CBHI protein mutant as well as preparation method and application thereof
By modifying the linking peptide of CBHI protein, different types of CBHI mutants were constructed, which solved the problems of low hydrolysis efficiency of cellulase and high adsorption with lignin, and achieved the effect of improving enzymatic lysis efficiency and reducing costs.
Patent Information
- Application Number
- CN202510250179.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-04
- Publication Date
- 2025-06-24
AI Technical Summary
The existing cellulase has low hydrolysis efficiency and is more unproductive adsorbed with lignin, resulting in large amounts of enzymes, high cost, and low utilization efficiency of ligno fiber raw materials.
By modifying the linking peptide of CBHI protein, different CBHI mutants are constructed, including increasing proline, glycosylation, simultaneously increasing proline and glycosylation, and deleting glycosylation, to regulate the hydrolytic activity and adsorption ability of the enzyme.
The modified CBHI mutant significantly improved the specific vitality of the enzyme and the adsorption ability to cellulose, reduced the adsorption ability to lignin, enhanced the tolerance to lignin, and thus improved the enzymatic lysis efficiency.
Smart Images

Figure CN120192953A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of the preparation and application of enzyme preparations, and more specifically, relates to a CBHI protein mutant, a preparation method thereof, and an application thereof. Background Art
[0002] The low efficiency of enzymatic hydrolysis and saccharification of cellulose leads to a large amount of enzyme usage and high enzymatic hydrolysis cost, which are the main factors restricting the biorefining of lignocellulose. At the same time, the non-productive adsorption of enzymes and residual lignin in lignocellulose raw materials further weakens the ability of enzymes to hydrolyze cellulose. Therefore, how to improve the hydrolysis efficiency of enzymes on cellulose and reduce the non-productive adsorption of enzymes and lignin is the key to reducing the cost of enzymatic hydrolysis and realizing the efficient utilization of lignocellulose raw materials.
[0003] A single cellulase derived from fungi usually consists of a catalytic domain (CD) and a carbohydrate-binding domain (CBH), and these two domains are connected by a flexible linker peptide. The binding domain is considered to be the key to the adsorption of cellulase on lignin. However, studies have found that removing or modifying the binding domain will reduce the adsorption of cellulase on lignin while also reducing the adsorption of cellulase on cellulose. The catalytic domain plays a secondary role in the adsorption process of cellulase and lignin. Some studies have modified the catalytic domain to reduce the adsorption of cellulase and lignin, but the complex structure and large uncertainties of the domain lead to great difficulty in modification. The linker peptide of fungal cellulase is different from the catalytic domain and the binding domain in that it has a high degree of conservation, and the similarity of linker peptides from different sources is low. The linker peptide can regulate the interaction between the catalytic domain and the carbohydrate-binding domain of cellulase in various ways, affecting the activity and adsorption performance of cellulase.
[0004] Most commercial cellulases are derived from Trichoderma reesei. The extracellular proteins secreted by Trichoderma reesei are mainly cellulases, accounting for more than 80% of the extracellular proteins. The highest content in cellulases is cellobiohydrolase I (CBH I or TrCel7A), accounting for about 60% of the extracellular proteins, which plays the most important role in the enzymatic hydrolysis efficiency of commercial cellulase systems derived from Trichoderma reesei. CBH I has a relatively high affinity for substrates, but a relatively low specific activity. Therefore, it is necessary to modify CBH I. Existing studies mainly focus on the catalytic domain or binding domain of CBH I, and there is insufficient research on modifying its linker peptide to regulate the adsorption performance and enzymatic properties of the enzyme. Summary of the Invention
[0005] In view of the above problems existing in the prior art, the technical problems to be solved by the present invention are to provide a CBHI mutant with a modified linker peptide. Another technical problem to be solved by the present invention is to provide a method for preparing the CBHI mutant. The technical problem to be further solved by the present invention is to provide the application of the CBHI mutant, which is used to regulate the hydrolysis activity of CBHI on cellulose, to regulate the adsorption ability of CBHI to cellulose and lignin, to increase the tolerance of CBHI to lignin, so as to regulate the enzymatic hydrolysis efficiency when the CBHI mutant, endoglucanase and β-glucosidase synergistically hydrolyze filter paper added with lignin.
[0006] To solve the above technical problems, the technical solutions adopted by the present invention are as follows:
[0007] A CBHI protein mutant, characterized in that the CBHI protein mutant is obtained by only modifying the linker peptide of CBHI, and its name and the corresponding amino acid sequence of the modified linker peptide are shown in Table 2.
[0008] The method for preparing the CBHI protein mutant is to modify the linker peptide of the CBHI protein, specifically: insert PPG or TTS or PPGNPPG after the PPGGNPPG sequence of the linker peptide, or insert TTSSGPPG after the PPGGNPPGTTTTRRPATTTGSSP sequence of the linker peptide, or insert PPG after the PPGGNPPG sequence and insert TTSSGPPG after the TTTTRRPATTTGSSP sequence, or truncate TTTRP in the linker peptide.
[0009] The method for preparing the CBHI protein mutant comprises the following steps:
[0010] 1) Extraction of Trichoderma reesei QM9414 genomic DNA and amplification of the target gene;
[0011] 2) Construction of a constitutive promoter expression vector;
[0012] 3) Construction of a recombinant plasmid;
[0013] 4) Transformation and screening of Escherichia coli;
[0014] 5) Transformation, screening and expression of Trichoderma reesei.
[0015] In the method for preparing the CBHI protein mutant, the promoter used is the promoter tef1; the constitutive promoter expression vector is M13-Ptef1-Tcbh1.
[0016] In the method for preparing the CBHI protein mutant, the primer sequences used are shown in Table 1.
[0017] Application of the described CBHI protein mutant in enzymatic hydrolysis of cellulose.
[0018] The described application, wherein the CBHI protein mutant is selected from CBHI-L+3-1, CBHI-L+7, CBHI-L+8, CBHI-L+11, CBHI-L-5.
[0019] Application of the described CBHI protein mutant in synergistic hydrolysis of cellulose with endoglucanase and β-glucosidase.
[0020] The described application, wherein the protein mutant is selected from CBHI-L+8, CBHI-L+7, CBHI-L+3-1, CBHI-L+11.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0022] In the present invention, the linker peptide of the CBHI protein is modified to obtain mutants CBHI-L+3-1 and CBHI-L+7 with increased proline; a mutant CBHI-L+3-2 with increased glycosylation is obtained; mutants CBHI-L+11 and CBHI-L+8 with increased proline and glycosylation are obtained; a mutant CBHI-L-5 with deleted glycosylation is obtained. The results show that: the specific activity of the enzyme is improved by CBHI-L+3-1 protein, and / or CBHI-L+7 protein, and / or CBHI-L+8 protein, and / or CBHI-L+11 protein, and / or CBHI-L-5 protein; the specific activity of the enzyme is decreased by CBHI-L+3-2 protein. The adsorption ability of the enzyme to cellulose is promoted by CBHI-L+3-1 protein, and / or CBHI-L+8 protein; the adsorption ability of the enzyme to cellulose is inhibited by CBHI-L+7 protein, and / or CBHI-L+11 protein, and / or CBHI-L-5 protein. The adsorption ability of the enzyme to lignin is inhibited by CBHI-L+11 protein, and / or CBHI-L+8 protein. The tolerance to lignin is improved by CBHI-L+3-2, CBHI-L+7, CBHI-L+8, CBHI-L+11, while the tolerance to lignin of CBHI-L-5 and CBHI-L+3-1 decreases. Therefore, when synergistically hydrolyzing filter paper added with lignin with endoglucanase and β-glucosidase, the enzymatic hydrolysis efficiencies of CBHI-L+8, CBHI-L+7, CBHI-L+3-1, CBHI-L+11 are 1.6 times, 1.52 times, 1.49 times, and 1.46 times that of the wild-type CBHI, respectively. Brief Description of the Drawings
[0023] Figure 1 It is the structural diagram of the expression vector M13-Ptef1-Tcbh1;
[0024] Figure 2It is the gel electrophoresis diagram of the full gene fragments of cbh1 and its mutants (M: marker; 1-7 are the full gene fragments of cbh1, cbh1-l+3-1, cbh1-l+3-2, cbh1-l+7, cbh1-l+8, cbh1-l+11, cbh1-l-5 respectively);
[0025] Figure 3 It is the gel electrophoresis diagram of the recombinant plasmid (M: marker; 1-7 are M13-Ptef1-CBHⅠ-L+3-1-Tcbh1, M13-Ptef1-CBHⅠ-L+3-2-Tcbh1, M13-Ptef1-CBHⅠ-L+7-Tcbh1, M13-Ptef1-CBHⅠ-L+8-Tcbh1, M13-Ptef1-CBHⅠ-L+11-Tcbh1, M13-Ptef1-CBHⅠ-L-5-Tcbh1 respectively);
[0026] Figure 4 It is the SDS-PAGE result diagram of CBHⅠ and its mutants;
[0027] Figure 5 It is the enzymatic hydrolysis time curve diagram of CBHI and its mutants on microcrystalline cellulose;
[0028] Figure 6 It is the enzymatic hydrolysis time curve diagram of CBHI and its mutants on filter paper;
[0029] Figure 7 It is the time curve diagram of the synergistic degradation of filter paper by CBHI and its mutants;
[0030] Figure 8 It is the binding diagram of CBHI and its mutants with 80% phosphoric acid swollen cellulose at 4°C (150 revolutions per minute);
[0031] Figure 9 It is the binding diagram of CBHI and its mutants with microcrystalline cellulose at 4°C (150 revolutions per minute);
[0032] Figure 10 It is the binding diagram of CBHI and its mutants with lignin at 4°C (150 revolutions per minute);
[0033] Figure 11 It is the diagram of the release amount of reducing sugar during the enzymatic hydrolysis of microcrystalline cellulose at different times after adding lignin (blue: without lignin; red: with lignin);
[0034] Figure 12 It is the diagram of the release amount of reducing sugar during the enzymatic hydrolysis of filter paper at different times after adding lignin (blue: without lignin; red: with lignin);
[0035] Figure 13 Time curve of the synergistic degradation of filter paper by CBHI and its mutants after adding lignin.
[0036] Figure 14 Diagram of the synergistic enzymatic hydrolysis of filter paper by CBHI and its mutants, endoglucanase EGI and β-glucosidase after adding lignin (A: enzymatic hydrolysis for 24 h; B: enzymatic hydrolysis for 48 h; C: enzymatic hydrolysis for 72 h); Specific implementation manners
[0037] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified in detail, the technical means used are all conventional means well known to those skilled in the art.
[0038] In the following embodiments, the main reagents and measurement methods used are as follows:
[0039] 1) Preparation of 80% phosphoric acid swollen cellulose: Weigh 0.2 g of microcrystalline cellulose into a 50 mL centrifuge tube, add 600 μL of distilled water and shake until it becomes a paste; prepare 80% phosphoric acid, add 10 mL of 80% phosphoric acid to the centrifuge tube, shake well and let it stand on ice for 1 h; add 10 mL of pre-cooled distilled water, shake well, centrifuge at 4°C and 10000 rpm for 10 min, discard the supernatant, and repeat 4 times; add 20 mL of distilled water to suspend the precipitate, adjust the pH to about 5 with 2 M Na2CO3, centrifuge at 4°C and 10000 rpm for 10 min, and discard the supernatant; resuspend the precipitate with distilled water to 20 mL, shake well, and store at 4°C; 80% phosphoric acid swollen cellulose is prepared.
[0040] 2) Determination of cellulase activity:
[0041] Activity of 80% phosphoric acid swollen cellulose: Take 400 µL of the above-prepared 80% phosphoric acid swollen cellulose into a 2 mL centrifuge tube (final concentration is 4 mg / mL), add 1 µM of pure enzyme, make up the sodium acetate buffer (pH 5.0) to 1 mL, shake and react at 50°C and 1000 rpm for 12 h, and measure its enzyme activity. One unit of enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol of reducing sugar (calculated as cellobiose) per hour under the above reaction conditions.
[0042] Activity of microcrystalline cellulose: Take 400 µL of 1% microcrystalline cellulose into a 2 mL centrifuge tube (final concentration is 4 mg / mL), add 3 µM of pure enzyme, make up the sodium acetate buffer (pH 5.0) to 1 mL, shake and react at 50°C and 1000 rpm for 12 h, and measure its enzyme activity.
[0043] Filter paper enzyme activity: Cut filter paper (Whatman No. 1) into strips of 1×3.5, divide them into 8 equal small portions (30 mg), place them in a centrifuge tube, add 3 µM of pure enzyme, make up the sodium acetate buffer (pH 5.0) to 1 mL, react with shaking at 50 °C and 1000 rpm for 12 h, and measure its enzyme activity.
[0044] The primer sequences used are shown in Table 1.
[0045] Table 1 Primer sequences
[0046]
[0047] Example 1 Construction of mutants
[0048] 1. Extraction of the T. reesei QM9414 genome
[0049] Use the TransGen plant genomic DNA extraction kit to extract and obtain the genomic DNA of Trichoderma reesei QM9414 that meets the usage requirements according to the method described in the kit instruction manual.
[0050] 2. Construction of the constitutive promoter expression vector M13-Ptef1-Tcbh1
[0051] Using the genomic DNA of Trichoderma reesei QM9414 as a template, the promoter tef1 (GenBank: Z23012.1) was amplified by PCR using the primers tef1-F1 / tef1-R1. The plasmid pBI-PTcbh1 containing Xho I and Kpn I restriction sites (Liangkun Long, Lu Sun, Zhen Liu, Qunying Lin, Jing Wang, Shaojun Ding*(2022) Functional characterization of a GH62 family α-L-arabinofuranosidasefrom Eupenicillium parvum suitable for monosaccharification of corncobarabinoxylan in combination with key enzymes. Enzyme and MicrobialTechnology. 154, 109965. https: / / doi.org / 10.1016 / j.enzmictec.2021.109965, previously constructed by the inventors of this application) was double-digested to remove the cbh1 promoter. The double-digestion system was as follows: The fragment or plasmid 2μL, 10× Qcut buffer 2μL, Kpn I 1μL, Xho I 1μL, ddH2O 25μL. Incubate at 37°C for 30 min. After the reaction, the purified product was detected by agarose gel electrophoresis. The digested plasmid and the promoter tef1 were ligated using the Novozymes homologous recombination kit to obtain an expression vector containing the promoter tef1, named M13-Ptef1-Tcbh1 ( Figure 1 ).
[0052] 3. Preparation of mutants
[0053] In this example, CBHI from Trichoderma reesei was used as the object, and the linker peptide was modified from three aspects: the rigidity and flexibility, length, and amino acid type of the linker peptide. Six mutants were constructed, namely, adding proline (CBHI-L+3-1, CBHI-L7), adding glycosylation (CBHI-L+3-2), adding proline and glycosylation (CBHI-L+11, CBHI-L+8), and deleting glycosylation (CBHI-L-5). The sequences of each mutant are shown in Table 2.
[0054] Table 2 Sequences of mutants
[0055]
[0056] Using the wild-type cbh1 gene (GenBank: Z23012.1) as a template, first, the upper and lower fragments of the mutant were amplified by PCR separately, and then the two fragments were fused by fusion PCR to obtain the complete target gene. Among them, the PCR amplification system was as follows: Plasmid 1 μL, Forward primer (10 μM) 1 μL, Reverse primer (10 μM) 1 μL, Fastpfu DNA Polymerase 1 μL, dNTPs (2.5 mM) 4 μL, 5×PS Buffer 10 μL, ddH2O 32 μL. The PCR reaction conditions were: 95°C for 4 min; 95°C for 20 s, 55°C for 20 s, 72°C for 2 min, 30 cycles; 75°C for 5 min; 16°C ∞. The specific steps were as follows:
[0057] 1) Amplification of CBHI and its mutant genes
[0058] Amplification of the wild-type cbh1 gene: Using Trichoderma reesei genomic DNA as a template, the cbh1 gene was amplified by PCR using the primers cbh1-F4 / cbh1-R2.
[0059] Amplification of the mutant cbh1-l+3-1 gene: Using the cbh1 gene as a template, the upper fragment of cbh1-l+3-1 was amplified using the downstream primer cbh1-R12 of cbh1-l+3-1 and the upstream primer cbh1-F4 of cbh1; using the cbh1 gene as a template, the lower fragment of cbh1-l+3-1 was amplified using the upstream primer cbh1-F14 of cbh1-l+3-1 and the downstream primer cbh1-R2 of cbh1; then, the upper and lower fragments were amplified by overlapping PCR using the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to obtain the full fragment of cbh1-l+3-1.
[0060] Amplification of the mutant cbh1-l+3-2 gene: Using the cbh1 gene as a template, the upper fragment of cbh1-l+3-2 was amplified using the downstream primer cbh1-R17 of cbh1-l+3-2 and the upstream primer cbh1-F4 of cbh1; using the upstream primer cbh1-F19 of cbh1-L+3-2 and the downstream primer cbh1-R2 of cbh1 to amplify the lower fragment of cbh1-L+3-2; then, the upper and lower fragments were amplified by overlapping PCR using the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to obtain the full fragment of cbh1-l+3-2.
[0061] Amplification of mutant cbh1-l+7 gene: Using cbh1 as a template, the upper fragment of cbh1-l+7 was amplified with the downstream primer cbh1-R16 of mutant cbh1-l+7 and the upstream primer cbh1-F4 of cbh1; the lower fragment of mutant cbh1-l+7 was amplified with the upstream primer cbh1-F18 of cbh1-L+7 and the downstream primer cbh1-R2 of cbh1; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to obtain the full fragment of mutant cbh1-l+7.
[0062] Amplification of mutant cbh1-l+8 gene: Using cbh1 as a template, the upper fragment of cbh1-l+8 was amplified with the downstream primer cbh1-R11 of cbh1-l+8 and the upstream primer cbh1-F4 of cbh1; the lower fragment of cbh1-L+8 was amplified with the upstream primer cbh1-F12 of cbh1-l+8 and the downstream primer cbh1-R2 of CBHⅠ; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to obtain the full fragment of cbh1-l+8.
[0063] Amplification of mutant cbh1-l+11 gene: Using cbh1 as a template, the upper fragment of cbh1-l+11 was amplified with the downstream primer cbh1-R13 of cbh1-l+11 and the upstream primer cbh1-F4 of cbh1; the lower fragment of cbh1-l+11 was amplified with the upstream primer cbh1-F13 of cbh1-l+11 and the downstream primer cbh1-R2 of cbh1; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to obtain the full fragment of cbh1-l+11.
[0064] Amplification of mutant cbh1-l-5 gene: Using cbh1 as a template, the upper fragment of cbh1-l-5 was amplified with the downstream primer cbh1-R3 of cbh1-l-5 and the upstream primer cbh1-F4 of cbh1; the lower fragment of cbh1-l-5 was amplified with the upstream primer cbh1-F5 of cbh1-l-5 and the downstream primer cbh1-R2 of cbh1; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to obtain the full fragment of cbh1-l-5.
[0065] Gel electrophoresis diagrams of the full gene fragments of cbh1 and its mutants are shown as Figure 2 follows. The gene sizes of cbh1 and its mutants are all around 2000 bp.
[0066] 2) Construction of recombinant plasmids, transformation of Escherichia coli and screening
[0067] The vector M13-Ptef1-Tcbh1 was digested with Xho1 enzyme alone. The cbh1 (introducing 6 His tags and Xho1 digestion site at the C-terminus of cbh1), cbh1-l+3-1, cbh1-l+3-2, cbh1-l+7, cbh1-l+8, cbh1-l+11, cbh1-l-5 were respectively ligated with the digested vector using Novozymes homologous recombination kit to construct recombinant mutant plasmids M13-Ptef1-CBHⅠ-Tcbh1, M13-Ptef1-CBHⅠ-L+3-1-Tcbh1 (adding three PPGs), M13-Ptef1-CBHⅠ-L+3-2-Tcbh1 (adding three TTSs), M13-Ptef1-CBHⅠ-L+7-Tcbh1 (adding 7 PPGNPPGs), M13-Ptef1-CBHⅠ-L+8-Tcbh1 (adding 8 TTSSGPPGs), M13-Ptef1-CBHⅠ-L+11-Tcbh1 (adding 11 PPG------TTSSGPPGs), M13-Ptef1-CBHⅠ-L-5-Tcbh1 (truncating 5 TTTRPs in the middle), and all were successfully constructed ( Figure 3 )
[0068] The ligation products were transferred into Escherichia coli Top.10 competent cells and spread on LBA plates. The plates were inverted and cultured at 37 °C until single colonies grew out. Several single colonies were picked from the LBA plates into 20 μL of sterile water, and 10 μL of the colony was taken for PCR identification. The PCR amplification system was: Plasmid 10 μL, Forward primer (10 μM) 1 μL, Reverse primer (10 μM) 1 μL, dNTP Mixture 13 μL, ddH2O 25 μL. The PCR reaction conditions were: 95 °C for 4 min; 95 °C for 20 s, 55 °C for 20 s, 72 °C for 2 min, 30 cycles; 75 °C for 5 min; 16 °C ∞.
[0069] After the reaction, the products were detected by gel electrophoresis. The bacterial liquid with correct bands was inoculated into 5 mL of LB liquid medium containing ampicillin resistance and cultured for 12 - 16 h. 0.5 mL was used for preservation, and the remaining bacterial liquid was used to extract plasmids with the TransGen plasmid mini kit for standby, and the specific operation was carried out according to the instructions. The plasmids were digested with Xho1 and Kpn1 double enzymes, and the plasmids with correct digestion results were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0070] The double digestion system is as follows: 2 μL of the fragment or plasmid, 2 μL of 10×Qcut buffer, 1 μL of Kpn Ⅰ, 1 μL of Xho Ⅰ, and 25 μL of ddH2O. Incubate at 37°C for 30 min. After the reaction, purify the product and detect the purified product by agarose gel electrophoresis.
[0071] 3) Preparation and transformation of Trichoderma reesei protoplasts
[0072] Inoculate T. reesei QM9414 into the seed flask culture medium and culture at 28°C for 5 days until green spores grow. Scrape the spores into sterile water and collect the fungal spores by filtering with a cotton wick. Pipette 10 6 -10 8 spores and spread them on a PDA plate containing cellophane, and culture at 28°C for 20 - 22 h; Peel off the cellophane with germinated hyphae and transfer it to 20 mL of protoplast buffer containing 30 mg / mL pectinase and 4 mg / mL snailase (containing 0.6 M ammonium sulfate solution and 50 mM maleic acid, adjust the pH to 5.0, filter and sterilize with a sterile filter membrane, and place in a 50 mL centrifuge tube); Incubate in a water bath shaker at 30°C and 80 rpm for 3 h; Filter the lysate through four layers of lens paper, collect the protoplast suspension in a centrifuge tube, centrifuge at 8000 rpm for 5 min, and collect the protoplasts in a 2 mL centrifuge tube; Add 2 mL of Solution B (containing 0.375 g of CaCl2 and 18.22 g of sorbitol per 100 ml, adjust the pH to 7.5, filter and sterilize with a sterile filter membrane) to the collected protoplasts, gently pipette to mix evenly, centrifuge at 3000 rpm for 4 min, and repeat twice; After resuspending the protoplasts with Solution B, examine under a microscope to make the concentration 1×10 8 cells / mL and place on ice.
[0073] Add 10 μg of plasmid to 100 μL of the prepared protoplasts, incubate on ice for 20 min; Add 2 mL of regeneration medium, gently mix, and let stand at room temperature for 2 min; Add 4 mL of regeneration medium and 200 μg / mL of cefotaxime sodium, and incubate at 28°C for 20 h; Centrifuge at 8000 rpm for 5 min and discard the supernatant; Take 200 μL of the suspension and spread it on a PDA screening plate containing 50 μg / mL of hygromycin B, and culture at 28°C for 3 - 5 d; Pick a single transformant and transfer it to a PDA screening plate containing 50 μg / mL of hygromycin B; After the screening plate grows, transfer it to a PDA plate without resistance and culture for 4 - 5 d until green spores grow for screening.
[0074] 6. Screening of mutant strains
[0075] Scrape the spores of the transformants and inoculate them into 50 mL of liquid shake flask seed culture medium containing 1% glucose. Culture for 2 days at 28 °C and 200 rpm to obtain the seed solution. Inoculate the seed solution into 50 mL of liquid shake flask fermentation culture medium containing 2% glucose at an inoculation amount of 4%. Culture for 5 days at 28 °C and 200 rpm. Detect the pH every 24 h and adjust the pH to 4.5 - 5 using sterile 1 M NaOH solution. Screen the transformants with high expression levels, and name the mutant strains obtained after screening as: QM9414 - CBHⅠ, QM9414 - CBHⅠ - L + 3 - 1, QM9414 - CBHⅠ - L + 3 - 2, QM9414 - CBHⅠ - L + 7, QM9414 - CBHⅠ - L + 8, QM9414 - CBHⅠ - L + 11, and QM9414 - CBHⅠ - L - 5.
[0076] Example 2
[0077] 1. Purification of the recombinant enzyme
[0078] Use the mutant strains to ferment with 2% glucose as the carbon source in the fermentation medium (containing 20 g of carbon source, 2 g of KH2PO4, 1.4 g of (NH4)2 S O4, 0.3 g of urea, 0.3 g of CaCl2, 1 g of Peptone, 0.3 g of MgSO4·7H2O, 1 ml of trace element concentrate (added before inoculation) in 1000 mL, and adjust the pH to 5.0 with citric acid. Autoclave at 115 °C for 30 min.). Culture at 28 °C and 200 rpm for 5 days. Purify and recover the fermentation supernatant using a Ni - NTA affinity column to obtain a high - concentration enzyme; analyze the purity using SDS - PAGE.
[0079] The results are as Figure 4 shown. The purification effect of all enzymes is good, with a size of about 54 KDa, and glycosylation causes the target band to shift upward.
[0080] 2. Enzymatic properties of the recombinant protease
[0081] 1) Kinetic constants
[0082] Determine the kinetic constants using 80% phosphoric acid - swollen cellulose as the substrate. Prepare 80% phosphoric acid - swollen cellulose with concentrations of 0.4, 1.2, 1.6, 2.0, 2.4, 3, 4, 5, and 6 mg / mL respectively. At the optimal temperature of 55 °C and pH 5.0, measure the specific enzyme activity of the enzyme against different concentrations of the substrate, and use the inactivated enzyme as the blank control. Use GraphPad Prism 7.0 software to calculate V max and K m values according to the method of nonlinear regression.
[0083] The results are shown in Table 3. The V of CBHⅠ max was 12.61 U / mg. The V of CBHI-L+3-1, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5 max was higher than that of the wild type, being 1.27, 1.25, 1.34, 1.21, and 1.25 times that of the wild type, respectively. The V of CBHI-L+3-2 max was slightly lower than that of the wild type, approximately 92% of the wild type. The K of CBHⅠ m value was 0.90 mg / mL. The K values of CBHI-L+3-1, CBHI-L+3-2, and CBHI-L+7 m were lower than that of the wild type, being 0.73 mg / mL, 0.81 mg / mL, and 0.76 mg / mL, respectively; the K value of CBHI-L+8 m was 0.93 mg / mL, showing little difference from the wild type; the K values of CBHI-L+11 and CBHI-L-5 m were higher than that of the wild type, being 1.18 mg / mL and 1.02 mg / mL, respectively.
[0084] Table 3 Kinetic Constants of CBHⅠ and Its Mutants
[0085]
[0086] Example 3
[0087] 1. Determination of Specific Enzyme Activity Using 1% - 80% Phosphoric Acid-Swollen Cellulose as Substrate
[0088] The activity detection system for 80% phosphoric acid-swollen cellulose was: 400 μL of 80% phosphoric acid-swollen cellulose, 1 μM of enzyme, and 50 mM sodium acetate at pH 5 to make up to 1 mL.
[0089] React in a water bath at 55°C for 1 h, inactivate at 99°C after the reaction. Centrifuge at 10000 rpm for 10 min, pipette 200 μL of the supernatant and mix with 200 μL of DNS solution, boil at 99°C for 5 min, immediately place on ice and cool to room temperature, and detect the absorbance at 540 nm. The formula for calculating enzyme activity is Formula 1. Specific enzyme activity (IU / mg) = enzyme activity (IU / mL) / protein concentration (mg / mL). One unit of enzyme activity (IU) is defined as the amount of enzyme required to produce 1 μmol of cellobiose per minute under the above reaction conditions. Relative activity = mutant specific enzyme activity / wild type specific enzyme activity.
[0090] The results are shown in Table 4. The specific enzyme activity of CBHI towards 80% phosphoric acid-swollen cellulose was 11.1 U / mg. The specific enzyme activities of CBHI-L+3-1, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5 were increased to varying degrees compared with the wild type, which were 1.33, 1.25, 1.20, 1.22, and 1.24 times that of the wild type, respectively. The specific enzyme activity of CBHI-L+3-2 was slightly lower than that of the wild type, which was 97% of the wild type.
[0091] Table 4 Specific Enzyme Activities of CBHⅠ and Its Mutants towards 80% Phosphoric Acid-Swollen Cellulose
[0092]
[0093] 2. Determination of Specific Enzyme Activity and Enzymatic Hydrolysis Efficiency Using Microcrystalline Cellulose (Avicel) as Substrate
[0094] The microcrystalline cellulose activity detection system was as follows: 400 μL of 1% microcrystalline cellulose, 1 μM of enzyme, and made up to 1 mL with 50 mM sodium acetate at pH 5.
[0095] ① Specific Enzyme Activity
[0096] React with shaking at 55°C and 1000 rpm for 8 h, and inactivate at 99°C after the reaction. Centrifuge at 10000 rpm for 10 min, pipette 200 μL of the supernatant and mix with 200 μL of DNS solution, boil at 99°C for 5 min, immediately cool on ice, and detect the absorbance at 540 nm. The formula for calculating enzyme activity is Formula 1. Specific enzyme activity (IU / mg) = enzyme activity (IU / mL) / protein concentration (mg / mL). One unit of enzyme activity (IU) is defined as the amount of enzyme required to produce 1 μmol of cellobiose per minute under the above reaction conditions.
[0097] The results are shown in Table 5. The specific enzyme activity of CBHI towards microcrystalline cellulose was 0.333 U / mg. The specific enzyme activities of CBHI-L+3-1, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5 were increased to varying degrees compared with the wild type, which were 1.55, 1.29, 1.15, 1.22, and 1.15 times that of the wild type, respectively. The specific enzyme activity of CBHI-L+3-2 was significantly decreased compared with the wild type, only 75% of the wild type.
[0098] Table 5 Specific Enzyme Activities of CBHⅠ and Its Mutants towards Microcrystalline Cellulose
[0099]
[0100] ② Enzymatic Hydrolysis Efficiency
[0101] React with shaking at 55°C and 1000 rpm for 12 h, 24 h, 48 h, and 72 h respectively (add Tetracycline with a final concentration of 80 μg / mL to the system). After the reaction, inactivate at 99°C and centrifuge to take the supernatant to detect the amount of reducing sugar. Plot the curve of the amount of reducing sugar released over time.
[0102] The results are as Figure 5 shown. The enzymatic hydrolysis rate of all enzymes is relatively fast in the first 12 hours. After 12 hours, the enzymatic hydrolysis rate gradually slows down with the increase of time. After 72 hours of enzymatic hydrolysis, the amounts of reducing sugar released by CBHI-L+3-1, CBHI-L+7, CBHI-L+11, CBHI-L+8, and CBHI-L-5 are 1.6, 1.29, 1.29, 1.15, and 1.15 times that of the wild type respectively, and the amount of reducing sugar released is increased compared with the wild type; the amount of reducing sugar released by CBHI-L+3-2 is 80% of the wild type, and the amount of reducing sugar released is decreased compared with the wild type.
[0103] 3. Determine the specific enzyme activity and enzymatic hydrolysis efficiency using filter paper (FP) as the substrate
[0104] ① Specific enzyme activity
[0105] Cut the filter paper into strips of 1×3.5 cm, divide them into 8 equal small parts (30 mg), and place them in 2 mL centrifuge tubes. Add 3 μM of pure enzyme, make up to 1 mL with sodium acetate at pH 5.0, and react with shaking at 55°C and 1000 rpm for 8 h. After the reaction, inactivate at 99°C and determine its specific enzyme activity. One unit of enzyme activity (IU) is defined as the amount of enzyme required to produce 1 μmol of cellobiose per hour under the above reaction conditions.
[0106] The results are shown in Table 6. The specific enzyme activity of CBHⅠ towards filter paper is 0.71 U / mg. The specific enzyme activities of CBHI-L+3-1, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5 are 1.53, 1.42, 1.37, 1.35, and 1.30 times that of the wild type respectively, and the specific enzyme activities are improved to varying degrees; the specific enzyme activity of CBHI-L+3-2 is only 88% of the wild type, and the specific enzyme activity decreases significantly.
[0107] Table 6 Specific enzyme activities of CBHI and its mutants towards filter paper
[0108]
[0109] ② Enzymatic hydrolysis efficiency
[0110] Cut the filter paper into strips of 1×3.5 cm (about 30 mg), divide it into 8 equal parts, add 3 µM of pure enzyme, make up to 1 mL with sodium acetate at pH 5.0, and react with shaking at 55 °C and 1000 rpm for 4 h, 8 h, 12 h, 24 h, 48 h and 72 h (add Tetracycline with a final concentration of 80 μg / mL to the system). After the reaction, inactivate at 99 °C, centrifuge to obtain the supernatant and detect the amount of reducing sugar, and draw a curve of the reducing sugar release amount changing with time.
[0111] The results are as Figure 6 shown. The enzymatic hydrolysis rate is the fastest in the first 4 h of enzymatic hydrolysis. Except that the amount of reducing sugar released by CBHI-L+3-1 is significantly higher than that of the wild-type enzyme and the other mutant enzymes, there is little difference in the amount of reducing sugar released by CBHI-L+7, CBHI-L+8, CBHI-L+11 and CBHI-L-5, which is only slightly higher than that of the wild-type. The amount of reducing sugar released by CBHI-L+3-2 is slightly lower than that of the wild-type; as time increases, after enzymatic hydrolysis for 72 h, the amounts of reducing sugar released by CBHI-L+3-1, CBHI-L+7, CBHI-L+11, CBHI-L+8 and CBHI-L-5 are 1.5, 1.4, 1.29, 1.31 and 1.20 times that of the wild-type respectively, and the reducing sugar release amount is increased compared with the wild-type; the amount of reducing sugar released by CBHI-L+3-2 is 90% of that of the wild-type, and the reducing sugar release amount is decreased compared with the wild-type.
[0112] Example 4 Synergistic enzymatic hydrolysis of filter paper by CBHI and its mutants and EG1 / β-glucosidase
[0113] Reaction system and conditions: Cut the filter paper into strips of 1×3.5 cm (about 30 mg), divide it into 8 equal parts, add 25 μg of EGI and 15 U / g of substrate β-glucosidase, and add 50 μg of CBHI and mutant enzymes respectively. Make up to 1 mL with sodium acetate at pH 5, and react with shaking at 50 °C and 1000 rpm for 4 h, 8 h, 12 h, 24 h, 48 h and 72 h (add Tetracycline with a final concentration of 80 μg / mL to the system). After the reaction, inactivate at 99 °C, centrifuge to obtain the supernatant and detect the amount of reducing sugar respectively. Draw a synergistic enzymatic hydrolysis curve with time as the abscissa and the reducing sugar release amount as the ordinate.
[0114] The results of the kinetic process of the synergistic effect are as Figure 7As shown, the synergistic degradation ability of mutants CBHI-L+3-1, CBHI-L+7, CBHI-L-5, CBHI-L+11, and CBHI-L+8 with EGI and β-glucosidase is higher than that of the wild type. The amounts of reducing sugars released by the synergistic enzymatic hydrolysis of filter paper for 72 h are 1.42, 1.35, 1.17, 1.11, and 1.10 times that of the wild type, respectively. The synergistic ability of mutant CBHI-L+3-2 is lower than that of the wild type, and the amount of reducing sugars released by the synergistic enzymatic hydrolysis for 72 h is only 85% of that of the wild type.
[0115] Example 5
[0116] 1. Adsorption of CBHI and Its Mutants on 80% Phosphoric Acid-Swelled Cellulose
[0117] The activity detection system for 80% phosphoric acid-swollen cellulose is as follows: 80% phosphoric acid-swollen cellulose 4 mg / mL, enzyme 0 - 40 µMol, pH 5, and make up to 0.5 mL with 50 mM sodium acetate.
[0118] Use 4 mg / mL 80% phosphoric acid-swollen cellulose as the substrate to detect the adsorption of enzyme variants and the wild type. React at 4°C and 150 rpm / min for 0, 15 min, 30 min, 45 min, and 60 min to explore the reaction time. After determining the reaction time, add each component according to the system for reaction. After the reaction, centrifuge at 10000 rpm for 10 min, take the supernatant, 280 measure the amount of unbound enzyme in the supernatant, and use the binding equation to determine max (µMol / g) and K d (µM) values. The formula is as follows:
[0119] .
[0120] Y - Amount of bound enzyme; X - Amount of free enzyme; B max - Maximum binding capacity; K d - Adsorption dissociation constant.
[0121] The results are as Figure 8 shown. At low concentrations (0 - 4 µM), the enzyme is rapidly adsorbed on phosphoric acid-swollen cellulose, and almost no free protein can be detected in the supernatant. When the enzyme concentration reaches 5 µM, a small amount of free protein can be detected in the supernatant. Continuing to increase the enzyme concentration, the free protein in the supernatant gradually increases, and the amount of enzyme adsorbed on the substrate also gradually increases. When the concentration reaches about 30 µM, the enzyme concentration adsorbed on the substrate no longer changes, and the adsorption reaches an equilibrium state.
[0122] The results are shown in Table 7. The affinity (K d), is significantly improved compared to the wild type, and its binding ability (B max ), is decreased compared to the wild type; the affinity of mutant CBHI-L+7 is slightly decreased compared to the wild type, and its binding ability is not significantly different from that of the wild type; the affinity of mutant CBHI-L+8 is increased compared to the wild type, and its binding ability is slightly increased compared to the wild type; the affinity of mutant CBHI-L+11 is decreased compared to the wild type, and its binding ability is not significantly different from that of the wild type; the affinity of mutant CBHI-L-5 is significantly decreased compared to the wild type, and its binding ability is also significantly decreased.
[0123] Table 7 Affinity of CBHI and Its Mutants for 80% Phosphoric Acid-Swelled Cellulose
[0124]
[0125] 2. Adsorption of CBHI and Its Mutants on Microcrystalline Cellulose
[0126] The adsorption of enzyme variants and wild type was detected using 4 mg / mL microcrystalline cellulose as the substrate. The reaction system was 4 mg / mL microcrystalline cellulose, 0 - 40 µMol of pure enzyme was added, and the volume was made up to 0.5 mL with 50 mM sodium acetate at pH 5.0. The reaction was carried out at 4 °C and 150 rpm / min for 1 h. After the reaction, it was centrifuged at 10000 rpm for 10 min, and the supernatant was taken. A 280 The free enzyme in the supernatant was detected, and the values of Bmax (µMol / g) and Kd (µM) were determined using the formula.
[0127] The results are as Figure 9 shown. When the added enzyme concentration is lower than 5 µM, the adsorption rate of the enzyme is fast. When the concentration is greater than 5 µM, the rate slows down.
[0128] The results are shown in Table 8. The affinity of mutant CBHI-L+3-1 is increased compared to the wild type, its binding ability is improved, and its adsorption performance is higher than that of the wild type; the binding ability of mutant CBHI-L+7 is not significantly different from that of the wild type, its affinity is decreased, and its adsorption performance is slightly lower than that of the wild type; the affinity of mutant CBHI-L+8 is increased compared to the wild type, and its binding ability is not significantly different from that of the wild type; the affinity of mutant CBHI-L+11 is decreased compared to the wild type, and its binding ability is significantly improved; the affinity of mutant CBHI-L-5 is significantly decreased compared to the wild type. Although its binding ability is improved, its adsorption performance is much lower than that of the wild type.
[0129] Table 8 Affinity of CBHI and Its Mutants for Microcrystalline Cellulose
[0130]
[0131] 3. Adsorption of CBHI and Its Mutants on Corncob Enzymatic Lignin
[0132] The adsorption of enzyme variants and wild type was detected using 4 mg / mL corncob enzymatically hydrolyzed lignin as the substrate. The reaction system was 4 mg / mL corncob enzymatically hydrolyzed lignin, to which 0 - 40 µMol of pure enzyme was added, and the volume was made up to 0.5 mL with 50 mM sodium acetate at pH 5.0. The reaction was carried out at 4 °C and 150 rpm / min for 1 h. After the reaction, it was centrifuged at 10000 rpm for 10 min, the supernatant was taken, and the free enzyme in the supernatant was detected by BCA. The formula was used to determine the values of Bmax (µMol / g) and Kd (µM).
[0133] The results are as Figure 10 shown. All enzymes had a relatively fast adsorption rate at low enzyme concentrations (below 5 µM). As the enzyme concentration increased, around 10 µM, the adsorption reached equilibrium, and the amount of enzyme bound to lignin no longer changed.
[0134] The results are shown in Table 9. The affinity of mutant CBHI-L+3-1 was lower than that of the wild type, but its binding ability increased, and the adsorption curve almost coincided with that of the wild type; the affinity of mutant CBHI-L+7 was lower than that of the wild type, and its binding ability also decreased, and the adsorption performance of this mutant for lignin was lower than that of the wild type; the affinity of mutant CBHI-L+8 was significantly lower than that of the wild type, and the binding ability also decreased significantly, and its adsorption ability was lower than that of the wild type; the affinity of mutant CBHI-L+11 was lower than that of the wild type, and the binding ability also decreased, and the adsorption performance was lower than that of the wild type; the affinity of mutant CBHI-L-5 was slightly higher than that of the wild type, but the binding ability increased significantly, and its adsorption performance for lignin was significantly improved.
[0135] Table 9 Affinity of CBHI and its mutants for lignin
[0136]
[0137] Example 6
[0138] 1. Effect of lignin on the activity and enzymatic hydrolysis efficiency of CBHI and its mutants
[0139] Referring to the specific enzyme activity detection method in Example 3, corncob enzymatically hydrolyzed lignin with a final concentration of 4 mg / mL was added to the reaction system. The reaction without lignin was used as a control, and the inactivated enzyme was used as a blank. The effects of corncob enzymatically hydrolyzed lignin on the specific enzyme activity of CBHI and its variants were detected using microcrystalline cellulose and filter paper as substrates respectively.
[0140] Referring to the enzymatic hydrolysis efficiency detection method in Example 3, corncob enzymatic lignin with a final concentration of 4 mg / mL was added to the reaction system. The reaction without lignin was used as a control, and the inactivated enzyme was used as a blank. The reactions were carried out on two substrates, microcrystalline cellulose and filter paper, for 12, 24, 48, and 72 h respectively. The release amount of reducing sugar before and after adding lignin was detected to investigate the effect of corncob enzymatic lignin on the enzymatic hydrolysis efficiency of CBHI and its variants.
[0141] ① Microcrystalline cellulose
[0142] The results are shown in Table 10. After adding lignin, the activities of all enzymes were inhibited to varying degrees, and the specific enzyme activities all decreased to varying degrees. Among them, the specific enzyme activity of the wild-type enzyme decreased to 73.5% of that without lignin. The mutant CBHI-L+3-1 was not significantly different from the wild-type. The specific enzyme activities of the mutants CBHI-L+7, CBHI-L+3-2, CBHI-L+8, and CBHI-L+11 were 82.2%, 90.4%, 87.8%, and 85.8% of that without lignin respectively, indicating that they were less inhibited by lignin than the wild-type. The specific enzyme activity of the mutant CBHI-L-5 decreased to 62.8% of that without lignin, and it was more severely inhibited by lignin than the wild-type.
[0143] Table 10 Specific enzyme activities of CBHI and its mutants on microcrystalline cellulose after adding lignin
[0144]
[0145] The results are as Figure 11 shown. After adding lignin, the release amount of reducing sugar after 72 h of enzymatic hydrolysis of all enzymes decreased to varying degrees. Among them, the release amount of reducing sugar of the wild-type CBHI after 72 h of enzymatic hydrolysis decreased to about 70% of that without lignin. The mutant CBHI-L+3-1 was not significantly different from the wild-type. The release amount of reducing sugar of the mutant CBHI-L+7 was about 77% of that without lignin, and its degree of inhibition was less than that of the wild-type. The release amounts of reducing sugar of the mutants CBHI-L+3-2, CBHI-L+8, and CBHI-L+11 were 85%, 82%, and 86% of that without lignin respectively, and their inhibition situations were significantly lower than that of the wild-type. The release amount of reducing sugar of the mutant CBHI-L-5 decreased to 68% of that without lignin, and its degree of inhibition by lignin was more severe than that of the wild-type.
[0146] ② Filter paper
[0147] The results are shown in Table 11. After adding lignin, the activities of all enzymes towards filter paper decreased to varying degrees. The specific enzyme activity of the wild-type enzyme decreased to about 75.4% of that without lignin, and the specific enzyme activities of mutants CBHI-L+7, CBHI-L+3-2, CBHI-L+8, and CBHI-L+11 were about 77.4%, 91%, 85.2%, and 84% of that without lignin, indicating that they were less inhibited by lignin than the wild-type; the specific enzyme activity of mutant CBHI-L+3-1 decreased to about 73% of that without lignin, showing little difference from the wild-type; the specific enzyme activity of mutant CBHI-L-5 decreased to 69.6% of that without lignin, and it was more severely inhibited by lignin than the wild-type.
[0148] Table 11 Specific Enzyme Activities of CBHI and Its Mutants towards Filter Paper after Adding Lignin
[0149]
[0150] The results are as Figure 12 shown. After adding lignin, the reducing sugar release of all enzymes decreased to varying degrees after 72 h of enzymatic hydrolysis. Among them, the reducing sugar release of wild-type CBHI after 72 h of enzymatic hydrolysis decreased to about 75% of that without lignin, and there was little difference between mutant CBHI-L+3-1 and the wild-type; the reducing sugar releases of mutants CBHI-L+7, CBHI-L+3-2, CBHI-L+8, and CBHI-L+11 decreased to about 82%, 88%, 88%, and 86% of that without lignin, respectively, and they were less inhibited by lignin than the wild-type; while the reducing sugar release of mutant CBHI-L-5 decreased to 71% of that without lignin, and it was more severely inhibited by lignin than the wild-type.
[0151] 2. Kinetics of the Synergistic Enzymatic Hydrolysis Process of CBHⅠ and Its Mutant Enzymes with Endoglucanase EG1 and β-Glucosidase towards Filter Paper after Adding Lignin
[0152] Referring to Example 4, 4 mg / mL lignin was added to the reaction system, and it was co-enzymatically hydrolyzed with endoglucanase EG1 and β-glucosidase for 4, 8, 12, 24, 48, and 72 h, respectively.
[0153] The results are as Figure 13As shown in the figure, after adding lignin, the amount of reducing sugar released by the mutant CBHI-L+8 co-enzyme hydrolysis is 1.51 times that of the wild type; CBHI-L+3-1 is 1.38 times that of the wild type; the inhibitory effect of CBHI-L+3-2 is relatively mild, but due to its poor synergistic ability with EG1 and β-glucosidase, the amount of reducing sugar released by the co-enzyme hydrolysis is still the lowest. The amount of reducing sugar released by CBHI-L+7 co-enzyme hydrolysis is 1.28 times that of the wild type; the inhibition of CBHI-L+11 by lignin is alleviated, and the amount of reducing sugar released by its co-enzyme hydrolysis is 1.19 times that of the wild type; CBHI-L-5 is severely inhibited by lignin, but its own co-enzyme hydrolysis ability is strong, so the amount of reducing sugar released after adding lignin is 1.14 times that of the wild type.
[0154] 3. Effect of Lignin on the Efficiency of CBHⅠ and Its Mutant Enzymes in Co-Hydrolyzing Filter Paper
[0155] Referring to Example 4, corncob enzymatic lignin with a final concentration of 4 mg / ml was added to the co-hydrolysis system and reacted for 24, 48, and 72 h respectively. At the same time, a co-reaction system without adding corncob enzymatic lignin was used as a control. After the reaction ended, the amount of reducing sugar in the supernatant was detected to analyze the effect of lignin on the efficiency of CBHⅠ and its mutant enzymes in co-hydrolyzing filter paper.
[0156] The results are as Figure 14 shown. After co-hydrolyzing for 24 h, the amount of reducing sugar released by CBHI was 38% of that without adding lignin; the amounts of reducing sugar released by CBHI-L+3-1, CBHI-L+3-2, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5 were 38%, 45%, 40%, 49%, 44%, and 34% of that without adding lignin respectively. After co-hydrolyzing for 48 h, the amount of reducing sugar released by CBHI was 33% of that without adding lignin; CBHI-L+3-1, CBHI-L+3-2, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5 were 33%, 40%, 37%, 48%, 40%, and 30% of that without adding lignin. After co-hydrolyzing for 72 h, the amount of reducing sugar released by CBHI was 36% of that without adding lignin; CBHI-L+3-1, CBHI-L+3-2, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5 were 34%, 40%, 39%, 48%, 44%, and 30% of that without adding lignin. The above results indicate that CBHI-L+3-2, CBHI-L+7, CBHI-L+8, and CBHI-L+11 have better lignin tolerance than the wild type.
[0157] The above description is illustrative rather than restrictive to the present invention. Those of ordinary skill in the art understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all of them will fall within the protection scope of the present invention.
Claims
1. A CBHI protein mutant, characterized in that: Only the connecting peptide of CBHI was modified to obtain CBHI protein mutants, whose names and corresponding amino acid sequences of the modified connecting peptides are as follows: CBH1-L+3-1:PPGGNPPGPPGTTTTRRPATTTGSSPGP, CBH1-L+3-2:PPGGNPPGTTSTTTTRRPATTTGSSPGP, CBH1-L+7:PPGGNPPGPPGNPPGTTTTRRPATTTGSSPGP, CBH1-L+8:PPGGNPPGTTTTRRPATTTGSSPTTSSGPPPGGP, CBH1-L+11:PPGGNPPGPPGTTTTRRPATTTGSSPTTSSGPPGGP, CBH1-L-5:PPGGNPPGTTATTTGSSPGP.
2. The method for preparing the CBHI protein mutant according to claim 1, characterized in that: The connecting peptide of the CBHI protein was modified by inserting PPG or TTS or PPGNPPG after the PPGGNPPG sequence of the connecting peptide, or inserting TTSSGPPG after the PPGGNPPGTTTTRRPATTTGSSP sequence of the connecting peptide, or inserting PPG after the PPGGNPPG sequence of the connecting peptide and inserting TTSSGPPG after the TTTTRRPATTTGSSP sequence, or truncating TTTRP in the connecting peptide.
3. The method for preparing a CBHI protein mutant according to claim 2, characterized in that: Here are the steps: 1) Extraction of Trichoderma reesei QM9414 genomic DNA and amplification of target genes; 2) Construction of constitutive promoter expression vector; 3) Construction of recombinant plasmid; 4) E. coli transformation and screening; 5) Transformation, screening and expression of Trichoderma reesei.
4. The method for preparing a CBHI protein mutant according to claim 3, characterized in that: The promoter used is promoter tef1; the constitutive promoter expression vector is M13-Ptef1-Tcbh1.
5. The method for preparing a CBHI protein mutant according to claim 3, characterized in that: The primer sequences (5'-3') used are as follows: cbh1-F4:GCTACATCACACAAACCGTCATGTATCGGAAGTTGGCCGT, cbh1-R2:CTTTCGCACGGAGCTCTCGAGTTAGTGGTGGTGATGATGATGCAGGCACTGAGAGTAGT, cbh1-F14: CCCGGCGGAAACCCGCCTGGCCCTCCCGGCACCACCACCCGCCGCCCA, cbh1-R12: TGGCGGCGGGTGGTGGTGGTGCCGGGAGGGCCAGGCGGGTTTCCGCCGG, cbh1-F19: GGCGGAAACCCGCCTGGCACCACTTCTACCACCACCACCCGCCGC, cbh1-R17: GCGGCGGGTGGTGGTGGTAGAAGTGGTGCCAGGCGGGTTTCCGCC, cbh1-F18: CCGCCTGGCCCTCCCGGCAACCCGCCTGGCACCACCACCACCCGCCGC, cbh1-R16: GCGGCGGGTGGTGGTGGTGCCAGGCGGGTTGCCGGGAGGGCCAGGCGG, cbh1-F12: AGCTCTCCCACTACCAGCTCTGGACCACCTGGCGGACCTACCCAGTCTCACTAC, cbh1-R11: GTAGTGAGACTGGGTAGGTCCGCCAGGTGGTCCAGAGCTGGTAGTGGGAGAGCT, cbh1-F13: CGCCGCCCAGCCACTACCACTGGAAGCTCTCCCACTACCAGCTCTGGACCACCTGGCGGACCTACCCAGTCTCACTAC, cbh1-R13:TCCAGTGGTAGTTGGGCGGCGGGTGGTGGTGGTGCCGGGAGGGCCAGGCGGGTTTCCGCCGG, cbh1-F5: GGAAACCCGCCTGGCACCACCGCCACTACCACTGGAAGCTCT, cbh1-R3: AGAGCTTCCAGTGGTAGTGGCGGTGGTGCCAGGCGGGTTT, tef1-F1:GCCTCGAGGGACAGAATGTAC, tef1-R2:TAGTCGACATCGATGACGGTTTGTGTGATGTAGCGTG.
6. The method for preparing a CBHI protein mutant according to claim 3, characterized in that: The amplification of each mutant gene is as follows: Amplification of mutant cbh1-1+3-1 gene: using cbh1 gene as template, using cbh1-1+3-1 downstream primer cbh1-R12 and cbh1 upstream primer cbh1-F4 to amplify the upper fragment of cbh1-1+3-1; using cbh1 gene as template, using cbh1-1+3-1 upstream primer cbh1-F14 and cbh1 downstream primer cbh1-R2 to amplify the lower fragment of cbh1-1+3-1; then using cbh1 upstream and downstream primers cbh1-F4 / cbh1-R2 to overlap the upper and lower fragments to obtain the full fragment of cbh1-1+3-1; Amplification of mutant cbh1-l+3-2 gene: Using cbh1 gene as template, using downstream primer cbh1-R17 of cbh1-l+3-2 and upstream primer cbh1-F4 of cbh1 to amplify the upper fragment of cbh1-l+3-2; using upstream primer cbh1-F19 of cbh1-L+3-2 and downstream primer cbh1-R2 of cbh1 to amplify the lower fragment of cbh1-L+3-2; then using upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to overlap the upper and lower fragments by PCR amplification to obtain the full fragment of cbh1-l+3-2; Amplification of mutant cbh1-l+7 gene: using cbh1 as template, using the downstream primer cbh1-R16 of the mutant cbh1-l+7 and the upstream primer cbh1-F4 of cbh1 to amplify the upper fragment of cbh1-l+7; using the upstream primer cbh1-F18 of cbh1-L+7 and the downstream primer cbh1-R2 of cbh1 to amplify the lower fragment of the mutant cbh1-l+7; then using the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to overlap the upper and lower fragments by PCR amplification to obtain the full fragment of the mutant cbh1-l+7; Amplification of mutant cbh1-l+8 gene: Using cbh1 as template, using cbh1-l+8 downstream primer cbh1-R11 and cbh1 upstream primer cbh1-F4 to amplify the upper fragment of cbh1-l+8; using cbh1-l+8 upstream primer cbh1-F12 and CBHⅠ downstream primer cbh1-R2 to amplify the lower fragment of cbh1-L+8; then using cbh1 upstream and downstream primers cbh1-F4 / cbh1-R2 to overlap the upper and lower fragments to obtain the full fragment of cbh1-l+8; Amplification of mutant cbh1-l+11 gene: using cbh1 as template, using the downstream primer cbh1-R13 of cbh1-l+11 and the upstream primer cbh1-F4 of cbh1 to amplify the upper fragment of cbh1-l+11; using the upstream primer cbh1-F13 of cbh1-l+11 and the downstream primer cbh1-R2 of cbh1 to amplify the lower fragment of cbh1-l+11; then using the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to overlap the upper and lower fragments by PCR amplification to obtain the full fragment of cbh1-l+11; Amplification of mutant cbh1-l-5 gene: Using cbh1 as template, the upper fragment of cbh1-l-5 was amplified using the downstream primer cbh1-R3 of cbh1-l-5 and the upstream primer cbh1-F4 of cbh1; the lower fragment of cbh1-l-5 was amplified using the upstream primer cbh1-F5 of cbh1-l-5 and the downstream primer cbh1-R2 of cbh1; and the upper and lower fragments were overlapped by PCR amplification using the upstream and downstream primers cbh1-F4 / cbh1-R2 of cbh1 to obtain the full fragment of cbh1-l-5.
7. Use of the CBHI protein mutant according to claim 1 in enzymatic hydrolysis of cellulose.
8. The use according to claim 7, characterized in that: The CBHI protein mutant is selected from CBHI-L+3-1, CBHI-L+7, CBHI-L+8, CBHI-L+11, and CBHI-L-5.
9. Use of the CBHI protein mutant according to claim 1 in synergistic hydrolysis of cellulose with endo-cellulase and β-glucosidase.
10. The use according to claim 9, characterized in that: The protein mutant is selected from CBHI-L+8, CBHI-L+7, CBHI-L+3-1, and CBHI-L+11.