequence SEQ ID NO:1, the nucleotide sequence of the downstream primer is as shown in sequence SEQ ID NO:2, and the nucleotide sequence of the probe is as shown in sequence SEQ ID NO:3. 2) for the ACTB gene: the nucleotide sequence of the upstream primer is as shown in sequence SEQ ID NO:4, the nucleotide sequence of the downstream primer is as shown in sequence SEQ ID NO:5, and the nucleotide sequence of the probe is as shown in sequence SEQ ID NO:6.

[0078] SEQ ID NO:1 is ATCATGGACGCCGAGCTTTA; SEQ ID NO:2 is ATGTCTTCCCTTTCATGCGC; SEQ ID NO:3 is AGCCTGTTTGGTGGTCTCTT.

[0079] SEQ ID NO:4 is CTACAATGAGCTGCGTGTGG; SEQ ID NO:5 is TAGCACAGCCTGGATAGCAA; SEQ ID NO:6 is TTCAACACCCCAGCCATGTA.

[0080] Among them, 1) for the ESRG gene: the 5' end of the probe is modified with a 6-FAM fluorescent group, and the 3' end is modified with a quenching group (quenching groups such as MGB, BHQ1, and BHQ2, etc.). 2) for the ACTB gene: the 5' end of the probe is modified with a VIC fluorescent group, and the 3' end is modified with a quenching group (quenching groups such as MGB, BHQ1, and BHQ2, etc.).

[0081] Among them, during the RT-qPCR reaction, the primers for the mRNA expression levels of the ESRG gene and the ACTB gene can specifically amplify the products of the cDNA samples respectively; the primers of the two genes cannot amplify the products of the gDNA samples and NTC (no-template control, i.e., DNase / RNase-Free Water); therefore, the primers of the two genes can specifically detect the mRNA expression levels of the ESRG gene and / or the ACTB gene in the samples. At the same time, the amplification efficiencies of the primers of the two genes both meet 90.0% - 110.0%. The specific results are shown in Table 4. Figure 2and Figure 3 。

[0082] Furthermore, the process of extracting total RNA and reverse transcribing cDNA is as follows: Take PSC and mDAP (or GIP) samples, containing a cell pellet of 1×10 6 , aspirate the residual supernatant liquid, with each 350 µL containing 1×10 6 cells, then add Buffer RL, fully lyse and mix evenly, and extract total RNA according to the requirements of the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, 9767) kit instructions. Measure the concentration of the extracted total RNA on a NanoDrop™ OneC instrument, and then, according to the requirements of the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, RR047A) kit instructions, perform cDNA reverse transcription with a total RNA content of 200 ng / reaction, with the final concentration of cDNA being 10 ng / µL of total RNA. Then, perform RT-qPCR analysis at 5 µL / well.

[0083] Furthermore, the process of preparing the standard product is as follows:

[0084] 1) Take PSC / mDAP (or GIP) samples, containing a cell pellet of n×10 6 , aspirate the residual supernatant liquid, with each 350 µL containing 1×10 6 cells, add Buffer RL, fully lyse and mix evenly, that is, the PSC / mDAP (or GIP) lysate.

[0085] 2) Standard products prepared by mixing PSC lysate and mDAP (or GIP) lysate in proportion are used for the detection of the standard curve. The standard products include standard products with PSC residual ratios of 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001%, and 0% respectively; an example of the standard product preparation process is shown in Table 1. Take 350 µL of each standard product with different PSC residual ratios, perform total RNA extraction and reverse transcription according to the process of extracting total RNA and reverse transcribing cDNA described above. After reverse transcription, the cDNA is aliquoted at 20 µL / tube and stored in a -80°C ultra-low temperature freezer.

[0086] Table 1 Example of the standard product preparation process

[0087]

[0088] 3) RT-qPCR analysis was performed at 5 μL / well. The calculation process of the standard curve of the standard product: With Log[PSC residue ratio (%)] as the abscissa and the ΔΔCT value of the standard product (Note: ΔΔCT = ΔCT - ΔCT 100% PSC标准品(STD-100%) ) as the ordinate, calculate the standard curve and formula (the determination coefficient R of the standard curve 2 : ≥0.98).

[0089] Furthermore, during the preparation process of the standard product, after the mDAP (or GIP) cells were subjected to total RNA extraction and reverse transcription into cDNA, then, ddPCR analysis was performed at 5 μL / Reaction, and ESRG was not detected.

[0090] Furthermore, the RT-qPCR analysis process is as follows

[0091] Take the cDNA of the standard product and the PSC / mDAP (or GIP) sample. According to the requirements of the Premix Ex Taq™ (Probe qPCR) (TaKaRa, RR390A) reagent instruction manual (select a suitable RT-qPCR reaction system and reaction program to perform multiplex RT-qPCR reaction), perform RT-qPCR analysis at 5 μL / well, and the sample replication number is 3 replicates.

[0092] Furthermore, the RT-qPCR reaction system is shown in Table 2, and the reaction program is shown in Table 3.

[0093] Table 2 RT-qPCR reaction system

[0094]

[0095] Table 3 RT-qPCR reaction program

[0096]

[0097] Furthermore, the standard curve formula is

[0098] ΔΔCT = k × Log[PSC residue ratio%] + b

[0099] where k is the slope and b is the intercept.

[0100] Furthermore, the calculation formula for the result of the mDAP (or GIP) sample is

[0101] .

[0102] On the other hand, the present application also provides a kit.

[0103] In some embodiments, the kit contains a standard prepared by any of the methods of the present application, and the standard contains total RNA or reverse-transcribed cDNA extracted after being prepared with different ratios of PSC lysis solution to cell lysis solution of PSC differentiation.

[0104] In some embodiments, the kit further contains upstream primers, downstream primers, and probes for the ESRG gene and a reference gene. The upstream primers, downstream primers, and probes contained in the kit are for detecting the gene expression of the ESRG gene and the reference gene in a sample to be tested.

[0105] In some embodiments, the PSC residual ratios in the standard contain 100%, 1%, 0.1%, 0.01%, 0.001%, and 0.0001%.

[0106] In some embodiments, the PSC residual ratios in the standard can further contain any ratio from 0.0001% to 100%. For example, the ratios can be 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 3%, 2%, 1%, 0.1%, 0.01%, 0.001%, and 0.0001%, etc.

[0107] In some embodiments, the reference gene is the ACTB gene.

[0108] In some embodiments, the upstream primers, downstream primers, and probes are in dry powder form.

[0109] In some embodiments, the kit further contains an instruction manual for the detection method. For example, the instruction manual for the detection method contains a result calculation method and usage instructions.

[0110] Without being limited by any theory, the following examples are only for explaining the preparation method of the standard of the present application, the establishment formula of the standard curve, the method for detecting the residual PSC in cells differentiated from PSC, etc., and are not used to limit the scope of the invention of the present application.

[0111] Examples

[0112] The principles and features of the present invention are described below, and the examples given are only for explaining the present invention and are not used to limit the scope of the present invention.

[0113] In the following embodiments, the reagents used for the extraction of total RNA, cDNA reverse transcription, and RT-qPCR analysis and detection were all purchased from TaKaRa, and iPSC, ESC, and mDAP (and / or GIP) cells were all prepared by Shanghai Yuesai Biotechnology Co., Ltd.; the primers for ESRG and ACTB were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0114] In the following embodiments, the extraction of total RNA and the process of cDNA reverse transcription are specifically described in the detailed description of the invention.

[0115] In the following embodiments, the preparation process of the standard product is specifically described in the detailed description of the invention.

[0116] In the following embodiments, the RT-qPCR reaction system and reaction program are specifically described in the detailed description of the invention.

[0117] In the following embodiments, the RT-qPCR analysis process is specifically described in the detailed description of the invention.

[0118] Example 1 Design and Verification of Primers

[0119] Using the online primer design website Primer3 Input (https: / / primer3.ut.ee / ), gene expression primers and probes spanning introns were designed. The size of the RT-qPCR product of the ESRG primer is 115 bp, and the size of the RT-qPCR product of the ACTB primer is 151 bp. The positions of the ESRG and ACTB primers and probes in the reference sequence are specifically shown in Figure 1 (Note: The probe of ESRG spans exon 1 and exon 2 and is not marked in the schematic diagram).

[0120] To verify the specificity and amplification characteristics of the ESRG and ACTB primers and probes, TotalRNA was extracted from iPSC and ESC and reverse transcribed into cDNA, and gDNA was extracted from iPSC and ESC, and then RT-qPCR analysis was performed. At the same time, gel electrophoresis analysis was performed on the RT-qPCR amplification products. The results are specifically shown in Table 4, Figure 2 and Figure 3 .

[0121] Table 4 Analysis of Specificity and Amplification Characteristics of Primers and Probes

[0122]

[0123] Note: 1. iPSC / ESC cDNA is an equal ratio mixture of iPSC cDNA and ESC cDNA; 2. iPSC / ESCgDNA is an equal ratio mixture of iPSC gDNA and ESC gDNA, with a concentration of 100.0 ng total gDNA perReaction.

[0124] iPSC / ESC gDNA and H2O were used as negative controls for the cross-intron mRNA primers. The results showed that only the ACTB primers and probes could specifically amplify the RT-qPCR products of iPSC / ESC cDNA; only the ESRG primers and probes could specifically amplify the RT-qPCR products of iPSC / ESC cDNA. This indicated that the designed ACTB primer / probe and ESRG primer / probe were specific cross-intron mRNA primers. In iPSC / ESC cDNA samples with different concentrations, there was a linear relationship between Lg[concentration / ng total RNA per Reaction] and CT. Among them, the amplification efficiency of the ACTB primer / probe was 90.47%, R 2 was 0.9993, and the amplification efficiency of the ESRG primer / probe was 95.32%, R 2 was 0.9998. This indicated that the designed ACTB primer / probe and ESRG primer / probe had good amplification effects and could be applied to the analysis of the expression levels of ACTB and ESRG mRNA in PSC / mDAP (or GIP) samples.

[0125] Example 2 Analysis of the mRNA Expression Levels of the ESRG Gene in PSCs of Different Donors and Passages

[0126] The mRNA expression levels of the ESRG gene and ACTB gene in 6 batches of iPSCs with different donors and passages, and 6 batches of ESCs with the same donor and different passages were analyzed. The results are shown in Table 5 and Figure 4 .

[0127] Table 5 mRNA Expression Levels of the ESRG Gene in PSCs of Different Donors and Passages

[0128]

[0129] The results showed that there were significant differences in the mRNA expression levels of the ESRG gene in PSCs of different donors and passages. Therefore, during the sample detection process, there were differences between the PSCs used for standard preparation and the PSCs at the D0 stage of the initial differentiation of mDAP (or GIP); during the calculation of the results of mDAP (or GIP) samples, by calculating ΔΔCT (ΔΔCT = ΔCT - ΔCT PSC ), thus, the differences between PSCs among batches were removed.

[0130] Example 3 Establishment of the Standard Curve

[0131] According to the standard preparation process in the detailed description of the invention, a standard curve for the detection of PSC residues in the neural progenitor cell therapy product (mDAP) was obtained. See specifically Figure 5 .

[0132] Example 4 Application of PSC Residual Detection Method in Neural Progenitor Cell Therapy Products

[0133] 1) In neural progenitor cell therapy products applied to Parkinson's disease, analyze the applicability of the PSC residual detection method.

[0134] Four batches of neural progenitor cell therapy products (mDAP, differentiated from iPSC according to the production process) containing different proportions of PSC (iPSC) were prepared and RT-qPCR analysis was carried out. The specific results are shown in Figure 6 .

[0135] One batch of neural progenitor cell therapy products (mDAP, differentiated from ESC according to the production process) containing different proportions of PSC (ESC) was prepared and RT-qPCR analysis was carried out. The specific results are shown in Figure 6 .

[0136] The results show that in the range of PSC (iPSC and ESC) proportions from 0.0001% to 100%, ΔΔCT has a gradient linear relationship with the PSC (iPSC and ESC) proportion. At the same time, the detection limit of PSC (iPSC and ESC) residues in neural progenitor cell therapy products (mDAP) can reach the level of 0.0001%.

[0137] 2) Similarly, in neural progenitor cell therapy products applied to epilepsy, also analyze the applicability of the PSC residual detection method.

[0138] One batch of neural progenitor cell therapy products (GIP, differentiated from ESC according to the production process) containing different proportions of PSC (ESC) was prepared and RT-qPCR analysis was carried out. The specific results are shown in Figure 6 .

[0139] The results show that in the range of PSC (ESC) proportions from 0.0001% to 100%, ΔΔCT has a gradient linear relationship with the PSC (ESC) proportion. At the same time, the detection limit of PSC (ESC) residues in neural progenitor cell therapy products (GIP) can also reach the level of 0.0001%.

[0140] Example 5 Study on the Change of PSC Residual Level in the Production Process of Neural Progenitor Cell Therapy Products

[0141] In neural progenitor cell therapy products applied to Parkinson's disease, analyze the change of PSC residual level in its production process, including mDAP differentiated from iPSC according to the production process and mDAP differentiated from ESC according to the production process. The results are shown in Figure 7 .

[0142] The results showed that in the neural progenitor cell therapy product mDAP, the PSC residual level in its production process decreased with the differentiation time, indicating that as the differentiation process proceeded, PSCs differentiated into neural progenitor cells; among PSCs from different donors, the PSC residual levels were inconsistent, indicating that there were differences in the differentiation progress of different donors; at the differentiation endpoint D21, the PSC residual levels of the neural progenitor cell therapy product mDAP were all lower than the detection limit level (<LOD: 0.0005%), indicating that the PSC residual levels of the neural progenitor cell therapy product mDAP were very low, and its safety met the requirements without the risk of tumorigenicity.

[0143] Example 6 Research on the detection sensitivity of flow cytometry sorting method and the method of mixing with lysis buffer in proportion

[0144] 6.1 Flow cytometry sorting method

[0145] After staining the PSC suspension (including iPSCs and ESCs, the same below) with live cell stain, use a flow cytometer (SONY, MA900) and set the sorting parameters: 1) Gate the main cell population, 2) Gate the live cell population, 3) Set the number of sorted cells, and sort PSCs into 15 mL centrifuge tubes according to the order of magnitude of 1, 10, 100, 1000, and 10000 cells respectively; then, similarly, after staining the mDAP cell suspension with live cell stain, use a flow cytometer (SONY, MA900), set the sorting parameters: 1) Gate the main cell population, 2) Gate the live cell population, 3) Set the number of sorted cells, and sort live mDAP into the above 15 mL centrifuge tubes according to the order of magnitude of 999999, 999990, 999900, 999000, and 990000 cells respectively; after centrifuging the collected PSCs and mDAP cell mixed suspension to remove the supernatant, prepare standards containing 0.0001%, 0.001%, 0.01%, 0.1%, and 1% PSC residual ratios. After total RNA extraction and cDNA reverse transcription, perform RT-qPCR analysis. The experimental design for preparing standards by flow cytometry sorting method is shown in Table 6 below, and the experimental results are as Figure 8 shown. The sensitivity of the standards prepared by flow cytometry sorting method is 0.001%.

[0146] Table 6 Experimental design for preparing standards by flow cytometry sorting method

[0147]

[0148] 6.2 Method of mixing with lysis buffer in proportion

[0149] 1) Take PSC / mDAP samples, containing n×10 6Cell pellet, aspirate the residual supernatant, at 350 µL per 1×10 6 cells, add Buffer RL, and lyse and mix well to obtain the PSC / mDAP cell lysate.

[0150] 2) A series of standard products prepared by mixing PSC lysate and mDAP lysate in proportion for the detection of the standard curve, including standard products with PSC residual ratios of 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001% and 0% respectively; an example of the standard product preparation process is shown in Table 7. Take 350 µL of each standard product with different PSC residual ratios, perform total RNA extraction and reverse transcription according to the total RNA extraction and cDNA reverse transcription processes described above. After reverse transcription, the cDNA is aliquoted at 20 µL / tube and stored in an ultra-low temperature freezer at -80 °C.

[0151] 3) Perform RT-qPCR analysis at 5 µL / well.

[0152] Table 7 Preparation process of standard products

[0153]

[0154] The detection results of the standard products prepared by the proportional mixing method of lysates are as Figure 9 shown. Applying the proportional mixing method of lysates (i.e., the method protected by this application) has a detection sensitivity of 0.0001%, which is one order of magnitude higher than that of the flow cytometry sorting method.

Claims

1. A method for detecting residual PSC in PSC-differentiated cells, characterized in that: The method uses the ESRG gene as a PSC marker, the PSC differentiated cells are ESRG negative cells, and the method includes the preparation of a standard and the generation of a standard curve, wherein the preparation process of the standard includes: using a PSC lysate and a PSC differentiated cell lysate, mixing them in proportion to prepare a standard.

2. The method according to claim 1, wherein the preparation process of the standard is: PSC lysate and PSC differentiated cell lysate are mixed in different proportions to prepare the standard, and the residual proportions of PSC in the standard are 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001% and 0%, respectively.

3. The method according to claim 1, wherein the calculation process of the standard curve is: 1) Calculate the ΔCT value of the standard sample with different PSC residue ratios, where ΔCT = CT ESRG -CT 内参基因 ; 2) Taking the ΔCT value of the standard with a PSC residual ratio of 100% as the control group, calculate the ΔΔCT values ​​of the standards with different PSC residual ratios, where ΔΔCT=ΔCT-ΔCT 100% PSC标准品 ;and 3) Use the standard sample Log [PSC residual ratio (%)] value as the horizontal axis and the ΔΔCT value as the vertical axis to draw a standard curve and derive the formula of the standard curve.

4. The method according to claim 1, wherein the formula of the standard curve is: ΔΔCT = k×Log[PSC residual ratio (%)]+b, Where k is the slope and b is the intercept.

5. The method according to claim 1, wherein the preparation process of the standard is: 1) Take PSC and ESRG negative cells and make the concentration of each cell reach 1×10 per 350 μL. 6 Add Buffer RL to each cell and mix thoroughly to obtain the PSC and ESRG negative cell lysate. 2) PSC lysate and ESRG-negative cell lysate were mixed in proportion to prepare standard samples, where the residual PSC ratios were 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001% and 0% respectively; 3) Take 350 µL of each standard sample with different PSC residual ratios for total RNA extraction and cDNA reverse transcription.

6. The method according to claim 1, wherein the ESRG-negative cells are selected from: 1) ectoderm-derived cells, including midbrain dopaminergic progenitors (mDAP), GABAergic interneuron progenitors (GIP), neurons, astrocytes, oligodendrocytes, retinal epithelial cells (RPE), epidermis, hair and keratinocytes; 2) endoderm-derived cells, including hepatocytes, pancreatic β cells, intestinal epithelial cells, alveolar cells; and 3) mesoderm-derived cells, including hematopoietic cells, endothelial cells, cardiomyocytes, smooth muscle cells, skeletal muscle cells, kidney cells, adipocytes, chondrocytes and osteocytes.

7. The method of claim 1, wherein the ESRG-negative cells are mDAP or GIP.

8. The method according to claim 7, wherein the preparation process of the standard is: 1) Take PSC and mDAP, or PSC and GIP, and make the cell concentration reach 1×10 per 350 µL. 6 Add Buffer RL to each cell and mix thoroughly, i.e., PSC and mDAP lysis buffer, or PSC and GIP lysis buffer; 2) PSC lysate and ESRG-negative cell lysate were mixed in proportion to prepare standard samples, where the residual PSC ratios were 100%, 1%, 0.1%, 0.01%, 0.001%, 0.0001% and 0% respectively; 3) Take 350 µL of each standard sample with different PSC residual ratios for total RNA extraction and cDNA reverse transcription.

9. The method according to claim 8, wherein the method is to extract total RNA and reverse transcribe cDNA, and then detect by RT-qPCR method: 1) Expression levels of ESRG genes and reference genes in standards, mDAP D0 and mDAP samples; or 2) Expression levels of ESRG genes and reference genes in standards, GIP D0, and GIP samples; The D0 is a PSC differentiated cell with a PSC residual ratio of 100%, that is, a PSC at the initial differentiation.

10. The method according to claim 9, wherein the mDAP D0 and mDAP sample, and GIP D0 and GIP sample calculation process are: 1) Calculate the ΔCT of mDAP D0 and mDAP samples, or calculate the ΔCT of GIP D0 and GIP samples, where ΔCT = CT ESRG -CT 内参基因 ; 2) Using the ΔCT value of the mDAP D0 or GIP D0 sample as the control group, calculate the ΔΔCT value of the mDAP or GIP sample, substitute the ΔΔCT value of the mDAP or GIP sample into the standard curve formula, and calculate the residual amount of PSC in the mDAP or GIP sample, wherein the ΔΔCT of the mDAP or GIP sample = ΔCT - ΔCT mDAP D0或GIP D0 ; The mDAP D0 or GIP D0 is mDAP or GIP with a PSC residual ratio of 100%, mDAP is differentiated from mDAP D0 according to the mDAP neural precursor cell treatment product production process, and GIP is differentiated from GIP D0 according to the GIP neural precursor cell treatment product production process.

11. The method according to claim 10, wherein the PSC residual ratio in the mDAP or GIP sample is calculated as follows: 。 12. The method according to claim 3, wherein the internal reference gene is selected from ACTB (Actin Beta), GAPDH and 18s-rRNA.

13. The method according to claim 12, wherein primers are used to detect the expression levels of the ESRG gene and the ACTB gene, and the primers include an upstream primer, a downstream primer and a probe; wherein, 1) ESRG gene: the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the probe is shown in SEQ ID NO: 3; 2) ACTB gene: the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5, and the nucleotide sequence of the probe is shown in SEQ ID NO:

6.

14. The method according to claim 13, wherein: 1) ESRG gene: The 5' end of the probe is modified with a 6-FAM fluorescent group, and the 3' end is modified with a quenching group. 2) ACTB gene: The 5' end of the probe is modified with a VIC fluorescent group, and the 3' end is modified with a quenching group. The quenching group comprises a minor groove binder (Minor Groove Binder, MGB), a black hole quencher 1 (Black Hole Quencher 1, BHQ1) and / or a black hole quencher 2 (Black Hole Quencher 2, BHQ2).

15. A kit comprising a standard prepared by the method of any one of claims 1 to 14, further comprising upstream primers, downstream primers and probes of the ESRG gene and an internal reference gene, and a detection method instruction manual, wherein the standard is total RNA or reverse transcribed cDNA obtained by extracting different PSC lysates and PSC differentiated cell lysates in proportion, wherein the residual proportion of PSC in the standard comprises 100%, 1%, 0.1%, 0.01%, 0.001% and 0.0001%.

Citation Information

Patent Citations

  • LncRNAs biomarkers for detecting expression of human body CYP3A4 metabolic enzyme and detection primer and detection method thereof

    CN108977522A

  • iPSC residue detection method using ESRG gene as universal marker gene

    CN111996241A

  • Low-cost and high-sensitivity method for in-vitro detection of hESC residues in hESC differentiation-derived functional cells

    CN113234805A

  • Method for testing expression level of pluripotent gene

    CN114164258A

  • Kit for rapidly detecting hiPSC residues in hiPSC derived cells and application of kit

    CN119265291A