Modified fusion protein and application thereof
By introducing ligation peptides of different lengths into heparinase I, MBP is linked to HepI, and a modified fusion protein is constructed, which solves the problem of poor thermal stability of heparinase I, significantly improves its thermal stability and activity, and enhances its value in industrial applications.
Patent Information
- Application Number
- CN202510368546.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2045-03-26
AI Technical Summary
The poor thermal stability of heparinase I limits its widespread use in industrial applications.
Modified fusion proteins are constructed to improve their thermal stability and activity by ligating maltose binding proteins (MBPs) with heparinase I (HepI) using ligation peptides of different lengths (such as GGGGS, (GGGGS)2, (GGGGS)3, etc.).
The thermal stability, activity and catalytic specificity constant of the modified fusion protein are significantly improved, and its application value in low molecular weight heparin production.
Smart Images

Figure BDA0005331443520000121 
Figure BDA0005331443520000122 
Figure BDA0005331443520000131
Abstract
Description
Technical Field
[0001] This application relates to the technical fields of genetic engineering and enzyme engineering, and specifically relates to a modified fusion protein and its application. Background Art
[0002] Heparin lyasesⅠ(HepⅠ, EC 4.2.2.7) is an important polysaccharide lyase that can catalyze the cleavage reaction of heparin. One of the most important uses of heparin lyasesⅠis the preparation of low molecular weight heparin, which is an important anticoagulant drug. In addition, heparin lyasesⅠalso has extensive scientific research and clinical application values, including analyzing the fine structure and biological functions of heparin polysaccharide molecules, being used for the quality control of heparin and low molecular weight heparin, and serving as a component of in vitro blood coagulation detection kits, etc. Given the important scientific research and clinical application values of heparin lyasesⅠ, researchers have studied its recombinant expression very early. Although heparin lyasesⅠhas achieved heterologous soluble expression and there are commercial products, it has not been applied on a large scale industrially. The key bottleneck lies in the poor thermal stability of heparin lyasesⅠ. Currently, the fusion enzyme of maltose binding protein (MBP) and heparin lyasesⅠlinked by a natural linker peptide has achieved efficient intracellular soluble expression in Escherichia coli, but its half-life at 30°C is only 10 min (Kuang Y, Xing XH, Chen Y, Ye F, Chen Y, Yan Y, et al. Production of heparin oligosaccharides by fusion protein of MBP–heparinaseI and the enzyme thermostability. J Mol Catal B Enzym. 2006;43:90–95.). To improve the thermal stability of heparin lyasesⅠ, Chen et al. increased the half-life of MBP-HepⅠat 30°C by 35% through site-directed mutagenesis, and by adding Ca during the enzyme production process 2+, further improving the stability of the fusion enzyme (Chen S, Huang Z, Wu J, Chen Y, Ye F, Zhang C, et al. Combination of site-directed mutagenesis and calcium ion addition for enhanced production of thermostable MBP-fused heparinase I in recombinant Escherichia coli. Appl Microbiol Biotechnol. 2013;97:2907–16.). However, their method of directly modifying the heparinase I site in the fusion enzyme has limited improvement in its thermal stability, and there is an urgent need to develop other technical means to enhance the thermal stability of the fusion heparinase.
[0003] Many research results have shown that linker peptides can affect the expression and catalytic properties of fusion enzymes. Lu et al. introduced different linker peptides into the fusion enzyme of β-glucanase (Glu) and xylanase (Xyl). They found that when (GGGGS)2 was used as the linker peptide, the catalytic efficiencies of Glu and Xyl in the fusion enzyme were increased by 326% and 43% respectively compared with the parental proteins; when (EAAAK)3 was used as the linker peptide, the increased ratios of catalytic efficiency were 262% and 31% respectively, and the thermal stability of Glu was improved compared with that before fusion (Lu P, Feng MG. Bifunctional enhancement of a beta-glucanase xylanase fusion enzyme by optimization of peptide linkers. Appl Microbiol Biotechnol. 2008;79:579–87.). After replacing the natural linker peptide encoded on the commercial pMAL-c2X plasmid with (GGGGS)5 and (EAAAK)5 in Patent CN 105753945 B, the half-life of MBP-fused heparinase I was increased from 10 min to about 35 min. These cases indicate that appropriate linker peptides are beneficial to the improvement of the target properties of fusion enzymes. Summary of the Invention
[0004] This application provides a linker peptide. The modified fusion protein formed by connecting MBP and heparinase I through this linker peptide can significantly improve thermal stability, activity, and catalytic specificity constant. The specific scheme is as follows:
[0005] 1. A modified fusion protein, the amino acid sequence of which is selected from one of the following:
[0006] SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15.
[0007] 2. A nucleic acid molecule encoding the fusion protein as described in item 1.
[0008] 3. A vector comprising the nucleic acid molecule as described in item 2.
[0009] 4. A genetically engineered bacterium comprising the vector as described in item 3.
[0010] 5. Use of the fusion protein as described in item 1 in the production of low molecular weight heparin.
[0011] 6. A method for producing low molecular weight heparin, comprising using the fusion protein as described in item 1 or using the nucleic acid molecule as described in item 2 or using the vector as described in item 3 or using the genetically engineered bacterium as described in item 4.
[0012] Advantageous effects:
[0013] In the present application, a modified fusion protein obtained by connecting maltose binding protein and heparinase I with linker peptides of different lengths improves the thermal stability, activity, and catalytic specificity constant of the maltose binding protein fused with heparinase I. The maltose binding protein fused with heparinase I with improved target characteristics can be applied to the production of low molecular weight heparin, greatly improving the industrial application value. At the same time, it can promote the industrial chain upgrade of heparin drugs, contribute to the development of the biopharmaceutical industry, and provide ideas for the application and development of other industrial enzyme systems. Description of the drawings
[0014] Figure 1-1 Shows the SDS-PAGE analysis diagram of MBP fused with heparinase I with linker peptides F1, F2, and F3 expressed by Escherichia coli TB1 in Example 1 of the present application. Among them, lane 1 is the crude enzyme solution of the fusion protein MBP-F1-HepI, lane 2 is the purified MBP-F1-HepI, lane 3 is the crude enzyme solution of the fusion protein MBP-F2-HepI, lane 4 is the purified MBP-F2-HepI, lane 5 is the crude enzyme solution of the fusion protein MBP-F3-HepI, lane 6 is the purified MBP-F3-HepI, lane M is the protein molecular weight standard, and the arrow indicates the position of the target fusion protein band;
[0015] Figure 1-2The SDS-PAGE analysis diagrams of MBP-fused heparinase I with the linker peptides F4, F5, and F6 expressed by Escherichia coli TB1 in Example 1 of the present application are shown. Among them, band 7 is the crude enzyme solution of the fusion protein MBP-F4-HepI, band 8 is the purified MBP-F4-HepI, band 9 is the crude enzyme solution of the fusion protein MBP-F5-HepI, band 10 is the purified MBP-F5-HepI, band 11 is the crude enzyme solution of the fusion protein MBP-F6-HepI, band 12 is the purified MBP-F6-HepI, band M is the protein molecular weight standard, and the arrow indicates the position of the target fusion protein band;
[0016] Figure 2 The specific activities of the modified fusion proteins with different linker peptides in Example 2 of the present application are shown;
[0017] Figure 3-1 The time curve diagrams of the residual activities of the modified fusion proteins with different linker peptides at 30 °C in Example 3 of the present application are shown;
[0018] Figure 3-2 The time curve diagrams of the residual activities of the modified fusion proteins with different linker peptides at 35 °C in Example 3 of the present application are shown. Detailed implementation manners
[0019] The present application will be further described below in conjunction with embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not used to limit the present application.
[0020] Unless otherwise defined, the technical and scientific terms in this specification have the same meanings as those commonly understood by those skilled in the art. Although methods and materials similar or identical to those described herein can be applied in experiments or practical applications, the materials and methods are still described below. In case of conflict, this specification including the definitions therein shall prevail. Additionally, the materials, methods, and examples are for illustrative purposes only and are not restrictive. The present application will be further described below in conjunction with specific embodiments, but not used to limit the scope of the present application.
[0021] In the present application, a linker peptide refers to a segment of amino acid sequence used to connect two or more target proteins or protein domains. Generally, the length of the linker peptide is 3 - 50 amino acids. The linker peptide can be used to connect two or more proteins, polypeptides, antibodies, etc. in different systems, and those skilled in the art can select an appropriate linker peptide according to the properties of the proteins, polypeptides, antibodies to be connected.
[0022] In the present application, the amino acid sequence of the linker peptide F1 is: GGGGS (SEQ ID NO: 1).
[0023] The amino acid sequence of linker peptide F2 is: (GGGGS)2 (SEQ ID NO:2).
[0024] The amino acid sequence of linker peptide F3 is: (GGGGS)3 (SEQ ID NO:3).
[0025] The amino acid sequence of linker peptide F4 is: (GGGGS)4 (SEQ ID NO:4).
[0026] The amino acid sequence of linker peptide F6 is: (GGGGS)6 (SEQ ID NO:5).
[0027] There is no particular restriction on the gene encoding the linker peptide, as long as the corresponding linker peptide sequence can be expressed through translation. For example, when the linker peptide is F1, its nucleotide sequence can be the nucleotide sequence shown in SEQ ID NO:6, and its nucleotide sequence is as follows:
[0028] GGTGGTGGCGGCAGC (SEQ ID NO:6).
[0029] When the linker peptide is F2, its nucleotide sequence can be the nucleotide sequence shown in SEQ ID NO:7, and its nucleotide sequence is as follows:
[0030] GGTGGTGGCGGCAGCGGTGGCGGCGGTAGC (SEQ ID NO:7).
[0031] When the linker peptide is F3, its nucleotide sequence can be the nucleotide sequence shown in SEQ ID NO:8, and its nucleotide sequence is as follows:
[0032] GGTGGTGGCGGCAGCGGTGGCGGCGGTAGCGGCGGTGGTGGAT CC (SEQ ID NO:8).
[0033] When the linker peptide is F4, its nucleotide sequence can be the nucleotide sequence shown in SEQ ID NO:9, and its nucleotide sequence is as follows:
[0034] GGTGGTGGCGGCAGCGGTGGCGGCGGTAGCGGCGGTGGTGGATC CGGTGGCGGTGGTTCT (SEQ IDNO:9)
[0035] When the linker peptide is F6, its nucleotide sequence can be the nucleotide sequence shown in SEQ ID NO:10, and its nucleotide sequence is as follows:
[0036] GGTGGTGGCGGCAGCGGTGGCGGCGGTAGCGGCGGTGGTGGAT CCGGTGGCGGTGGTTCTGGTGGTGGTGGCAGCGGTGGTGGCGGCAG C(SEQ ID NO:10).
[0037] The present application provides a fusion protein, which is selected from one of the following:
[0038] MBP-F1-HepI, MBP-F2-HepI, MBP-F3-HepI, MBP-F4-HepI, MBP-F6-HepI.
[0039] In the present application, when the fusion protein is MBP-F1-HepI, it has the amino acid sequence shown in SEQ ID NO:11.
[0040] SEQ ID NO:11:
[0041] MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTGGGGSQQKKSGNIPYRVNVQADSAKQSEIIDNKWVAVGINKPYALQYDDKLRFNGKPSYRFELKAEDNSLEGYAAGETKGRIELSYSYATTNDFKKFPPSVYQNAQKLKTVYHYGKGICEQGSSRSYTFSVYIPSSFPDNATTIFAQWHGAPSRTLVATPEGEIKTLSIEEFLALYDRMIFKKNIAHDKVEKKDKDGKITYVAGKPNGWKVEQGGYPPLAFGFSKGYFYIKANSDRQWLTDKADRNNANPENSEVMKPYSSEYKTSTIAYKMPFAQFPKDCWITFDVAIDWTKYGKEANTILKPGKLDVMMTYTKNKKPQKAHIVNQQEILIGRNDDDGYYFKFGIYRVGNSTVPVTYNLSGYSETAR
[0042] In the present application, when the fusion protein is MBP-F2-HepI, it has the amino acid sequence shown in SEQ ID NO:12.
[0043] SEQ ID NO:12:
[0044] MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTGGGGSGGGGSQQKKSGNIPYRVNVQADSAKQSEIIDNKWVAVGINKPYALQYDDKLRFNGKPSYRFELKAEDNSLEGYAAGETKGRIELSYSYATTNDFKKFPPSVYQNAQKLKTVYHYGKGICEQGSSRSYTFSVYIPSSFPDNATTIFAQWHGAPSRTLVATPEGEIKTLSIEEFLALYDRMIFKKNIAHDKVEKKDKDGKITYVAGKPNGWKVEQGGYPPLAFGFSKGYFYIKANSDRQWLTDKADRNNANPENSEVMKPYSSEYKTSTIAYKMPFAQFPKDCWITFDVAIDWTKYGKEANTILKPGKLDVMMTYTKNKKPQKAHIVNQQEILIGRNDDDGYYFKFGIYRVGNSTVPVTYNLSGYSETAR
[0045] In the present application, when the fusion protein is MBP-F3-HepI, it has the amino acid sequence shown in SEQ ID NO:13.
[0046] SEQ ID NO:13:
[0047] MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTGGGGSGGGGSGGGGSQQKKSGNIPYRVNVQADSAKQSEIIDNKWVAVGINKPYALQYDDKLRFNGKPSYRFELKAEDNSLEGYAAGETKGRIELSYSYATTNDFKKFPPSVYQNAQKLKTVYHYGKGICEQGSSRSYTFSVYIPSSFPDNATTIFAQWHGAPSRTLVATPEGEIKTLSIEEFLALYDRMIFKKNIAHDKVEKKDKDGKITYVAGKPNGWKVEQGGYPPLAFGFSKGYFYIKANSDRQWLTDKADRNNANPENSEVMKPYSSEYKTSTIAYKMPFAQFPKDCWITFDVAIDWTKYGKEANTILKPGKLDVMMTYTKNKKPQKAHIVNQQEILIGRNDDDGYYFKFGIYRVGNSTVPVTYNLSGYSETAR
[0048] In the present application, when the fusion protein is MBP-F4-HepI, it has the amino acid sequence shown in SEQ ID NO:14.
[0049] SEQ ID NO:14:
[0050] MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTGGGGSGGGGSGGGGSGGGGSQQKKSGNIPYRVNVQADSAKQSEIIDNKWVAVGINKPYALQYDDKLRFNGKPSYRFELKAEDNSLEGYAAGETKGRIELSYSYATTNDFKKFPPSVYQNAQKLKTVYHYGKGICEQGSSRSYTFSVYIPSSFPDNATTIFAQWHGAPSRTLVATPEGEIKTLSIEEFLALYDRMIFKKNIAHDKVEKKDKDGKITYVAGKPNGWKVEQGGYPPLAFGFSKGYFYIKANSDRQWLTDKADRNNANPENSEVMKPYSSEYKTSTIAYKMPFAQFPKDCWITFDVAIDWTKYGKEANTILKPGKLDVMMTYTKNKKPQKAHIVNQQEILIGRNDDDGYYFKFGIYRVGNSTVPVTYNLSGYSETAR
[0051] In the present application, when the fusion protein is MBP-F6-HepI, the amino acid sequence it has is as shown in SEQ ID NO:15.
[0052] SEQ ID NO:15:
[0053] MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTGGGGSGGGGSGGGGSGGGGSGGGGSGGGGSQQKKSGNIPYRVNVQADSAKQSEIIDNKWVAVGINKPYALQYDDKLRFNGKPSYRFELKAEDNSLEGYAAGETKGRIELSYSYATTNDFKKFPPSVYQNAQKLKTVYHYGKGICEQGSSRSYTFSVYIPSSFPDNATTIFAQWHGAPSRTLVATPEGEIKTLSIEEFLALYDRMIFKKNIAHDKVEKKDKDGKITYVAGKPNGWKVEQGGYPPLAFGFSKGYFYIKANSDRQWLTDKADRNNANPENSEVMKPYSSEYKTSTIAYKMPFAQFPKDCWITFDVAIDWTKYGKEANTILKPGKLDVMMTYTKNKKPQKAHIVNQQEILIGRNDDDGYYFKFGIYRVGNSTVPVTYNLSGYSETAR
[0054] This application provides a vector, which contains a nucleic acid molecule encoding the above-mentioned fusion protein.
[0055] This application places no restrictions on the vector, and a suitable vector can be selected according to needs. For example, the vector can be a plasmid.
[0056] This application provides a genetically engineered bacterium, which includes the above-mentioned vector.
[0057] For the genetically engineered bacteria, the present invention does not impose any restrictions, and those skilled in the art can determine according to needs. For example, the genetically engineered bacteria can be Escherichia coli.
[0058] The present application provides a method for constructing and expressing a fusion protein, which is to fuse a linker peptide with a target protein. The constructed fusion protein is a fusion protein obtained by connecting two target proteins (such as MBP and HepI) in a certain order through a linker peptide.
[0059] The method for constructing and expressing a fusion protein is well-known to those skilled in the art. For example, the following steps can be adopted:
[0060] The genes encoding the target proteins (such as MBP and HepI) are tandemly linked with the gene encoding the linker peptide to construct a fusion gene. The methods of linkage include: designing appropriate primers and obtaining the fusion gene by polymerase chain reaction (PCR); or directly synthesizing the required fusion gene by artificial synthesis. The above fusion gene is inserted into the multiple cloning site region of the expression vector to obtain an expression vector containing the fusion gene; the expression vector containing the fusion gene is transformed into a suitable host cell to obtain a transformed host cell; the transformed host cell is cultured, and the expression of the fusion protein is induced by a suitable method; the fusion protein is extracted and separated from the host cell.
[0061] Example 1 Construction of a modified fusion protein of maltose-binding protein (MBP) and heparinase (HepI)
[0062] The construction of the modified fusion protein provided by this application is achieved by artificially synthesizing the fusion protein gene. Among them, the fusion protein gene contains the nucleotide sequence encoding MBP, the nucleotide sequence encoding the linker peptide, and the nucleotide sequence encoding HepI. Among them, the nucleotide sequence encoding MBP is the same as the nucleotide sequence encoding MBP in MBP-R-HepA (Patent CN105753945B); the nucleotide sequence encoding HepI is the same as the nucleotide sequence encoding HepI in MBP-R-HepA (Patent CN105753945B); the nucleotide sequence encoding the linker peptide F1 is as shown in SEQ ID NO:6: GGTGGTGGCGGCAGC; the nucleotide sequence encoding the linker peptide F2 is as shown in SEQ ID NO:7: GGTGGTGGCGGCAGCGGTGGCGGCGGTAGC; the nucleotide sequence encoding the linker peptide F3 is as shown in SEQ ID NO:8: GGTGGTGGCGGCAGCGGTGGCGGCGGTAGCGGCGGTGGTGGATCC; the nucleotide sequence encoding the linker peptide F4 is as shown in SEQ ID NO:9: GGTGGTGGCGGCAGCGGTGGCGGCGGTAGCGGCGGTGGTGGATCCG GTGGCGGTGGTTCT; the nucleotide sequence encoding the linker peptide F6 is as shown in SEQ ID NO:10: GGTGGTGGCGGCAGCGGTGGCGGCGGTAGCGGCGGTGGTGGATCCG GTGGCGGTGGTTCTGGTGGTGGTGGCAGCGGTGGTGGCGGCAGC.
[0063] An NdeI restriction enzyme site is designed and added to the N-terminus of all fusion genes, and an EcoRI restriction enzyme site is designed and added to the C-terminus. After double digestion of the fusion gene with NdeI / EcoRI, it is ligated with the pMAL-c2X (New England Biolabs) vector that has also been double digested with NdeI / EcoRI, and plasmids pMAL-F1-HepI, pMAL-F2-HepI, pMAL-F3-HepI, pMAL-F4-HepI, and pMAL-F6-HepI are successfully constructed respectively, and the correctness of the plasmids is verified by restriction enzyme digestion and sequencing. The said plasmids are transformed into Escherichia coli strain TB1 to construct engineering bacteria TB1 / pMAL-F1-HepI, TB1 / pMAL-F2-HepI, TB1 / pMAL-F3-HepI, TB1 / pMAL-F4-HepI, and TB1 / pMAL-F6-HepI.
[0064] The genetically engineered bacteria were cultured using the following method: For the liquid culture of the genetically engineered bacteria, M9YGC medium was used, and its composition can be referred to the literature (Chen Y, Xing XH, Ye F, Kuang Y, Luo M. Production of MBP–HepA fusion protein in recombinant Escherichia coli by optimization of culture medium. Biochem Eng J. 2007;34:114–21.).
[0065] 100 μg·ml of ampicillin was added to the M9YGC medium, and the shaker speed was 170 rpm. Method for induced culture of genetically engineered bacteria: Inoculate single colonies from the solid plate into the M9YGC medium, pre-culture at 37 °C for 12 - 16 h, transfer the culture to fresh M9YGC medium at an inoculation amount of 1% (v / v), culture at 37 °C for about 3 h. When the cell concentration OD -1 reaches 1.0, add IPTG with a final concentration of 0.24 mM for induction, and transfer to a 15 °C air bath shaker to continue culturing for 24 h. After the culture is completed, centrifuge at 10000×g for 5 min at 4 °C, collect the cells and wash them three times with 20 mM Tris-HCl buffer (pH 7.4) containing 200 mM NaCl. Finally, resuspend the cells with 20 mM Tris-HCl buffer (pH 7.4) containing 200 mM NaCl. Ultrasonically disrupt the obtained resuspended solution at low temperature, centrifuge at 15000×g for 30 min at 4 °C to collect the supernatant to obtain the crude enzyme solution. Perform affinity purification at 4 °C using an AKTA pure25 protein purification system (Cytiva). Equilibrate the MBPTrap HP column (5 mL; Cytiva) with 25 mL of binding buffer (20 mM Tris-HCl buffer, 200 mM NaCl, pH 7.4), load the protein supernatant onto the MBPTrap HP column, and then wash the column with 50 mL of binding buffer. Elute the fusion protein with 25 mL of elution buffer (10 mM maltose, 20 mM Tris-HCl buffer, 200 mM NaCl, pH 7.4). Collect the active peak part for further analysis. Identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ( 600 and Figure 1-1 and Figure 1-2 ), the crude enzyme solution contains the target fusion protein, and good purification effect can be achieved through affinity purification. Further identification shows that the obtained fusion proteins MBP-F1-HepI, MBP-F2-HepI, MBP-F3-HepI, MBP-F4-HepI, and MBP-F6-HepI all have the activity of heparinase I.
[0066] Example 2 Activity Analysis of the Modified Fusion Protein
[0067] By the method of Example 1 of the present application, the modified fusion proteins MBP-F1-HepI, MBP-F2-HepI, MBP-F3-HepI, MBP-F4-HepI and MBP-F6-HepI were constructed and expressed, and the fusion proteins were purified by affinity purification. The fusion protein MBP-F5-HepI containing the linker peptide F5: (GGGGS)5 was used as a control and was expressed and purified together. In order to investigate the intrinsic changes in the activities of these six fusion proteins with different linker peptide lengths, their heparinase activities were measured.
[0068] The method for detecting the heparinase activity of the modified fusion protein is as follows: The reaction system is 1 mL, including 5 g / L heparin, 20 mM Tris-HCl buffer (pH 7.0), 3.5 mM CaCl2 and 50 mM NaCl. After adding an appropriate amount of enzyme solution, the mixture was quickly mixed evenly to initiate the reaction. The temperature was 30 °C, and the change in absorbance at 232 nm within 1 min was measured using a spectrophotometer. Heparin has no absorption at 232 nm, while the extinction coefficient of the unsaturated uronic acid produced by the cleavage of heparin by heparinase at 232 nm is ε 232 = 3.8 mM -1 cm -1 . The activity of 1 U of heparinase is defined as the amount of enzyme required to cleave 1 μmol of unsaturated uronic acid per minute.
[0069] The protein concentration was determined according to the standard method of Bradford using bovine serum albumin (BSA) as the standard protein. In order to calculate the specific activity of the fusion protein, the fusion protein was subjected to gel density scanning to estimate the proportion of the target protein in the total protein.
[0070] The activity of the fusion heparinase I with the linker peptide F5: (GGGGS)5 was set as 100% (21.3 U / mg), and the relative values of the specific activities of the six fusion proteins are as Figure 2 shown.
[0071] It can be seen that when the linker peptide is F6, the specific activity of the fusion protein is 38.0 U / mg, which is higher than that of the fusion protein with the linker peptide F5 and is 1.8 times that of it; when the linker peptide is F1, the specific activity of the fusion protein is the highest, which is 2.4 times that of the fusion protein with the linker peptide F5; the specific activities of the fusion proteins with the linker peptides F2 and F3 are 2 times and 1.6 times that of the fusion protein with the linker peptide F5, respectively. The specific activity of the fusion protein with the linker peptide F4 is lower than that of the fusion protein with the linker peptide F5 and is 78% of it.
[0072] In summary, the application of the linker peptide F6 results in a significant increase in the specific activity of the modified fusion protein compared to the fusion protein with the corresponding linker peptide F5. In addition, it also shows a significant increase compared to the specific activity (15.4 U / mg) of MBP-HepI containing the original linker peptide NSSSNNNNNNNNNNLGIEGRISEFGS in the prior art.
[0073] Example 3 Thermal stability analysis of the modified fusion protein
[0074] Adjust the concentration of all modified fusion proteins to 0.6 mg / mL with 20 mM Tris-HCl (pH 7.4) containing 200 mM NaCl, incubate them at 30 °C and 35 °C respectively, and take samples at appropriate time intervals for the analysis of residual activity. The results are shown in Figure 3-1 and Figure 3-2 As can be seen from the figure, whether at 30 °C or 35 °C, the modified fusion protein MBP-F6-HepI with the linker peptide F6 shows significantly superior thermal stability compared to other fusion proteins.
[0075] According to the time curve of the residual activity of the fusion protein, the half-lives of different fusion proteins at 30 °C and 35 °C are calculated, and the results are shown in Table 1.
[0076] Table 1 Half-lives of fusion heparinases with different linker peptides at 30 °C and 35 °C
[0077]
[0078] Combined with Table 1 and Figure 3-1 、 Figure 3-2 It can be seen that the thermal stability of MBP-F2-HepI is slightly improved compared to MBP-F5-HepI, while the thermal stabilities of MBP-F3-HepI and MBP-F4-HepI are close to that of MBP-F5-HepI, without significant improvement.
[0079] The half-life of the modified fusion protein MBP-F6-HepI at 30 °C is 69 min, which is 1.6 times that of MBP-F5-HepI at 30 °C. The half-life of MBP-F6-HepI at 35 °C is 13 min, which is 2.2 times that of MBP-F5-HepI at 35 °C. This shows that the thermal stability of MBP-F6-HepI is significantly improved compared to MBP-F5-HepI.
[0080] In addition, the half-life of the modified protein MBP-F6-HepI at 30 °C is 6.3 times that of MBP-HepI containing the original linker peptide in the prior art (11 min), and the thermal stability of MBP-F6-HepI is significantly improved.
[0081] Example 4 Determination of kinetic parameters of modified fusion proteins
[0082] To determine the kinetic parameters of the modified fusion proteins, the concentration of heparin was changed in the range of 0 - 500 μM, and the initial rate of heparin cleavage was measured. The initial reaction rate was fitted to the Michaelis equation curve to calculate the kinetic parameters of the modified fusion proteins, and the results are shown in Table 2.
[0083] Table 2 Kinetic parameters of fusion heparinases with different linker peptides
[0084]
[0085]
[0086] Note: The values in parentheses in the table are the ratios of the parameter values of the fusion protein to the corresponding parameter values of the MBP fusion heparinase with linker peptide F5 (MBP-F5-HepI).
[0087] As can be seen from Table 2, the kinetic analysis of the fusion proteins shows that the catalytic constant k cat value of MBP-F1-HepI is 2.51 times that of MBP-F5-HepI, and the catalytic specificity constant k cat / K m value is 2.22 times that of MBP-F5-HepI, and the catalytic efficiency is significantly improved.
[0088] The K m values of MBP-F2-HepI and MBP-F3-HepI are slightly lower than the K m value of MBP-F5-HepI, indicating a slightly increased affinity for the substrate. The catalytic specificity constants k cat / K m values of MBP-F2-HepI and MBP-F3-HepI are 2.05 and 1.64 times that of MBP-F5-HepI respectively, and the catalytic efficiency is significantly improved.
[0089] The K m value of MBP-F6-HepI is lower than the K m value of MBP-F5-HepI, indicating an increased affinity for the substrate. In addition, its catalytic specificity constant k cat / K m value is 1.89 times that of MBP-F5-HepI, and its catalytic efficiency is significantly improved.
[0090] In summary, for maltose-binding protein (MBP) and heparinase I (HepI), compared with the fusion protein MBP-F5-HepI with the linker peptide F5, the modified fusion proteins constructed by the linker peptides F1, F2, F3, F4, and F6 provided in this application are as follows:
[0091] The activity and catalytic efficiency of MBP-F1-HepI are significantly improved. Its activity is 2.4 times that of MBP-F5-HepI; its catalytic efficiency is 2.22 times that of MBP-F5-HepI.
[0092] The activity, thermal stability, and catalytic efficiency of MBP-F2-HepI are all improved. Among them, the activity of MBP-F2-HepI is 2 times that of MBP-F5-HepI. The half-life of MBP-F2-HepI is slightly higher than that of MBP-F5-HepI. The affinity of MBP-F2-HepI for the substrate increases slightly, and the catalytic efficiency is 2.05 times that of MBP-F5-HepI.
[0093] The activity and catalytic efficiency of MBP-F3-HepI are both improved. Among them, the activity of MBP-F3-HepI is 1.6 times that of MBP-F5-HepI. The affinity of MBP-F3-HepI for the substrate increases slightly, and the catalytic efficiency is 1.64 times that of MBP-F5-HepI.
[0094] The affinity of MBP-F4-HepI for the substrate increases, the catalytic efficiency is close to that of MBP-F5-HepI, the thermal stability is similar to that of MBP-F5-HepI, but the activity decreases.
[0095] The activity, thermal stability, and catalytic efficiency of MBP-F6-HepI are all improved. Among them, the activity of MBP-F6-HepI is 1.8 times that of MBP-F5-HepI. The half-life of MBP-F6-HepI is significantly higher than that of MBP-F5-HepI, and is 1.6 times and 2.2 times that of MBP-F5-HepI at 30 °C and 35 °C respectively. The affinity of MBP-F6-HepI for the substrate increases, and the catalytic efficiency is 1.89 times that of MBP-F5-HepI.
[0096] The above are only the preferred embodiments of this application, and it is not a limitation of this application in other forms. Any person skilled in the art may use the technical content disclosed above to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of this application without departing from the technical solution content of this application still belong to the protection scope of the technical solution of this application.
Claims
1. A modified fusion protein, whose amino acid sequence is selected from one of the following: SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:
15.
2. A nucleic acid molecule encoding the fusion protein according to claim 1. A vector comprising the nucleic acid molecule according to claim 2 . A genetically engineered bacterium comprising the vector according to claim 3 .
5. Use of the fusion protein according to claim 1 in the production of low molecular weight heparin.
6. A method for producing low molecular weight heparin, comprising using the fusion protein as claimed in claim 1, or using the nucleic acid molecule as claimed in claim 2, or using the vector as claimed in claim 3, or using the genetically engineered bacteria as claimed in claim 4.
Citation Information
Patent Citations
A linker peptide and its applications
CN105753945B
Fusion heparinase and coding gene thereof
CN101608179A
Heparinase I fusion protein
CN103160487A
Bacteroides edulis heparinase I fusion protein as well as coding gene and preparation method thereof
CN115975040A