Construction method of CiYMaV CRP mutant infectious clone

Abstract

The invention discloses a construction method of CiYMaV CRP mutant infectious clone. A CiYMaV infectious clone vector is prepared by inserting a CiYMaV complete sequence into the downstream of a 2 * 35S promoter of a vector pCASS4-RZ; the mutant is obtained by carrying out alanine site-directed mutation or deletion mutation on a CRP (C-reactive protein) region on a CiYMaV infectious cloning vector through overlap extension PCR (polymerase chain reaction), and the site-directed mutation or deletion mutation is obtained on the basis of CiYMaV strong pathogenicity infectious cloning pCiYMaV. According to the invention, a vector pCASS4-RZ is used as a vector skeleton to construct an infectious clone containing strong pathogenicity of CiYMaV, and a series of CRP mutant infectious clone which is coded by viruses and has different pathogenicity and pathogenic expressions are constructed at the same time; virus inoculation experiments show that the CRP protein affects virus accumulation and symptom formation, and a foundation is laid for research on pathogenic mechanisms, virus gene functions and low virulent line cross protection of citrus yellow mottle related viruses and subsequent Mandarivirus virus research.

Description

Technical Field

[0001] The present invention relates to the technical field of viral proteins, and in particular, to a method for constructing an infectious clone of the CiYMaV CRP mutant. Background Art

[0002] Citrus is an economically important fruit tree widely cultivated worldwide. However, during its perennial cultivation, it is susceptible to viral diseases. Viruses of the genus Mandarivirus are positive-sense single-stranded RNA viruses that pose a serious threat to the citrus industry. They can infect most citrus varieties and hybrids. Due to their diverse transmission methods and severe damage, they have become the key points and difficulties in the prevention and control of citrus viral diseases in recent years. The genus Mandarivirus belongs to the genus Potexvirus of the family Alphaflexiviridae, and currently includes three identified species: Citrus yellow vein clearing virus (CYVCV), Citrus yellow mottle-associated virus (CiYMaV), and Indian citrus ringspot virus. Citrus yellow mottle disease is a systemic infectious disease of citrus caused by Citrus yellow mottle-associated virus (CiYMaV), which was initially discovered during the field investigation of citrus viral diseases in Pakistan from 2010 to 2018.

[0003] After infecting Citrus grandis, C. reticulata × C. sinensis, C. sinensis, and Citrus sinensis cv. Washington, CiYMaV causes varying degrees of yellow mottle symptoms, especially the most severe and persistent symptoms on Citrus grandis. However, C. aurantifolia, C. limon, C. aurantium, and C. aurantium var. daidai do not show viral disease symptoms after being infected with CiYMaV.

[0004] CiYMaV has a single-stranded RNA genome of 7,479 nucleotides, with six open reading frames (ORFs). ORF6 partially overlaps with ORF5 and encodes a cysteine-rich protein (CRP) with a molecular weight of approximately 24.5 kDa and a zinc finger-like (ZF) motif. This protein is one of the important characteristics that distinguish Mandarivirus from other viruses in the same genus (Potexvirus). Currently, there is no report on the function and molecular mechanism of the CRP protein of Mandarivirus viruses during virus infection.

[0005] In view of this, the present application is specifically proposed. Summary of the Invention

[0006] The present invention provides a method for constructing a full-length infectious clone of CiYMaV and its CRP mutants to study the pathogenic mechanism of citrus yellow mosaic-associated virus. An infectious clone containing the highly pathogenic CiYMaV was constructed using the vector pCASS4-RZ as the vector backbone, and a series of infectious clones of CRP mutants with different pathogenicities and pathogenic manifestations encoded by the virus were also constructed. Virus inoculation experiments showed that the CRP protein affects virus accumulation and symptom formation. The present invention lays a foundation for studying the pathogenic mechanism of citrus yellow mosaic-associated virus, the function of virus genes, cross-protection by mild strains, and subsequent research on Mandarivirus viruses.

[0007] The present invention is achieved through the following technical solutions:

[0008] In the first aspect, the present invention provides a full-length infectious clone vector of CiYMaV, which is prepared by inserting the full sequence of citrus yellow mosaic-associated virus CiYMaV downstream of the 2×35S promoter of the vector pCASS4-RZ, and is named pCiYMaV.

[0009] In the second aspect, the present invention provides a method for constructing an infectious clone of CiYMaV, including the following steps:

[0010] (1) Obtain the reference sequence of the CiYMaV virus genome;

[0011] (2) Design primers to amplify the full-length cDNA sequence of citrus yellow mosaic-associated virus CiYMaV;

[0012] (3) The pCASS4-RZ vector was linearized using Stu I and BamH I restriction endonucleases, and then the full-length cDNA sequence of CiYMaV was inserted downstream of the 2×35S promoter of pCASS4-RZ through T4 DNA ligase to obtain the recombinant vector pCiYMaV;

[0013] (4) The recombinant vector pCiYMaV was transferred into Escherichia coli to construct an infectious clone of CiYMaV.

[0014] In a specific embodiment, the amplification primers in step (2) are CiYMaV-FL-F and CiYMaV-FL-R, and their nucleotide sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0015] In a specific embodiment, in step (2), the PCR amplification system is: 10 μL of 5×Q5 Reaction Buffer, 0.5 μL of DNA Polymerase, 1.25 μL of each of the upstream and downstream primers at 10 μM, 1 μL of 10 mM dNTPs, 2 μL of cDNA template, 10 μL of 5×Q5 High GC Enhancer, 24 μL of ddH2O, and the total reaction system is 50 μL; the reaction conditions for each fragment are: 98 °C for 2 min; 98 °C for 10 s, 55 °C for 15 s, 72 °C for 2 min, 35 cycles; 72 °C for 5 min.

[0016] In a third aspect, the present invention provides a CiYMaV mutant, which is obtained by site-directed alanine mutagenesis or deletion mutagenesis of the CRP region by overlap extension PCR on the CiYMaV infectious clone vector. The site-directed mutagenesis or deletion mutagenesis is obtained based on the highly virulent infectious clone pCiYMaV of CiYMaV, and the infectious clone pCiYMaV is obtained by inserting the sequence of CiYMaV into the vector pCASS4-RZ.

[0017] In a specific embodiment, the deletion mutagenesis of the CRP region refers to deleting the C-terminal partial sequence of the CRP protein, specifically deleting nt 7,079 - 7,443 to obtain the mutant virus pCiYMaV ΔCRP

[0018] In a specific embodiment, the site-directed alanine mutagenesis of the CRP region refers to introducing a stop codon by synonymous mutagenesis after the start codon of the CRP protein to obtain the mutant virus pCiYMaV mCRP .

[0019] In a specific embodiment, the site-directed alanine mutagenesis of the CRP region refers to the site-directed alanine mutagenesis of the zinc finger structure of the CRP protein to obtain the mutant virus pCiYMaV mCRP ZF 。

[0020] In a specific embodiment, the site-directed alanine mutagenesis of the CRP region refers to the site-directed alanine mutagenesis of the nuclear localization signal of the CRP protein to obtain the mutant virus pCiYMaV mCRP NLS 。

[0021] Fourthly, the present invention provides a method for constructing a CiYMaV mutant, comprising the following steps:

[0022] (1) Digesting the pCiYMaV plasmid with Sal I and BamH I enzymes;

[0023] (2) PCR amplifying the sequence fragments required for mutant construction;

[0024] (3) Recombinantly ligating the PCR product sequence fragments with the pCiYMaV digested product to obtain the CRP mutant virus recombinant plasmid.

[0025] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0026] 1. An infectious clone vector of CiYMaV, a mutant thereof and a construction method thereof provided by an embodiment of the present invention utilize the plant binary expression vector pCASS4-RZ as a vector backbone to construct an infectious clone pCiYMaV containing the strong pathogenicity of CiYMaV, which can be used for subsequent research on the pathogenic mechanism of citrus yellow mottle-related viruses;

[0027] 2. An infectious clone vector of CiYMaV, a mutant thereof and a construction method thereof provided by an embodiment of the present invention utilize the infectious clone with the strong pathogenicity of pCiYMaV to construct multiple CRP protein infectious clone mutants with different pathogenicities and pathogenic manifestations, proving that the CRP protein affects virus accumulation and symptom formation, providing a strong basis for virus gene function, cross-protection of attenuated strains and subsequent research on Mandarivirus viruses;

[0028] 3. An infectious clone vector of CiYMaV, a mutant thereof and a construction method thereof provided by an embodiment of the present invention, the constructed pCiYMaV ΔCRP mutant virus has no infectious activity, while the constructed pCiYMaV mCRP 、pCiYMaV mCRP ZF and pCiYMaV mCRPNLS After infecting 'Chandler' pummelo with the three mutant viruses, no leaf symptoms were caused, but the infected plants still showed dwarfing symptoms, and the virus accumulation levels of the CRP mutants in the host were significantly lower than those of the wild-type virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0030] Figure 1 Schematic diagram of the construction of the full-length cDNA clone of CiYMaV provided by the embodiment of the present invention;

[0031] Figure 2 Infectivity analysis of the full-length cDNA clone of CiYMaV provided by the embodiment of the present invention; (A, B) Symptoms of 'Chandler' pummelo inoculated with pCiYMaV (FL-1, 18, and 22) for 40 days; (C) Western blot detection of the accumulation level of the viral coat protein in 'Chandler' pummelo after inoculation with pCiYMaV, and Coomassie Brilliant Blue staining was used as the loading control; (D) Northern blot detection of the accumulation level of genomic RNA (CP) in 'Chandler' pummelo after inoculation with pCiYMaV, and methylene blue staining was used as the control; (E) Transmission electron microscopy observation of the morphology of pCiYMaV-FL-22 virus particles; HC, healthy control; EV, empty vector control; WT, CiYMaV positive control;

[0032] Figure 3 Symptoms of 'Chandler' pummelo inoculated with pCiYMaV-FL-22 for 180 days and 360 days provided by the embodiment of the present invention; HC, healthy control; EV, empty vector control; WT, CiYMaV positive control;

[0033] Figure 4 Symptoms of pCiYMaV-FL-22 on different citrus varieties provided by the embodiment of the present invention (A, G) Eureka lemon; (B, H) Carter Valencia orange; (C, I) Jincheng orange; (D, J) Wogan; (E, K) Zaoxiang pomelo; (F) 'Chandler' pummelo as the positive control; HC, healthy control; EV, empty vector control; WT, CiYMaV positive control;

[0034] Figure 5 Amino acid sequence alignment (A) and phylogenetic analysis (B) of the CRP protein of Mandarivirus provided by the embodiment of the present invention;

[0035] Figure 6 Schematic diagram for constructing the CiYMaV CRP mutant virus provided by the embodiment of the present invention;

[0036] Figure 7 pCiYMaV provided by the embodiment of the present invention mCRP Analysis of the infectivity of the mutant virus; (A, B) Symptoms observation after inoculating 'Chandler' pummelo with pCiYMaV mCRP The photos were taken at 50 d (left side of A) and 330 d (right side of A and B) after inoculation; (C) Plant height statistics of 'Chandler' pummelo inoculated with pCiYMaV mCRP Different letters on the error bars indicate significant differences between treatments (one-way ANOVA analysis, LSD multiple comparison test, P<0.05); (D) Detection of the accumulation level of the viral coat protein in 'Chandler' pummelo after inoculation with pCiYMaV by Western blot, with Coomassie Brilliant Blue (CBB) staining as a control; mCRP

[0037] Figure 8 pCiYMaV provided by the embodiment of the present invention mCRP ZF and pCiYMaV mCRP NLS Analysis of the infectivity of the mutant virus; (A) Symptoms observation after inoculating 'Chandler' pummelo with the CiYMaV CRP mutant; (B) RT-qPCR detection of the relative expression level of CiYMaV mRNA in 'Chandler' pummelo inoculated with CiYMaV, pCiYMaV mCRP ZF and pCiYMaV mCRP NLS '****' indicates significant differences between different treatments (two-way ANOVA analysis, Dunnett multiple comparison test, P<0.0001); (C) Detection of the accumulation level of the viral coat protein in 'Chandler' pummelo after inoculation with the CiYMaV CRP mutant by Western blot, with Coomassie Brilliant Blue (CBB) staining as a control. Detailed implementation manners

[0038] To make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below with reference to the embodiments and the accompanying drawings. The illustrative embodiments of the present invention and their descriptions are only used to explain the present invention and do not limit the present invention.

[0039] ​In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. However, it will be apparent to those of ordinary skill in the art that the present invention may be practiced without these specific details. In other instances, well-known structures, materials, or methods have not been specifically described to avoid obscuring the understanding of the present invention.

[0040] Throughout the specification, the mention of "an embodiment", "embodiment", "an example" or "example" means that the specific features, structures, or characteristics described in connection with that embodiment or example are included in at least one embodiment of the present invention. Thus, the phrases "an embodiment", "embodiment", "an example" or "example" appearing throughout the specification do not necessarily all refer to the same embodiment or example. In addition, the specific features, structures, or characteristics may be combined in any suitable combination and / or sub-combination in one or more embodiments or examples. In addition, those of ordinary skill in the art should understand that the drawings provided herein are for illustrative purposes only and are not necessarily drawn to scale. The term "and / or" used herein includes any and all combinations of one or more of the associated listed items.

[0041] In the description of the present invention, the orientation or positional relationship indicated by the terms "front", "rear", "left", "right", "upper", "lower", "vertical", "horizontal", "high", "low", "inner", "outer", etc. is based on the orientation or positional relationship shown in the drawings, and is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and thus should not be construed as limiting the protection scope of the present invention.

[0042] Example 1

[0043] Construction of an Infectious Clone of Citrus Yellow Mottle-associated Virus CiYMaV

[0044] 1. Cloning of CiYMaV Gene

[0045] Total plant RNA was extracted by the Trizol method, and RNA reverse transcription experiments were performed using the PrimeScrip tT MRT reagent Kit with gDNA Eraser (Takara). The specific operation steps are as follows:

[0046] 1) Removal of genomic DNA

[0047] Reaction system: 1 μL OligodT Primer, 1 μL dNTP Mixture, 2 μL Total RNA, 6 μL RNase-free ddH2O; after mixing the system, react at 65 °C for 5 min and quickly place on ice.

[0048] 2) Reverse transcription of RNA to synthesize cDNA

[0049] Add 4 μL of 5×PrimeScriptⅡ Buffer, 1 μL of PrimeScriptⅡ RTase, 0.5 μL of RNase Inhibitor, and 4.5 μL of RNase-free ddH2O to step 1) in sequence. After mixing the system, react at 42 °C for 60 min and at 95 °C for 5 min. Store the cDNA product at -20 °C for long term.

[0050] 3) Amplification of the full-length cDNA sequence

[0051] Refer to the whole genome sequence information of the reference genome CiYMaV-PK (GenBank accession number MK957246) to design primers CiYMaV-FL-F and CiYMaV-FL-R (SEQ ID NO: 1 and SEQ ID NO: 2), and amplify the full-length sequence of CiYMaV using Q5-Hot Start High-Fidelity DNA Polymerase (NEB, Beijing, China) in a 50 μL reaction system. Separate the PCR products by 1.5% gel electrophoresis and purify them using a gel extraction kit (Omega Bio-Tek, Norcross, GA, USA).

[0052] The amplification system is: 10 μL of 5×Q5 Reaction Buffer, 0.5 μL of DNA Polymerase, 1.25 μL each of the upstream and downstream primers at 10 μM, 1 μL of 10 mM dNTPs, 2 μL of cDNA template, 10 μL of 5×Q5 High GC Enhancer, 24 μL of ddH2O, and the total reaction system is 50 μL.

[0053] The reaction conditions are: 98 °C for 2 min; 98 °C for 10 s, 55 °C for 15 s, 72 °C for 2 min, 35 cycles; 72 °C for 5 min.

[0054] SEQ ID NO: 1

[0055] 5′-GAAGGCCTGAAAAGCAAACATACCCAACCACA-3′

[0056] SEQ ID NO: 2

[0057] 5′-CGCGGATCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGAAAATGGAAACTGAA AGCCTG-3′

[0058] 2. Construction of Infectious Clone Vector of CiYMaV

[0059] Digest the amplified product of full-length CiYMaV with StuI and BamHI, and then insert it downstream of the 2×35S promoter of the binary vector pCass4-Rz digested with the same enzymes using T4 DNA ligase (Promega, Madison, WI, USA) (as Figure 1 shown) to obtain the recombinant vector pCiYMaV.

[0060] 3. Transformation of Escherichia coli with Infectious Clone of CiYMaV

[0061] Transform the recombinant vector pCiYMaV into Escherichia coli strain DH5α (TransGen, Beijing, China). The specific steps are as follows:

[0062] 1) Quickly take out the DH5α competent cells from the -80°C refrigerator, thaw them in an ice-water bath (about 5 min), aliquot 50 μL of the competent cells into a sterilized 1.5 mL centrifuge tube, and then add 5 μL of the ligation product to the competent cells. Gently pipette to mix well and let it stand on ice for 30 min;

[0063] 2) Heat shock at 42°C for 45 s, and then quickly transfer it to ice and let it stand for 2 min;

[0064] 3) In a laminar flow hood, add 700 μL of antibiotic-free LB liquid medium to the centrifuge tube, and then place it in a shaker at 37°C and resuscitate at 200 rpm for 1 h;

[0065] 4) Centrifuge at 5000 rpm for 3 min, aspirate 600 μL of the supernatant, gently pipette to resuspend the remaining bacterial liquid with a pipette tip, and then evenly spread it on the LB medium plate with the corresponding resistance (the pGEM-T Easy vector can be screened by blue-white screening. See Appendix II for the plate formula). After the plate is dried, seal it with a sealing film and invert it in a constant temperature incubator at 37°C for about 14 - 16 h;

[0066] 5) After single colonies grow, pick a single clone into a sterilized 1.5 mL centrifuge tube with a sterilized white pipette tip, add the LB liquid medium with the corresponding resistance to the centrifuge tube, and then place it on a shaker at 37°C and culture at 200 rpm for 2 - 3 h to obtain positive bacterial liquid and perform PCR verification;

[0067] 6) Amplify the positive bacterial liquid in large quantities, and then extract the plasmid using the plasmid mini-prep kit from Tiangen Biochemical and store it at -20°C for later use.

[0068] Among them, for PCR verification, the turbid monoclonal bacterial solution was used as a template, and PCR amplification was carried out using 2×Taq MasterMix from Novoprotein. Taking the CiYMaV-CP sequence as the reference sequence, the sequencing primers were CiYMaV-CP-F and CiYMaV-CP-R (SEQ ID NO: 3 and SEQ ID NO: 4).

[0069] SEQ ID NO: 3

[0070] 5′-ATGAGCTTAGACTATCAGCATCCC-3′

[0071] SEQ ID NO: 4

[0072] 5′-CTAGGTGGCAAAAGGGGTCTTGC-3′

[0073] PCR reaction system: 5 μL of 2×Taq Master MIX, 0.3 μL of each of the upstream and downstream primers at 10 μM, 1 μL of bacterial solution, 3.4 μL of ddH2O.

[0074] PCR running program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for X min (1 kb / min), 35 cycles; extension at 72°C for 10 min; temporarily stored at 4°C.

[0075] After the PCR reaction ended, the amplification products were detected by 1.2% agarose gel electrophoresis, and then the colonies that could amplify the target band size were selected for sequencing verification. The sequencing results were analyzed by sequence alignment using CLC Sequence Viewer 11.0.

[0076] After sequencing verification, a total of 3 full-length cDNA clones of CiYMaV (pCiYMaV-FL-1, 18, and 22) were obtained in the present invention. Their whole genomes were all composed of 7,479 nucleotides (nt), including a Poly(A) tail with a length of 30 nt. BLAST sequence alignment found that the nucleotide sequence homology of the 3 pCiYMaV clones with CiYMaV-PS was greater than 98.9%, and there were only sequence differences in the REP region among the 3 pCiYMaV clones, located at the 690th, 1316th, and 1598th positions of the amino acid sequence respectively.

[0077] Example 2

[0078] Infectivity identification of the infectious clone of citrus yellow mosaic-associated virus CiYMaV

[0079] To verify the infectivity of the full-length cDNA clone of CiYMaV, the present invention inoculated pCiYMaV into the yellowing seedlings of Chandler pummelo by the Agrobacterium-mediated vacuum infiltration method. The specific steps are as follows:

[0080] 1. Agrobacterium transformation

[0081] 1) Take out the competent cells of Agrobacterium tumefaciens EHA105 from the -80°C refrigerator and thaw them in the palm of the hand. When the ice and water are in a fused state, insert them on ice and continue to thaw. After complete melting, aliquot 50 μL of the competent cells into a sterilized 1.5 mL centrifuge tube;

[0082] 2) Add 1 μL of the recombinant plasmid into 50 μL of the competent cells, gently pipette and mix well, incubate in an ice-water bath for 5 min, stand in liquid nitrogen for 5 min, incubate in a 37°C water bath for 5 min, and then incubate in an ice-water bath for 5 min;

[0083] 3) In the laminar flow hood, add 700 μL of antibiotic-free LB liquid medium, and then place it on a shaker at 28°C and resuscitate at 200 rpm for 2 - 3 h;

[0084] 4) Pipette 100 μL of the bacterial solution (without enrichment) and spread it evenly on the LB medium plate with the corresponding resistance. After the plate is dried, seal it with a sealing film and invert it in an incubator at 28°C for about 36 - 48 h;

[0085] 5) When single colonies grow, pick a single clone with a sterilized white pipette tip and transfer it into a sterilized 1.5 mL centrifuge tube. Add the LB liquid medium with the corresponding resistance to the centrifuge tube, and then place it on a shaker at 28°C and culture at 200 rpm for 8 - 12 h. Then, bacterial liquid PCR verification can be carried out (the sequencing primers are CiYMaV-CP-F / R). Part of the positive bacterial liquid is used for expansion culture, and part is mixed with an equal volume of 50% glycerol and stored at -80°C.

[0086] 2. Agrobacterium infiltration inoculation

[0087] 1) Expand and culture the above positive bacterial liquid according to a volume ratio of 1:100, shake and culture at 28°C and 200 rpm for about 16 h. After the bacterial liquid is fully turbid, centrifuge at 5,000 rpm for 10 min and discard the supernatant;

[0088] 2) Add an appropriate amount of MMA resuspension buffer (500 μL of 1 mol / L MgCl2, 1 mL of 500 mmol / L MES, 50 μL of 0.2 MAS in 50 mL of sterile water), pipette and resuspend the bacterial cells with a pipette tip, and then centrifuge at 5,000 rpm for 10 min again and discard the supernatant;

[0089] 3) Add an appropriate amount of MMA resuspension buffer to adjust the bacterial liquid concentration to OD 600 = 1.0, and then let it stand in the dark at room temperature for 2 h;

[0090] 4) Inoculation of citrus plants: Immerse the yellowing citrus seedlings (with roots about 3 - 5 cm long) in the cell resuspension, let it stand for 1 min under a negative standard atmospheric pressure, then rinse with ddH2O. After that, transplant the yellowing citrus seedlings into nutrient soil, culture them in the dark at 25°C for 48 h, and finally continue to culture them in a light incubator at 25°C with 16 h of light / 20°C with 8 h of darkness;

[0091] 5) Inoculation of herbaceous hosts: Use a needleless syringe to inject the cell resuspension into the abaxial surface of the leaves of suitable-aged herbaceous hosts. After injection, the plants need to be placed in the dark for 8 - 12 h, and then transferred to the normal growth environment for continued cultivation; Each experiment is repeated three times, and 13 - 20 plants are inoculated for each treatment.

[0092] The results are as Figure 2 shown. At 10 days post-inoculation (10dpi), no obvious differences were observed in the symptoms caused by the 3 pCiYMaV clones on Chandler grapefruit, and all showed slight vein yellowing; At 40dpi, the infected plants showed severe vein yellowing, mottling and dwarfing symptoms ( Figure 2 A, B), but no obvious symptoms were observed in the control plants. As Figure 3 shown, at 180dpi and 360dpi, the infected plants showed more severe vein yellowing, mottling and dwarfing symptoms. At 60dpi, the newly emerged top leaves of Chandler grapefruit inoculated with pCiYMaV were collected for RT-PCR and DTBIA detection. The results showed that pCiYMaV-FL-1, 18 and 22 could all infect Chandler grapefruit, and the infection rates were 100%, 94.7% and 100% respectively (Table 1). At the same time, through Northern blot and Western blot detection, it was found that the virus accumulation level in the leaves of Chandler grapefruit inoculated with pCiYMaV-FL-22 was significantly higher than that of the other two clones ( Figure 2 C, D). Since among the 3 pCiYMaV clones, pCiYMaV-FL-22 had the highest virus accumulation amount and stronger pathogenicity in Chandler grapefruit, it was used for subsequent experiments. In addition, at 180dpi, the leaves of Chandler grapefruit infected with pCiYMaV-FL-22 were collected for virus particle extraction, and after negative staining, they were observed under an electron microscope. As Figure 2 shown in E, the virus particles were long and linear, with a diameter of about 13 - 14 nm and a length of about 600 - 700 nm, which was similar to the reported CiYMaV virus particle morphology. The above results indicate that the 3 full-length cDNA clones of CiYMaV constructed in the present invention all have infectious activity and can cause obvious symptoms on Chandler grapefruit.

[0093] Table 1

[0094]

[0095]

[0096] Note: Positive sample / inoculated sample; NI, non-inoculated

[0097] To verify the pathogenicity of CiYMaV to different hosts, pCiYMaV-FL-22 was inoculated onto 7 citrus cultivars shown in Table 1. As Figure 4 shown, through symptom observation, mosaic symptoms appeared on the middle leaves of Eureka lemon at 40 dpi ( Figure 4 A), but these symptoms disappeared after two weeks; slight vein yellowing and mottling symptoms appeared on the leaves of Cara Cara orange, Jincheng orange and Wogan ( Figure 4 B-D), and these symptoms only lasted for 30 d; strong vein yellowing and mottling symptoms appeared on the leaves of Zaoxiang pomelo ( Figure 4 E); in addition, the infected Eureka lemon, Cara Cara orange, Jincheng orange, Wogan and Zaoxiang pomelo plants also showed different degrees of dwarfing ( Figure 4 G-K). However, no obvious symptoms were shown on W. Murcott tangor and Ponkan from Taiwan Province of China after inoculation with pCiYMaV-FL-22. Subsequently, detection by DTBIA and RT-PCR found that the infection rates of pCiYMaV-FL-22 on different citrus cultivars were 76.9% - 93.3% (DTBIA) and 84.6% - 100% (RT-PCR) (Table 1). As a perennial woody plant, citrus has problems such as a long juvenile period and difficult genetic transformation, which has led to slow progress in the research on citrus virus diseases. Therefore, to clarify the herbaceous hosts of CiYMaV and accelerate the research speed of this virus, pCiYMaV-FL-22 was infiltrated and inoculated onto Nicotiana benthamiana, Arabidopsis thaliana and Vigna unguiculata. After 30 days of continuous observation, no obvious symptoms were shown on the 3 herbaceous plants. In addition, systemic leaves were collected at 14 dpi and 28 dpi for RT-PCR detection, and the results were all negative. The experiment was repeated 3 times with consistent results. The above results indicate that pCiYMaV-FL-22 can infect multiple citrus cultivars and cause obvious virus disease symptoms.

[0098] Example 3

[0099] Construction of CRP mutant virus of CiYMaV

[0100] 1. Sequence analysis of Mandarivirus CRP protein

[0101] Amino acid sequence alignment of the Mandarivirus CRP protein using NCBI BlastP revealed that the Mandarivirus CRP protein had the highest sequence similarity with the CRP protein encoded by garlic virus A, but the similarity was less than 50%. The results of multiple amino acid sequence alignment showed that the Mandarivirus CRP protein had two conserved motifs similar to the CRP proteins of viruses in the genus Allexivirus: the Zinc finger motif (ZF) and the Nuclear localization signal (NLS). Figure 5 )。In addition, based on the CRP protein sequences of different viruses in the families Alphaflexiviridae and Betaflexiviridae, a phylogenetic tree was constructed using the maximum likelihood method, and Mandarivirus CRP clustered into a separate branch.

[0102] 2. Construction of CRP mutant viruses

[0103] Using the pCiYMaV-FL-22 plasmid prepared in Example 1 as a template and primers, site-directed alanine mutagenesis and deletion mutagenesis were performed on the CRP region by overlapping extension PCR to obtain four intermediate fragment sites, namely mCRP, ΔCRP, mCRP ZF, and mCRP NLS (as Figure 6 shown). The four intermediate fragments were inserted into pCiYMaV-FL-16 respectively to obtain the corresponding CiYMaV CRP mutant virus recombinant plasmids pCiYMaV mCRP 、pCiYMaV ΔCRP 、pCiYMaV mCRP ZF and pCiYMaV mCRP NLS .

[0104] pCiYMaV mCRP indicates that a synonymous mutation was introduced to introduce a stop codon after the start codon of the CRP protein using the site-directed alanine mutagenesis strategy.

[0105] pCiYMaV ΔCRP indicates that a partial sequence at the C-terminus of CRP was deleted, specifically nt 7,079 - 7,443.

[0106] pCiYMaV mCRP ZF indicates that the zinc finger structure was site-directed mutated with alanine. Specifically, the CX2CX 11 CX5C of the zinc finger structure was mutated to AX2AX 11 CX5C.

[0107] pCiYMaV mCRP NLS It represents the use of alanine site-directed mutagenesis of the nuclear localization signal, specifically mutating KRRAXR of the nuclear localization signal to AAAAAXR.

[0108] The primer pairs used for mCRP are: pCiYMaV-eco81I-1F and CiYMaV mCRP -overlap-1R, CiYMaV mCRP -overlap-2F and pCiYMaV-FL-2R, pCiYMaV-eco81I-1F and pCiYMaV-FL-2R, and their nucleotide sequences are SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 respectively.

[0109] The primer pairs used for ΔCRP are: pCiYMaV-eco81I-1F and pCiYMaV ΔCRP -1R (SEQ ID NO: 9), pCiYMaV-eco81I-1F and pCiYMaV ΔCRP -2R (SEQ ID NO: 10).

[0110] The primer pairs used for mCRP ZF are pCiYMaV-eco81I-1F and CiYMaV mCRP ZF -overlap-1R (SEQ IDNO: 11), CiYMaV mCRP ZF -overlap-2F (SEQ ID NO: 12) and pCiYMaV-FL-2R, pCiYMaV-eco81I-1F and pCiYMaV-FL-2R.

[0111] The primer pairs used for mCRP NLS are pCiYMaV-eco81I-1F and CiYMaV mCRP NLS -overlap-1R (SEQID NO: 13), CiYMaV mCRP NLS -overlap-2F (SEQ ID NO: 14) and pCiYMaV-FL-2R, pCiYMaV-eco81I-1F and pCiYMaV-FL-2R.

[0112] SEQ ID NO: 5

[0113] 5′-ACCTGCCTGAGGGGTTTAAATCTAACTGAGTCCGA-3′

[0114] SEQ ID NO: 6

[0115] 5′-GGTCAGCTTTAATCATGAGGTTCCATACGACGCGG-3′

[0116] SEQ ID NO: 7

[0117] 5′-TGATTAAAGCTGACCAACCACCCGCGAACTGGATG-3′

[0118] SEQ ID NO: 8

[0119] 5′-CGCGGATCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGAAAATGGAAACTGAA AGCCTG-3′

[0120] SEQ ID NO: 9

[0121] 5′-CTAGGTGGCAAAAGGGGTCTTGC-3′

[0122] SEQ ID NO: 10

[0123] 5′-CGCGGATCCAAACATAAATATTCAGGCTTTCAGTTTCCATTTTCTGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAACTAGGTGGCAAAAGGGGTCT-3′

[0124] SEQ ID NO: 11

[0125] 5′-CCCTGCCTTGTATGCGTAGTTAAGTCGAGAGGCTCGGC-3′

[0126] SEQ ID NO: 12

[0127] 5′-TACGCATACAAGGCAGGGCACCCACTTTATCTAAATAA-3′

[0128] SEQ ID NO: 13

[0129] 5′-GGCTGCTGCTGCGACAGCAGAGCGACTTGAACCCA-3′

[0130] SEQ ID NO: 14

[0131] 5′-GTCGCAGCAGCAGCCTCTCGACTTAACTACTGTTA-3′

[0132] Example 4

[0133] Transformation of CRP mutant virus of CiYMaV and evaluation of plants

[0134] The recombinant plasmids pCiYMaV of virus mutants obtained respectively in Example 3 mCRP 、pCiYMaV ΔCRP 、pCiYMaV mCRP ZF and pCiYMaV mCRP NLS were transferred into Agrobacterium tumefaciens EHA105, and the cell concentration was adjusted to OD 600 = 1.0 with resuspension buffer before inoculation, and then the citrus yellowing seedlings were inoculated by Agrobacterium vacuum infiltration. The specific methods of Agrobacterium transformation and inoculation of citrus yellowing seedlings were the same as those described in Example 2, so they will not be elaborated here in detail.

[0135] From Figure 7 the results, it can be seen that at 50 dpi, no obvious symptoms were observed in citrus plants inoculated with pCiYMaV mCRP 、pCiYMaV ΔCRP mutant viruses. The plant height measurement and statistics of the plants found that the plant heights of the plants inoculated with the wild-type virus of CiYMaV and pCiYMaV mCRP mutant virus were significantly lower than those of the control, and there was no significant difference between the two.

[0136] To further verify the infection activity of the above two CRP mutant viruses, the top new leaves of the inoculated plants were collected at 50 dpi for DTBIA and RT-PCR detection. The results showed that the pCiYMaV ΔCRP mutant virus had no infection activity, and the infection rate of the pCiYMaV mCRP mutant virus was lower than that of the wild-type virus (Table 2). At the same time, virus sequence amplification and sequencing of the collected samples found that the mutant sites were all stably present. In addition, the Western blot detection results showed that the virus accumulation in citrus plants inoculated with the pCiYMaV mCRP mutant virus was lower than that of the wild-type virus.

[0137] Table 2

[0138]

[0139] Note: Positive samples / inoculated samples

[0140] FromFigure 8 As can be seen from the results, after 20 days of inoculation, pCiYMaV mCRP ZF and pCiYMaV mCRP NLS mutant viruses did not cause any leaf symptoms on Chandler pummelo. At 330 dpi, the plant height of the inoculated plants was measured and statistically analyzed. It was found that compared with the Chandler pummelo inoculated with the empty vector, pCiYMaV mCRP ZF and pCiYMaV mCRP NLS mutant virus-inoculated plants had significantly reduced plant height, but there was no significant difference compared with the plant height of plants inoculated with the CiYMaV wild-type virus.

[0141] Samples were collected at 50 days after inoculation for DTBIA and RT-PCR detection. The results showed that pCiYMaV mCRP ZF and pCiYMaV mCRP NLS mutant viruses could all infect citrus plants, and the infection rate was 40.6% - 88%. In addition, citrus samples were collected at 20 days, 30 days, 40 days, 50 days, and 60 days after inoculation for RT-qPCR detection. It was found that the virus accumulation in citrus plants inoculated with pCiYMaV mCRP ZF and pCiYMaV mCRP NLS mutant viruses was always lower than that of the wild-type virus. The results of Western blot detection were consistent with those of RT-qPCR.

[0142] In summary, the present invention constructed four CRP mutant viruses of CiYMaV by alanine site-directed mutagenesis or deletion mutagenesis. After infecting citrus yellowing seedlings with these four mutant viruses, it was found that different mutant viruses showed different phenotypic symptoms on the plants, providing a strong basis for the study of virus gene function, cross-protection of attenuated strains, and subsequent research on Mandarivirus viruses, and also laying a theoretical foundation for creating excellent resistant germplasm materials and establishing a continuous and effective prevention and control system for citrus virus diseases.

[0143] The above-described specific embodiments further detailed the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above is only the specific embodiment of the present invention and is not used to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A CiYMaV infectious cloning vector, characterized in that: The virus was prepared by inserting the complete sequence of citrus yellow mottle-associated virus CiYMaV into the downstream of the 2×35S promoter of the vector pCASS4-RZ.

2. A method for constructing a CiYMaV infectious clone, characterized in that: The steps include: (1) Obtain the CiYMaV viral genome reference sequence; (2) Design primers to amplify the full-length cDNA sequence of CiYMaV; (3) The pCASS4-RZ vector was linearized using Stu I and BamH I restriction endonucleases, and then the CiYMaV full-length cDNA sequence was inserted into the downstream of the 2×35S promoter of pCASS4-RZ using T4 DNA ligase to obtain the recombinant vector pCiYMaV; (4) The recombinant vector pCiYMaV was transformed into Escherichia coli to construct an infectious clone of CiYMaV.

3. The method for constructing a CiYMaV infectious clone according to claim 2, characterized in that: The amplification primers in step (2) are CiYMaV-FL-F and CiYMaV-FL-R, and their nucleotide sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

4. The method for constructing a CiYMaV infectious clone according to claim 2, characterized in that: In step (2), the PCR amplification system is: 10 μL 5×Q5 Reaction Buffer, 0.5 μL DNA Polymerase, 1.25 μL of 10 μM upstream and downstream primers, 1 μL 10 mM dNTPs, 2 μL cDNA template, 10 μL 5×Q5 High GC Enhancer, 24 μL ddH2O, and the total reaction system is 50 μL; the reaction conditions for each fragment are: 98°C 2 min; 98°C 10 s, 55°C 15 s, 72°C 2 min, 35 cycles; 72°C 5 min.

5. A CiYMaV mutant, characterized in that: The mutant is obtained by performing alanine site-directed mutation or deletion mutation on the CRP region on the CiYMaV infectious cloning vector through overlapping extension PCR. The site-directed mutation or deletion mutation is obtained on the basis of the CiYMaV highly pathogenic infectious clone pCiYMaV. The infectious clone pCiYMaV is obtained by inserting the sequence of CiYMaV into the vector pCASS4-RZ.

6. A CiYMaV mutant according to claim 5, characterized in that: The deletion mutation of the CRP region refers to the deletion of the C-terminal sequence of the CRP protein to obtain the mutant virus pCiYMaV ΔCRP .

7. A CiYMaV mutant according to claim 5, characterized in that: The alanine site-directed mutagenesis of the CRP region refers to a synonymous mutation after the start codon of the CRP protein to introduce a stop codon to obtain a mutant virus pCiYMaV mCRP .

8. A CiYMaV mutant according to claim 5, characterized in that: The alanine site-directed mutagenesis of the CRP region refers to alanine site-directed mutagenesis of the zinc finger structure of the CRP protein to obtain the mutant virus pCiYMaV mCRP ZF.

9. A CiYMaV mutant according to claim 5, characterized in that: The alanine site-directed mutagenesis of the CRP region refers to alanine site-directed mutagenesis of the nuclear localization signal of the CRP protein to obtain the mutant virus pCiYMaV mCRPNLS .

10. The method for constructing a CiYMaV mutant according to any one of claims 5 to 9, characterized in that: The steps include: (1) Digest the pCiYMaV plasmid with Sal I and BamH I; (2) PCR amplification of the sequence fragment required for mutant construction; (3) The PCR product sequence fragment was recombined and connected with the pCiYMaV restriction endonuclease product to obtain the CRP mutant virus recombinant plasmid.

Images