HLA-E diallele knockout

Abstract

A composition comprising an RNA molecule comprising a guide sequence portion having 17 to 50 contiguous nucleotides, the 17 to 50 contiguous nucleotides comprising a nucleotide of the sequence of any one of SEQ ID NO: 1 to 7830, as well as methods and uses thereof.

Description

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 376,269, filed on September 19, 2022, the content of which is incorporated herein by reference.

[0002] In this application, various publications are cited, including the references in parentheses. The disclosures of all publications mentioned in this application are incorporated herein by reference in their entirety to provide supplementary descriptions of the field to which the present invention pertains and the features of this field that can be adopted by the present invention. Reference to the Sequence Listing

[0003] This application incorporates by reference the nucleotide sequences in the file named "230918_92040 - A - PCT_Sequence_Listing_AWG.xml", which is 6,779 kilobytes in size and was created in IBM - PC machine format on September 18, 2023, and is compatible with the operating system of MS - Windows, and is included as part of this application in the XML file filed on September 18, 2023. Background of the Invention

[0004] Chimeric antigen receptors (CARs) provide a promising approach to immunotherapy. However, to make such therapies (e.g., CAR - T cell therapy) more accessible, it is highly desirable to develop allogeneic adoptive transfer strategies, in which universal CAR cells derived from cells of healthy donors can be used to treat multiple patients. To implement such a strategy, the immunogenicity and reactivity of CAR - T cells must be optimized to avoid adverse reactions, such as host rejection or graft - versus - host disease. Summary of the Invention

[0005] HLA - E molecules are restrictive elements for specific T - cell responses. Methods for knocking out the HLA - E gene in cells for immunotherapy methods (such as CAR - T treatment) are disclosed. Cells modified to have an HLA - E knockout improve the performance of such cells in allogeneic adoptive transfer therapies. Such cells have improved activity, retention, and / or expansion characteristics for adoptive cancer immunotherapy. Specifically, the HLA - E knockout reduces the immunogenicity of the modified cells to avoid rejection by the host immune system during allogeneic adoptive transfer. Thus, bi - allelic knockout of the HLA - E gene in cells as described herein can be used to minimize the immunogenicity of the cells. The disclosed methods for knocking out the HLA - E gene in cells (such as allogeneic immune cells) are used to increase the persistence and / or engraftment of such cells in the presence of host immune cells.

[0006] The present invention also provides a method for inactivating alleles of the major histocompatibility complex, class I, E (HLA-E) gene in cells, the method comprising introducing a composition into the cells, the composition comprising: a CRISPR nuclease, or a polynucleotide molecule encoding the CRISPR nuclease; and an RNA molecule comprising a guide sequence portion having 17-50 nucleotides, or a polynucleotide molecule encoding the RNA molecule, wherein the complex of the CRISPR nuclease and the RNA molecule affects double-strand breaks in the alleles of the HLA-E gene.

[0007] In some embodiments, the RNA molecule comprises a guide sequence portion that targets a sequence within any one of exons 1-7 of the HLA-E gene, or a sequence within a genomic range selected from any one of 6:30489462-30489633, 6:30489656-30490033, 6:30490170-30490553, 6:30491067-30491450, 6:30491467-30491691, 6:30492334-30492474, and 6:30492471-30492619. In some embodiments, the guide sequence portion of the RNA molecule comprises 17-50 contiguous nucleotides that contain the nucleotides of any one of the sequences shown in SEQ ID NOs: 1-7830.

[0008] According to an embodiment of the present invention, there is provided an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides that contain the nucleotides of any one of the sequences shown in SEQ ID NOs: 1-7830.

[0009] According to an embodiment of the present invention, there is provided a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides that contain the nucleotides of any one of the sequences shown in SEQ ID NOs: 1-7830.

[0010] According to an embodiment of the present invention, a method for inactivating the HLA-E allele in a cell is provided. The method includes delivering to the cell a composition comprising an RNA molecule and a CRISPR nuclease. The RNA molecule comprises a guide sequence portion having 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830. In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is a T cell. In some embodiments, the cell is a regulatory T cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a natural killer (NK) cell. In some embodiments, the cell is a macrophage. In some embodiments, the cell is a stem cell. In some embodiments, the cell is an iPSC. In some embodiments, the cell is a fibroblast, blood cell, hepatocyte, keratinocyte, or any other cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC). In some embodiments, the delivery to the cell is carried out in vivo, ex vivo, or in vitro. In some embodiments, the method is carried out ex vivo, and the cell is provided / explanted from an individual patient. In some embodiments, the method further includes the step of introducing the resulting cells with a modified / knocked-out HLA-E allele into an individual patient together. In some embodiments, the cell is derived from the individual patient to be treated. In some embodiments, the cell is derived from a donor. In some embodiments, the cell is allogeneic to the individual patient into which it is introduced.

[0011] According to an embodiment of the present invention, a method for treating, alleviating, and / or preventing host-versus-graft rejection (HvG) is provided. The method includes delivering to the cells of a subject suffering from host-versus-graft rejection (HvG) or at risk of suffering from host-versus-graft rejection (HvG) a composition comprising an RNA molecule and a CRISPR nuclease. The RNA molecule comprises a guide sequence portion having 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830.

[0012] According to an embodiment of the present invention, a method for improving the activity and / or retention and / or expansion of cells for adoptive cell therapy is provided. The method includes delivering to the cells of a subject in need of adoptive cell therapy a composition comprising an RNA molecule and a CRISPR nuclease. The RNA molecule comprises a guide sequence portion having 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830.

[0013] In an embodiment, the method is for increasing the persistence and / or engraftment of cells in the cells of a host subject, the method comprising delivering to the cells a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides containing nucleotides in a sequence shown in any one of SEQ ID NOs: 1-7830; and introducing the cells into the host subject. In some embodiments, the cells are further differentiated before being introduced into the host subject. In some embodiments, the cells are further engineered to express a chimeric antigen receptor. In some embodiments, the cells are stem cells, iPSCs or progenitor cells and are differentiated into T cells before being introduced into the host subject. In some embodiments, the cells are T cells. In some embodiments, the cells are further engineered to inactivate and / or knockout additional genes in order to improve the use of the cells for adoptive transfer, such as knocking out additional genes to avoid graft-versus-host disease (GVHD) after introducing the cells into the host subject.

[0014] According to an embodiment of the present invention, there is provided the use of a composition comprising an RNA molecule and a CRISPR nuclease for inactivating HLA-E alleles in cells, the RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides containing nucleotides in a sequence shown in any one of SEQ ID NOs: 1-7830, the use comprising delivering to the cells a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides containing nucleotides in a sequence shown in any one of SEQ ID NOs: 1-7830.

[0015] According to an embodiment of the present invention, there is provided a medicament comprising an RNA molecule and a CRISPR nuclease for inactivating FASLG alleles in cells, the RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides, the contiguous nucleotides containing nucleotides in a sequence shown in any one of SEQ ID NOs: 1-7830, wherein the medicament is administered by delivering to the cells a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides containing nucleotides in a sequence shown in any one of SEQ ID NOs: 1-7830.

[0016] According to an embodiment of the present invention, there is provided a composition comprising an RNA molecule and a CRISPR nuclease for use in improving the use for treating, ameliorating or preventing host-versus-graft rejection (HvG) or increasing the persistence of cells after transplantation, the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-7830, the use comprising delivering to the cells of a subject suffering from or at risk of experiencing host-versus-graft rejection a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-7830.

[0017] According to an embodiment of the present invention, there is provided a medicament comprising a composition containing an RNA molecule and a CRISPR nuclease, the medicament for treating, ameliorating or preventing host-versus-graft rejection (HvG), the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-7830, wherein the medicament is administered by delivering to the cells of a subject suffering from or at risk of experiencing host-versus-graft rejection (HvG) a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-7830.

[0018] According to an embodiment of the present invention, there is provided a composition comprising an RNA molecule and a CRISPR nuclease for use in improving the activity and / or retention and / or expansion or increasing the persistence of cells after transplantation for adoptive cell therapy, the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-7830, the use comprising delivering to the cells of a subject in need of adoptive cell therapy a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-7830.

[0019] According to an embodiment of the present invention, there is provided a kit for inactivating HLA-E alleles in cells, which comprises an RNA molecule, a CRISPR nuclease and / or a tracrRNA molecule, wherein the RNA molecule comprises a guide sequence portion having 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in any one of the sequences shown in SEQ ID NO: 1-7830; and instructions for delivering the RNA molecule, the CRISPR nuclease and / or the tracrRNA to cells.

[0020] According to an embodiment of the present invention, there is provided a method for treating a disease or disorder, the method comprising delivering any one of the compositions or modified cells described herein to a subject, preferably wherein the disease or disorder is cancer.

[0021] According to an embodiment of the present invention, there is provided a kit for treating or preventing host-versus-graft rejection (HvG) in a subject, which comprises an RNA molecule, a CRISPR nuclease, and optionally a tracrRNA molecule, wherein the RNA molecule comprises a guide sequence portion having 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in any one of the sequences shown in SEQ ID NO: 1-7830; and instructions for delivering the RNA molecule, the CRISPR nuclease, and optionally the tracrRNA to cells of a subject suffering from or at risk of host-versus-graft rejection (HvG). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : HLA-E editing in HeLa cells. The OMNI-103 CRISPR nuclease was expressed in a mammalian cell system (HeLa cells) by DNA transfection together with an sgRNA expression plasmid. The transfection efficiency (transfection %) was determined by flow cytometry measurement of the mCherry signal. All tests were repeated three times. Cells transfected with "only OMNI nuclease" (i.e., without a guide) were used as negative controls, and no editing was observed in these cells (data not shown).

[0023] Figure 2 : HLA-E editing in primary T cells. T cells obtained from a donor were thawed and activated with beads for 72 hours. Then, they were treated with OMNI-103 CRISPR nuclease (113 pmol) + sgRNA (226 pmol) and 2×10 6The cells were assayed for cleavage activity. After seven (7) days, approximately 100,000 cells were sorted by FACS and sent for next-generation sequencing (NGS) analysis. NGS samples were prepared using robotic PCR on DNA lysates from Quick Extract. Detailed Description

[0024] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting necessarily.

[0025] It should be understood that the terms "a" and "an" as used above and elsewhere in this document refer to "one or more" of the listed components. It will be clear to those of ordinary skill in the art that, unless specifically stated otherwise, the use of the singular includes the plural. Thus, the terms "a," "an," and "at least one" are used interchangeably in this application.

[0026] For a better understanding of the teachings and without limiting the scope of the teachings in any way, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, as well as other numerical values used in the specification and claims, are to be understood in all instances as being modified by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0027] Unless otherwise stated, adjectives such as "substantially" and "about" modifying one or more features of embodiments of the present invention that describe a condition or relationship characteristic are to be understood as meaning that the condition or characteristic is defined within a tolerance acceptable for the operation of the embodiment to which it is intended to be applied. Unless otherwise indicated, the word "or" in the specification and claims is to be regarded as an inclusive "or" rather than an exclusive or, and indicates at least one, or any combination, of the items associated with it.

[0028] In the specification and claims of this application, each of the verbs "comprise," "include," and "have," and variations thereof, is used to indicate that the one or more objects of the verb are not necessarily a complete list of the components, elements, or parts of the one or more subjects of the verb. Other terms used herein are intended to be defined by their well-known meaning in the art.

[0029] In some embodiments of the present invention, DNA nucleases are utilized to effect DNA breaks at target sites to induce cellular repair mechanisms such as, but not limited to, non-homologous end joining (NHEJ). In classical NHEJ, the two ends of a double-strand break (DSB) site are joined together in a rapid but inaccurate manner (i.e., often resulting in mutations in the form of small insertions or deletions in the DNA at the cleavage site).

[0030] As used herein, the term "modified cell" refers to a cell in which a double-strand break is effected by a complex of an RNA molecule and a CRISPR nuclease due to hybridization to a target sequence, i.e., on-target hybridization.

[0031] The present invention provides one or more modified cells obtained by using any of the methods described herein. In one embodiment, these one or more modified cells are capable of producing progeny cells. In one embodiment, these one or more modified cells are capable of producing progeny cells after engraftment. As a non-limiting example, the modified cell can be a hematopoietic stem cell (HSC), or any cell suitable for allogeneic or autologous cell transplantation.

[0032] As used herein, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence or a molecule comprising a nucleotide sequence that is capable of hybridizing to a specific target sequence, e.g., the targeting sequence has a nucleotide sequence that is at least partially complementary to the sequence being targeted along the length of the targeting sequence. The targeting sequence or targeting molecule can be part of an RNA molecule that can form a complex with a CRISPR nuclease either alone or in combination with other RNA molecules, wherein the targeting sequence serves as the targeting moiety of the CRISPR complex. When a molecule having a targeting sequence is present together with a CRISPR nuclease, the RNA molecule, either alone or in combination with one or more additional RNA molecules (such as a tracrRNA molecule), is capable of targeting the CRISPR nuclease to a specific target sequence. As a non-limiting example, the guide sequence portion of a CRISPR RNA molecule or a single-guide RNA molecule can serve as the targeting molecule. Each possibility represents a separate embodiment. The targeting sequence can be custom-designed to target any desired sequence.

[0033] As used herein, the term "targeting" refers to preferentially hybridizing the targeting sequence of a targeting molecule to a nucleic acid having a target nucleotide sequence. It should be understood that the term "target" includes variable hybridization efficiencies such that a nucleic acid having a target nucleotide sequence is preferentially targeted, but off-target hybridization may also occur in addition to on-target hybridization. It should be understood that when an RNA molecule targets a sequence, the complex of the RNA molecule and the CRISPR nuclease molecule targets that sequence to achieve nuclease activity.

[0034] The "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that can hybridize with a specific target DNA sequence. For example, the guide sequence portion has a nucleotide sequence that is partially or fully complementary to the DNA sequence portion being targeted along the length of the guide sequence portion. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or is about 17 - 50, 17 - 49, 17 - 48, 17 - 47, 17 - 46, 17 - 45, 17 - 44, 17 - 43, 17 - 42, 17 - 41, 17 - 40, 17 - 39, 17 - 38, 17 - 37, 17 - 36, 17 - 35, 17 - 34, 17 - 33, 17 - 31, 17 - 50, 17 - 29, 17 - 28, 17 - 27, 17 - 26, 17 - 25, 17 - 24, 17 - 22, 17 - 21, 18 - 25, 18 - 24, 18 - 23, 18 - 22, 18 - 21, 19 - 25, 19 - 24, 19 - 23, 19 - 22, 19 - 21, 19 - 20, 20 - 22, 18 - 20, 20 - 21, 21 - 22, or 17 - 20 nucleotides in length. Preferably, the entire length of the guide sequence portion is fully complementary to the target DNA sequence along the length of the guide sequence portion. The guide sequence portion can be part of an RNA molecule that can form a complex with a CRISPR nuclease, where the guide sequence portion acts as the DNA targeting portion of the CRISPR complex. When an RNA molecule having a guide sequence portion is present simultaneously with a CRISPR molecule, either alone or in combination with one or more additional RNA molecules (such as a tracrRNA molecule), the RNA molecule is capable of targeting the CRISPR nuclease to a specific target DNA sequence. Thus, a CRISPR complex can be formed by the direct binding of an RNA molecule having a guide sequence portion to a CRISPR nuclease or by the binding of an RNA molecule having a guide sequence portion and one or more additional RNA molecules to a CRISPR nuclease. Each possibility represents a separate embodiment. The guide sequence portion can be custom-designed to target any desired sequence. Thus, a molecule containing a "guide sequence portion" is a class of targeting molecules. In some embodiments, the guide sequence portion contains a sequence that is the same as or differs by no more than 1, 2, 3, 4, or 5 nucleotides from the guide sequence portions described herein, such as the guide sequences shown in any one of SEQ ID NOs: 1 - 7830. Each possibility represents a separate embodiment. In some such embodiments, the guide sequence portion contains a sequence that is the same as the sequence shown in any one of SEQ ID NOs: 1 - 7830.In the present application, the terms "guide molecule", "RNA guide molecule", "guide RNA molecule", and "gRNA molecule" are synonymous with a molecule that includes a guide sequence portion.

[0035] As used herein, the term "indiscriminate" means that the guide sequence portion of an RNA molecule targets a specific DNA sequence that is common to all alleles of a gene.

[0036] In an embodiment of the present invention, the RNA molecule includes a guide sequence portion having 17 - 50 consecutive nucleotides, and the 17 - 50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NOs: 1 - 7830.

[0037] The RNA molecule and / or the guide sequence portion of the RNA molecule may contain modified nucleotides. Exemplary modifications to nucleotides / polynucleotides can be synthetic and include polynucleotides containing nucleotides that include bases other than the naturally occurring adenine, cytosine, thymine, uracil, or guanine bases. Modifications to polynucleotides include polynucleotides containing synthetic non - naturally occurring nucleosides such as locked nucleic acids. Modifications to polynucleotides can be used to increase or decrease the stability of RNA. An example of a modified polynucleotide is an mRNA containing 1 - methylpseudouridine. For examples of modified polynucleotides and their uses, see U.S. Patent 8,278,036, PCT International Publication No. WO / 2015 / 006747, and Weissman and Kariko (2015), each of which is incorporated herein by reference.

[0038] As used herein, "consecutive nucleotides" as shown in SEQ ID NO refer to the nucleotides in a nucleotide sequence in the order shown in the SEQ ID NO without any inserted nucleotides.

[0039] In an embodiment of the present invention, the length of the guide sequence portion can be 17 - 50 nucleotides and contains 20 - 22 consecutive nucleotides in the sequence shown in any one of SEQ ID NO: 1 - 7830. In an embodiment of the present invention, the length of the guide sequence portion can be less than 22 nucleotides. For example, in an embodiment of the present invention, the length of the guide sequence portion can be 17, 18, 19, 20, or 21 nucleotides. In such embodiments, the guide sequence portion can be composed of 17, 18, 19, 20, or 21 nucleotides in the sequence of 17 - 22 consecutive nucleotides shown in any one of SEQ IDNO: 1 - 7830. For example, a guide sequence portion of 17 nucleotides in the sequence of 17 consecutive nucleotides shown in SEQ ID NO: 7831 can be composed of any one of the following nucleotide sequences (nucleotides excluded from the consecutive sequence are marked with a strikethrough): AAAAAAAUGUACUUGGUUCC (SEQ ID NO:7831) 17 - nucleotide guide sequence 1: 17 - nucleotide guide sequence 2: 17 - nucleotide guide sequence 3: 17 - nucleotide guide sequence 4:

[0040] In embodiments of the present invention, the length of the guide sequence portion can be greater than 20 nucleotides. For example, in embodiments of the present invention, the length of the guide sequence portion can be 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In such embodiments, the guide sequence portion comprises 17 - 50 nucleotides containing a sequence of 20, 21, or 22 consecutive nucleotides shown in any one of SEQ ID NOs: 1 - 7830, and additional nucleotides that are fully complementary to the nucleotides or nucleotide sequences adjacent to the 3'-end of the target sequence, the 5'-end of the target sequence, or both.

[0041] In embodiments of the present invention, a CRISPR nuclease and an RNA molecule comprising a guide sequence portion form a CRISPR complex that binds to a target DNA sequence to effect cleavage of the target DNA sequence. The CRISPR nuclease, such as Cpf1, can form a CRISPR complex comprising the CRISPR nuclease and the RNA molecule without an additional tracrRNA molecule. Alternatively, the CRISPR nuclease, such as Cas9, can form a CRISPR complex between the CRISPR nuclease, the RNA molecule, and the tracrRNA molecule. The guide sequence portion, which comprises a nucleotide sequence capable of hybridizing to a specific target DNA sequence, and the sequence portion involved in binding of the CRIPR nuclease, such as the tracrRNA sequence portion, can be located on the same RNA molecule. Alternatively, the guide sequence portion can be located on one RNA molecule and the sequence portion involved in binding of the CRISPR nuclease, such as the tracrRNA portion, can be located on a separate RNA molecule. A single RNA molecule comprising a guide sequence portion (e.g., a DNA-targeting RNA sequence) and at least one RNA sequence portion that binds to a CRISPR protein (e.g., a tracrRNA sequence portion) can form a complex with the CRISPR nuclease and act as a DNA-targeting molecule. In some embodiments, a first RNA molecule (e.g., a crRNA molecule) comprising a DNA-targeting RNA portion that includes a guide sequence portion and a separate RNA molecule (e.g., a tracrRNA molecule) comprising an RNA sequence that binds to a CRISPR protein base pair with each other to form an RNA complex (e.g., a crRNA:tracrRNA complex) that targets the CRISPR nuclease to a DNA target site, or, alternatively, the first RNA molecule is fused to the separate RNA molecule to form an RNA molecule (e.g., a sgRNA molecule) that complexes with the CRISPR nuclease and targets the CRISPR nuclease to a DNA target site.

[0042] In embodiments of the present invention, an RNA molecule comprising a guide sequence portion can further comprise the sequence of a tracrRNA molecule. These embodiments can be designed as synthetic fusions of the guide portion of the RNA molecule and the trans-activating crRNA (tracrRNA). (See Jinek et al., 2012). In such embodiments, the RNA molecule is a single guide RNA (sgRNA) molecule. Embodiments of the present invention can also utilize a separate tracrRNA molecule and a separate RNA molecule (e.g., a crRNA molecule) comprising a guide sequence portion to form a CRISPR complex. In such embodiments, the tracrRNA molecule can hybridize to the RNA molecule by base pairing and may be advantageous in certain applications of the invention described herein.

[0043] The term "tracr pairing sequence" refers to a sequence that is sufficiently complementary to a tracrRNA molecule to hybridize with the tracrRNA via base pairing and promote the formation of a CRISPR complex. (See U.S. Patent No. 8,906,616). In embodiments of the present invention, the RNA molecule can further comprise a portion having a tracr pairing sequence.

[0044] For the purposes of this disclosure, "gene" includes a DNA region that encodes a gene product, as well as all DNA regions that regulate the production of the gene product, whether or not these regulatory sequences are adjacent to the coding sequence and / or the transcriptional sequence. Thus, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions.

[0045] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.

[0046] As used herein, the term "nuclease" refers to an enzyme capable of cleaving the phosphodiester bond between nucleotide subunits of a nucleic acid. The nuclease can be isolated or derived from a natural source. The natural source can be any living organism. Alternatively, the nuclease can be a modified or synthetic protein that retains phosphodiester bond cleavage activity. Gene modification can be achieved using a nuclease, such as a CRISPR nuclease

[0047] According to an embodiment of the present invention, a method for inactivating an allele of the major histocompatibility complex, class I, E (HLA-E) gene in a cell is provided, the method comprising introducing into the cell a composition comprising: at least one CRISPR nuclease, or a polynucleotide molecule encoding a CRISPR nuclease; and an RNA molecule comprising a guide sequence portion, or a polynucleotide molecule encoding the RNA molecule, wherein the complex of the CRISPR nuclease and the RNA molecule affects a double-strand break in the allele of the HLA-E gene, and wherein the guide sequence portion of the RNA molecule comprises 17-50 contiguous nucleotides, and the 17-50 contiguous nucleotides contain nucleotides in any one of the sequences shown in SEQ ID NO: 1-7830.

[0048] In some embodiments, the guide sequence portion comprises a nucleotide sequence listed in SEQ ID NOs: 1-7830 or a portion of any one of SEQ ID NOs: 1-7830, and optionally comprises additional nucleotides before or after the beginning or end of the nucleotide sequence. As a non-limiting example, the 17-nucleotide sequence found in SEQ ID NO:1 can form the guide sequence portion. Additionally, the guide sequence portion can comprise the 17-nucleotide sequence found in SEQ ID NO:1 and further include additional nucleotides at the 5' or 3' of the 17-nucleotide sequence found in SEQ ID NO:1.

[0049] In some embodiments, the RNA molecule is a crRNA molecule, and the composition further comprises a tracrRNA molecule that forms a crRNA:tracrRNA complex with the crRNA molecule. In some embodiments, the RNA molecule is a sgRNA molecule.

[0050] In some embodiments, the composition comprises an additional RNA molecule that comprises a guide sequence portion comprising 17-50 contiguous nucleotides that comprise nucleotides from any one of the sequences shown in SEQ ID NOs: 1-7830.

[0051] In some embodiments, the guide sequence portion of the RNA molecule comprises 17-50 contiguous nucleotides that comprise nucleotides from any one of the sequences shown in SEQ ID NOs: 1-7830, which are modified to comprise up to five mismatches relative to the target site.

[0052] In some embodiments, the method is a method of preparing modified immune cells (e.g., T cells) for immunotherapy. In some embodiments, the method is performed in vitro or ex vivo.

[0053] In some embodiments, the composition is introduced into a cell of a subject or a cultured cell.

[0054] In some embodiments, the cell is a lymphocyte, T cell, T regulatory cell, B cell, natural killer (NK) cell, macrophage, stem cell or fibroblast, blood cell, hepatocyte, keratinocyte or any other cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC).

[0055] In some embodiments, the cells are hematopoietic stem cells (HSCs), induced pluripotent stem cells (iPS cells), iPSC-derived cells, natural killer cells (NK), iPS-derived NK cells (iNK), T cells, innate-like T cells (iT), natural killer T cells (NKT), γδ T cells, iPSC-derived T cells, invariant NKT cells (iNKT), iPSC-derived NKT, monocytes, or macrophages.

[0056] In some embodiments, the CRISPR nuclease and the RNA molecule are introduced into the cells at substantially the same time or at different times.

[0057] In some embodiments, an allele of the HLA-E gene in the cell is subjected to an insertion or deletion mutation.

[0058] In some embodiments, the insertion or deletion mutation results in an early stop codon.

[0059] In some embodiments, the inactivation results in a truncated protein encoded by the mutated allele. For example, the inactivation method mutates the HLA-E allele such that the mutated allele encodes a truncated form of the HLA-E protein.

[0060] In some embodiments, the composition introduced into the cell further comprises a second RNA molecule comprising a guide sequence portion, wherein the guide sequence portion of the second RNA molecule comprises 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in any one of the sequences shown in SEQ ID NO: 1-7830, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

[0061] According to an embodiment of the present invention, a method for inactivating an allele of the major histocompatibility complex, class I, E (HLA-E) gene in a cell is provided, the method comprising introducing a composition into the cell, the composition comprising: at least one CRISPR nuclease, or a polynucleotide molecule encoding the CRISPR nuclease; and an RNA molecule comprising a guide sequence portion, or a polynucleotide molecule encoding the RNA molecule, wherein the complex of the CRISPR nuclease and the RNA molecule affects a double-strand break in the allele of the HLA-E gene, The guide sequence portion of the RNA molecule comprises 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NO: 1-7830, which are modified to contain 1, 2, 3, 4 or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion.

[0062] In some embodiments, the guide sequence portion of the RNA molecule comprises 1, 2, 3, 4 or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion.

[0063] In some embodiments, the guide sequence portion provides higher targeting specificity for the complex of the CRISPR nuclease and the RNA molecule relative to the guide sequence portion having higher complementarity to the allele of the HLA-E gene.

[0064] In some embodiments, the composition introduced into the cell further comprises a second RNA molecule comprising a guide sequence portion, wherein the guide sequence portion of the second RNA molecule comprises 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NO: 1-7830, or any one of SEQ ID NO: 1-7830, which are modified to contain 1, 2, 3, 4 or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

[0065] According to an embodiment of the present invention, a composition comprising an RNA molecule is provided, and the RNA molecule comprises a guide sequence portion comprising 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NO: 1-7830.

[0066] In some embodiments, the composition further comprises a second RNA molecule comprising a guide sequence portion, wherein the guide sequence portion comprises 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in the sequence shown in any one of SEQ ID NO: 1-7830, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

[0067] According to embodiments of the present invention, there are provided compositions comprising an RNA molecule comprising a guide sequence portion comprising 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides comprising nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830, or any one of SEQ ID NOs: 1-7830, which is modified to contain 1, 2, 3, 4, or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion.

[0068] In some embodiments, the composition further comprises a second RNA molecule comprising a guide sequence portion comprising 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides comprising nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830, or any one of SEQ ID NOs: 1-7830, which is modified to contain 1, 2, 3, 4, or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

[0069] In some embodiments, any one of the compositions described herein further comprises a CRISPR nuclease.

[0070] In some embodiments, any one of the compositions described herein further comprises a tracrRNA molecule.

[0071] According to embodiments of the present invention, there are provided cells modified by any one of the methods described herein or modified using any one of the compositions described herein. The modified cells may also have other genes altered to improve their use for adoptive transfer, e.g., to reduce or prevent graft-versus-host disease (GVHD).

[0072] Preferably, all alleles of the HLA-E gene are inactivated such that the modified cells cannot express a full-length functional HLA-E protein product.

[0073] In some embodiments, the cell is any one of the following, wherein the cell is a lymphocyte, T cell, T regulatory cell, B cell, natural killer (NK) cell, macrophage, stem cell or fibroblast, blood cell, hepatocyte, keratinocyte or any other cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC).

[0074] In some embodiments, the cells are hematopoietic stem cells (HSCs), induced pluripotent stem cells (iPS cells), iPSC-derived cells, natural killer cells (NK), iPS-derived NK cells (iNK), T cells, innate-like T cells (iT), natural killer T cells (NKT), γδ T cells, iPSC-derived T cells, invariant NKT cells (iNKT), iPSC-derived NKT, monocytes, or macrophages.

[0075] In some embodiments, the cells are stem cells or any cell type capable of being reprogrammed into induced pluripotent stem cells (iPSCs).

[0076] In some embodiments, the stem cells differentiate after they are modified.

[0077] In some embodiments, the stem cells differentiate into any one of lymphocytes, T cells, T regulatory cells, B cells, natural killer (NK) cells, innate-like T cells (iT), natural killer T cells (NKT), γδ T cells, invariant NKT cells (iNKT), monocytes, or macrophages.

[0078] According to an embodiment of the present invention, there is provided a drug comprising any one of the compositions described herein, which is used to inactivate the HLA-E allele in cells, wherein the drug is administered by delivering the composition to the cells.

[0079] According to an embodiment of the present invention, there is provided the use of any one of the compositions or modified cells described herein for treating, ameliorating, or preventing host-versus-graft rejection (HvG), including delivering the composition or modified cells to a subject who is experiencing or at risk of experiencing host-versus-graft rejection (HvG).

[0080] According to an embodiment of the present invention, there is provided a drug comprising any one of the compositions or modified cells described herein, which is used to treat, ameliorate, or prevent host-versus-graft rejection (HvG), wherein the drug is administered by delivering the composition or modified cells to a subject who is experiencing or at risk of experiencing host-versus-graft rejection (HvG).

[0081] According to an embodiment of the present invention, there is provided a kit for inactivating the HLA-E allele in cells, which comprises any one of the compositions described herein and instructions for delivering the composition to the cells.

[0082] In some embodiments, the composition is delivered ex vivo to the cells.

[0083] According to an embodiment of the present invention, there is provided a kit for treating or preventing host-versus-graft rejection (HvG) in a subject, the kit comprising any one of the compositions or modified cells described herein, and instructions for delivering the composition or modified cell to a subject experiencing or at risk of experiencing host-versus-graft rejection (HvG).

[0084] According to an embodiment of the present invention, there is provided any one of the compositions or modified cells described herein for treating, ameliorating or preventing host-versus-graft rejection (HvG), including delivering the composition or modified cell to a subject experiencing or at risk of experiencing host-versus-graft rejection (HvG).

[0085] According to an embodiment of the present invention, there is provided any one of the compositions or modified cells described herein for adoptive immunotherapy, including delivering the composition or modified cell to a subject in need of adoptive immunotherapy.

[0086] According to an embodiment of the present invention, there is provided a medicament for adoptive immunotherapy comprising the composition or modified cell, wherein the medicament is administered by delivering the composition or modified cell to a subject in need of adoptive immunotherapy.

[0087] According to an embodiment of the present invention, there is provided a kit for administering adoptive immunotherapy to a subject, which comprises any one of the compositions or modified cells described herein and instructions for delivering the composition or modified cell to a subject in need of adoptive immunotherapy.

[0088] According to an embodiment of the present invention, there is provided any one of the compositions or modified cells described herein for adoptive immunotherapy, including delivering the composition or modified cell described herein to a subject in need of adoptive immunotherapy.

[0089] A method of treating a disease or disorder, the method comprising delivering any one of the compositions or modified cells described herein to a subject, preferably wherein the disease or disorder is cancer.

[0090] According to an embodiment of the present invention, there is provided a composition, method, process, kit or use, characterized by one or more elements disclosed herein.

[0091] According to an embodiment of the present invention, the modified immune cells (e.g., T cells) obtained by the method are intended to be used as a medicament for treating cancer, infection or immune diseases in a subject in need thereof. Administration of the modified immune cells or a population thereof to the subject can be carried out in any convenient manner known in the art, including but not limited to aerosol inhalation, injection, ingestion, blood transfusion, implantation or transplantation. Injection or infusion can be carried out subcutaneously, intradermally, intratumorally, intranodally, intramedullarily, intramuscularly, by intravenous or lymphatic injection or intraperitoneally. According to an embodiment of the present invention, there is provided a method for adoptive cell therapy or prophylaxis, which comprises administering modified cells to a subject suffering from cancer or infection or determined to be at risk of suffering from cancer or infection.

[0092] According to an embodiment of the present invention, there is provided the use of any one of the compositions or modified cells described herein for reducing or preventing host-versus-graft response (HvG) during the treatment, amelioration or prophylaxis of cancer, disease or infection in a subject, including delivering the composition or modified cells to a subject experiencing or at risk of experiencing host-versus-graft rejection (HvG).

[0093] According to an embodiment of the present invention, there is provided a medicament comprising any one of the modified cells described herein for treating, ameliorating or preventing host-versus-graft rejection (HvG), such that the medicament is administered by delivering the composition to a subject experiencing or at risk of experiencing host-versus-graft rejection (HvG).

[0094] According to an embodiment of the present invention, there are provided RNA molecules for modifying cells (e.g., lymphocytes, T cells, CAR-T cells) to treat, ameliorate or prevent host-versus-graft rejection (HvG) in a subject. The RNA molecules can be delivered to the cells ex vivo, in vitro or in vivo.

[0095] According to an embodiment of the present invention, there is provided a kit for inactivating HLA-E alleles in cells, which comprises any one of the compositions described herein and instructions for delivering the composition to the cells.

[0096] According to an embodiment of the present invention, there is provided any one of the compositions or modified cells described herein for adoptive immunotherapy, including delivering the composition or modified cells to a subject in need of adoptive immunotherapy.

[0097] According to an embodiment of the present invention, there is provided a medicament for adoptive immunotherapy comprising any one of the compositions or modified cells described herein, wherein the medicament is administered by delivering the composition or modified cells to a subject in need of adoptive immunotherapy.

[0098] According to an embodiment of the present invention, there are provided cells modified by the methods described herein or modified using the compositions described herein.

[0099] According to an embodiment of the present invention, there is provided a gene editing composition comprising an RNA molecule, the RNA molecule comprising a guide sequence portion having 17 - 50 consecutive nucleotides, the 17 - 50 consecutive nucleotides containing the nucleotides shown in any one of SEQ ID NOs: 1 - 7830. In some embodiments, the RNA molecule further comprises a portion having a sequence that binds to a CRISPR nuclease. In some embodiments, the sequence that binds to a CRISPR nuclease is a tracrRNA sequence. In some embodiments, the RNA comprising the guide sequence portion is a crRNA molecule. In some embodiments, the RNA molecule comprising the guide sequence portion is a single guide RNA (sgRNA) molecule.

[0100] In some embodiments, the RNA molecule further comprises a portion having a tracr mate sequence.

[0101] In some embodiments, the RNA molecule may further comprise one or more linker portions.

[0102] According to an embodiment of the present invention, the length of the RNA molecule can be at most 1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110 or 100 nucleotides. Each possibility represents a separate embodiment. In an embodiment of the present invention, the length of the RNA molecule can be from 17 to at most 300 nucleotides, from 100 to at most 300 nucleotides, from 150 to at most 300 nucleotides, from 100 to at most 500 nucleotides, from 100 to at most 400 nucleotides, from 200 to at most 300 nucleotides, from 100 to 200 nucleotides, or from 150 to at most 250 nucleotides. Each possibility represents a separate embodiment.

[0103] According to some embodiments of the present invention, the composition further comprises a tracrRNA molecule.

[0104] According to an embodiment of the present invention, there is provided a method for inactivating HLA-E expression in a cell, the method comprising delivering to the cell a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830.

[0105] According to some embodiments of the present invention, there is provided a method for preventing host-versus-graft rejection (HvG), the method comprising delivering to a cell of a subject a composition comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830.

[0106] According to an embodiment of the present invention, at least one CRISPR nuclease and one or more RNA molecules are delivered to the subject and / or cell substantially simultaneously or at different times.

[0107] In some embodiments, the tracrRNA molecule is delivered to the subject and / or cell substantially simultaneously or at different times with the CRISPR nuclease and one or more RNA molecules.

[0108] The compositions and methods of the present disclosure can be used to treat, prevent, ameliorate, or slow the progression of host-versus-graft rejection (HvG).

[0109] Any one or a combination of the strategies for inactivating HLA-E expression described herein can be used in the context of the present invention.

[0110] In an embodiment of the present invention, the guide RNA molecule is used to direct the CRISPR nuclease to an exon or splice site of the HLA-E allele to produce a double-strand break (DSB), thereby resulting in the insertion or deletion of nucleotides and the formation of a frameshift mutation in the HLA-E allele by inducing the error-prone non-homologous end joining (NHEJ) mechanism. The frameshift mutation can result in inactivation or knockout of the HLA-E allele, for example, by generating an early stop codon in the HLA-E allele, and nonsense-mediated mRNA decay of the truncated protein or allelic transcript. In a further embodiment, one RNA molecule is used to direct the CRISPR nuclease to the promoter of the HLA-E allele.

[0111] In some embodiments, the method is used to treat a subject at risk of host-versus-graft rejection (HvG), which is a disease phenotype caused by the expression of the HLA-E gene. In such embodiments, the method results in the remission, improvement, or prevention of the disease phenotype.

[0112] Embodiments of the compositions described herein include at least one CRISPR nuclease, one or more guide RNA molecules, and optionally one or more tracrRNA molecules, which are effective simultaneously in a subject or cell. The at least one CRISPR nuclease, one or more guide RNA molecules, and optionally one or more tracrRNA molecules can be delivered substantially simultaneously, or can be delivered at different times but have an effect simultaneously. For example, this includes delivering the CRISPR nuclease to a subject or cell before the guide RNA molecule and / or tracrRNA molecule is substantially present in the subject or cell.

[0113] In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is a T cell. In some embodiments, the cell is a T regulatory cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a natural killer (NK) cell. In some embodiments, the cell is a macrophage. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a fibroblast, blood cell, hepatocyte, keratinocyte, or any other cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC). HLA-E Editing Strategy

[0114] The present invention provides a method for knocking out the HLA-E allele in a subject's cells, thereby improving the performance of such cells or cells derived from such cells in adoptive transfer therapy. The present invention also provides a method for knocking out the HLA-E allele in a subject's cells, thereby avoiding host-versus-graft rejection (HvG) after adoptive transfer of these cells or cells derived therefrom to a subject in need of adoptive transfer.

[0115] HLA-E editing strategies include, but are not limited to, bi-allelic knockout by targeting any one or combination of exons 1-7, including within thirty nucleotides upstream and downstream of the exons flanking the splice donor and acceptor sites, since frameshifts in these exons result in non-functional truncated HLA-E proteins or nonsense-mediated decay of mutant HLA-E transcripts. CRISPR Nuclease and PAM Recognition

[0116] In some embodiments, the sequence-specific nuclease is selected from CRISPR nucleases or functional variants thereof. In some embodiments, the sequence-specific nuclease is an RNA-guided DNA nuclease. In such embodiments, the RNA sequence of the RNA-guided DNA nuclease (e.g., Cpf1) binds to all HLA-E alleles in the cell and / or directs the RNA-guided DNA nuclease to all HLA-E alleles in the cell. In some embodiments, the CRISPR complex does not further comprise a tracrRNA. Those skilled in the art will understand that RNA molecules can be engineered by methods well known in the art to bind to selected targets in the genome.

[0117] As used herein, the term "PAM" refers to the nucleotide sequence of the target DNA that is located near the target DNA sequence and is recognized by the CRISPR nuclease complex. The PAM sequence can vary depending on the identity of the nuclease. In addition, there are CRISPR nucleases that can target almost all PAMs. In some embodiments of the present invention, the CRISPR system utilizes one or more RNA molecules having a guide sequence portion to direct the CRISPR nuclease to the target DNA site through Watson-Crick base pairing between the guide sequence portion and the protospacer of the target DNA site, which is adjacent to the protospacer adjacent motif (PAM), which is an additional requirement for target recognition. The CRISPR nuclease then mediates cleavage of the target DNA site to generate a double-strand break within the protospacer. In one non-limiting example, the type II CRISPR system utilizes a mature crRNA:tracrRNA complex that directs the CRISPR nuclease (e.g., Cas9) to the target DNA through Watson-Crick base pairing between the guide sequence portion of the crRNA and the protospacer on the target DNA that is adjacent to the protospacer adjacent motif (PAM).Those skilled in the art will understand that each of the engineered RNA molecules of the present invention is further designed to associate with a target genomic DNA sequence adjacent to a protospacer adjacent motif (PAM), such as a PAM that matches the sequence associated with the type of CRISPR nuclease utilized. For non-limiting examples, NGG or NAG for Streptococcus pyogenes Cas9 WT (SpCAS9), where "N" is any nucleobase; NNGRRT for Staphylococcus aureus (SaCas9); NNNVRYM for Campylobacter jejuni Cas9 WT; NGAN or NGNG for SpCas9-VQR variant; NGCG for SpCas9-VRER variant; NGAG for SpCas9-EQR variant; NRRH for SpCas9-NRRH variant, where N is any nucleobase, R is A or G and H is A, C or T; NRTH for SpCas9-NRTH variant, where N is any nucleobase, R is A or G and H is A, C or T; NRCH for SpCas9-NRCH variant, where N is any nucleobase, R is A or G, and H is A, C or T; NG for SpG variant of SpCas9, where N is any nucleobase; NG or NA for SpCas9-NG variant of SpCas9, where N is any nucleobase; NR or NRN or NYN for SpRY variant of SpCas9, where N is any nucleobase, R is A or G and Y is C or T; NNG for Streptococcus canis Cas9 variant (ScCas9), where N is any nucleobase; NNNRRT for SaKKH-Cas9 variant (SaCas9) of Staphylococcus aureus, where N is any nucleobase, and R is A or G; NNNNGATT for Neisseria meningitidis (NmCas9), where N is any nucleobase; TTN for Alicyclobacillus acidocaldarius Cas12b (AacCas12b), where N is any nucleobase; or TTTV for Cpfl, where V is A, C or G. Each of the RNA molecules of the present invention is designed to bind to one or more different CRISPR nucleases to form a complex and is designed to target a polynucleotide sequence of interest using one or more different PAM sequences corresponding to the CRISPR nuclease utilized.

[0118] In some embodiments, RNA-guided DNA nucleases, such as CRISPR nucleases, can be used to cause DNA breaks at desired locations in the cell genome, whether substantially double-stranded or single-stranded. The most commonly used RNA-guided DNA nucleases are derived from the CRISPR system. However, other RNA-guided DNA nucleases are also contemplated for use in the genomic editing compositions and methods described herein. See, for example, U.S. Patent Publication No. 2015 / 0211023, which is incorporated herein by reference.

[0119] The CRISPR systems useful in the practice of the present invention vary widely. The CRISPR system can be a type I, type II, or type III system. Non-limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, Casl0, Casl Od, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966.

[0120] In some embodiments, the RNA-guided DNA nuclease is a CRISPR nuclease derived from a type II CRISPR system (e.g., Cas9). The CRISPR nuclease can be from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.) Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp.) Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, or any species encoding a CRISPR nuclease with a known PAM sequence. CRISPR nucleases encoded by uncultured bacteria can also be used in the context of the present invention. (See Burstein et al., Nature, 2017). CRIPR protein variants with known PAM sequences, such as SpCas9 D1135E variant, SpCas9VQR variant, SpCas9 EQR variant, or SpCas9 VRER variant, can also be used in the context of the present invention.

[0121] Thus, RNA-guided DNA nucleases of the CRISPR system, such as Cas9 protein or modified Cas9 or homologs or orthologs of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs and orthologs, can be used in the compositions of the present invention. Other CRISPR nucleases can also be used, such as the nucleases described in PCT International Application Publication Nos. WO2020 / 223514 and WO2020 / 223553, which are incorporated herein by reference.

[0122] In certain embodiments, the CRISPR nuclease can be a "functional derivative" of a naturally occurring Cas protein. A "functional derivative" of a native sequence polypeptide is a compound having the same qualitative biological properties as the native sequence polypeptide. "Functional derivatives" include, but are not limited to, fragments of the native sequence and derivatives of the native sequence polypeptide and its fragments, provided that they have the same biological activity as the corresponding native sequence polypeptide. The biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments. The term "derivative" includes amino acid sequence variants, covalent modifications, and fusions of the polypeptide. Suitable derivatives of the Cas polypeptide or its fragment include, but are not limited to, mutants, fusions, and covalent modifications of the Cas protein or its fragment. Derivatives include, but are not limited to, CRISPR nickases, catalytically inactive or "dead" CRISPR nucleases, and fusions of the CRISPR nuclease or its derivative with other enzymes such as base editors or retrotransposons. See, for example, Anzalone et al. (2019) and PCT International Application No. PCT / US2020 / 037560.

[0123] In some embodiments, a CRISPR nuclease or a derivative thereof can be fused to a protein having enzymatic activity. In some embodiments, the enzymatic activity modifies the target DNA. In some embodiments, the enzymatic activity is nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity. In some cases, the enzymatic activity is nuclease activity. In some cases, the nuclease activity introduces a double-strand break in the target DNA. In some cases, the enzymatic activity modifies a target polypeptide associated with the target DNA. In some cases, the enzymatic activity is methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity, or demyristoylation activity. In some cases, the target polypeptide is a histone and the enzymatic activity is methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, or deubiquitination activity.

[0124] Cas proteins, which include Cas proteins or fragments thereof, and derivatives of Cas proteins or fragments thereof, can be obtained from cells or chemically synthesized or obtained by a combination of these two methods. The cells can be cells that naturally produce Cas proteins, or cells that naturally produce Cas proteins and have been genetically engineered to produce endogenous Cas proteins at a higher expression level or to produce Cas proteins from an exogenous nucleic acid that encodes a Cas that is the same as or different from the endogenous Cas. In some cases, the cells do not naturally produce Cas proteins and have been genetically engineered to produce Cas proteins.

[0125] In some embodiments, the CRISPR nuclease is Cpf1. Cpf1 is a single-RNA-guided endonuclease that utilizes a T-rich protospacer adjacent motif. Cpf1 cleaves DNA through staggered DNA double-strand breaks. Two Cpf1 enzymes from Acidaminococcus and Lachnospiraceae have been shown to perform efficient genome editing activity in human cells. (See Zetsche et al., 2015).

[0126] Accordingly, RNA-guided DNA nucleases of type II CRISPR systems, such as Cas9 protein or modified Cas9 or homologs, orthologs or variants of Cas9, or other RNA-guided DNA nucleases belonging to other CRISPR system types, such as Cpf1 and its homologs, orthologs or variants, can be used in the present invention.

[0127] In some embodiments, the guide molecule comprises one or more chemical modifications that confer new or improved properties (e.g., improved degradation stability, improved hybridization energy characteristics or improved binding properties to the RNA-guided DNA nuclease). Suitable chemical modifications include, but are not limited to: modified bases, modified sugar moieties or modified internucleoside linkages. Non-limiting examples of suitable chemical modifications include: 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methyluridine, "β, D-galactosylqueuosine", 2'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, "2,2-dimethylguanosine", 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, "β, D-mannosylqueuosine", 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyguanosine, 2-methylthio-N6-isopentenyladenosine, N-((9-β-D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-β-D-ribofuranosylpurine-6-yl)N-methylcarbamoyl)threonine, uridine-5-hydroxyacetate methyl ester, uridine-5-hydroxyacetate, wybutoxosine, queuosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-β-D-ribofuranosylpurine-6-yl)-carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, wybutosine, "3-(3-amino-3-carboxypropyl)uridine, (acp3)u", 2'-O-methyl (M), 3'-thiophosphate (MS), 3'-thioPACE (MSP), pseudouridine or 1-methylpseudouridine. Each possibility represents a separate embodiment of the present invention.

[0128] In addition to targeting HLA-E alleles by RNA-guided CRISPR nucleases, other means of inhibiting HLA-E expression in target cells include, but are not limited to, the use of gapmers, shRNAs, siRNAs, custom TALENs, meganucleases or zinc finger nucleases, small molecule inhibitors, and any other methods known in the art for reducing or eliminating gene expression in target cells. See, e.g., U.S. Patent Nos. 6,506,559; 7,560,438; 8,420,391; 8,552,171; 7,056,704; 7,078,196; 8,362,231; 8,372,968; 9,045,754; and PCT International Publication Nos. WO / 2004 / 067736; WO / 2006 / 097853; WO / 2003 / 087341; WO / 2000 / 041566l; WO / 2003 / 080809; WO / 2010 / 079430; WO / 2010 / 079430; WO / 2011 / 072246; WO / 2018 / 057989; and WO / 2017 / 164230, the entire contents of each of which are incorporated herein by reference.

[0129] Advantageously, when complexed with a CRISPR nuclease in a cell, the guide RNA molecules provided herein provide improved HLA-E knockout efficiency relative to other guide RNA molecules. These specially designed sequences can also be used to identify HLA-E target sites for other nucleotide-targeted gene editing or gene silencing methods, such as siRNAs, TALENs, meganucleases or zinc finger nucleases. Delivery to Cells

[0130] Any of the compositions described herein can be delivered to target cells by any suitable means. The RNA molecule compositions of the invention can target any cell containing and / or expressing an HLA-E allele, such as mammalian lymphocytes or stem cells. For example, in one embodiment, the RNA molecule specifically targets the HLA-E allele of the target cell, and the target cell is a lymphocyte, T cell, T regulatory cell, B cell, natural killer (NK) cell, macrophage, stem cell or fibroblast, blood cell, hepatocyte, keratinocyte or any other cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC). Delivery to the cell can be carried out in vivo, ex vivo or in vitro. In addition, the nucleic acid compositions described herein can be delivered to the cell as one or more of a DNA molecule, an RNA molecule, a ribonucleoprotein (RNP), a nucleic acid vector, or any combination thereof.

[0131] In some embodiments, the RNA molecule comprises a chemical modification. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl, 3'-thiol phosphate (MS), or 2'-O-methyl, 3'-thiol PACE (MSP), pseudouridine, and 1-methylpseudouridine. Each possibility represents a separate embodiment of the invention.

[0132] In some embodiments, any of the compositions described herein are delivered in vivo to a cell. The compositions can be delivered to the cell by any known in vivo delivery method, including but not limited to viral transduction, e.g., using lentivirus or adeno-associated virus (AAV), nanoparticle delivery, etc. Additional detailed delivery methods are described in this section.

[0133] In some embodiments, any of the compositions described herein are delivered ex vivo to a cell. The compositions can be delivered to the cell by any known ex vivo delivery method, including but not limited to nucleofection, electroporation, viral transduction, e.g., using lentivirus or adeno-associated virus (AAV), nanoparticle delivery, liposomes, etc. Additional detailed delivery methods are described in the examples of this section.

[0134] Any suitable viral vector system can be used to deliver nucleic acid compositions, such as the RNA molecule compositions of the invention. Conventional viral- and non-viral-based gene transfer methods can be used to introduce nucleic acids into target tissues. In certain embodiments, the nucleic acids are administered for in vivo or ex vivo gene therapy applications. Non-viral vector delivery systems include naked nucleic acids and nucleic acids complexed with delivery vectors such as liposomes or poloxamers. For reviews of gene therapy methods, see Anderson (1992); Nabel & Felgner (1993); Mitani & Caskey (1993); Dillon (1993); Miller (1992); Van Brunt (1988); Vigne (1995); Kremer & Perricaudet (1995); Haddada et al. (1995); and Yu et al. (1994).

[0135] Non-viral delivery methods of nucleic acids and / or proteins include electroporation, lipofection, microinjection, gene gun, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNP), polycations or lipid:nucleic acid conjugates, artificial virosomes, and reagent-enhanced nucleic acid uptake, or can be delivered to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium NGR234, Sinorhizobium meliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus, and cassava vein mosaic virus). (See, e.g., Chung et al., 2006) Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also considered as an in vivo, ex vivo, or in vitro delivery method. (See Zuri et al. (2015); also see Coelho et al. (2013); Judge et al. (2006); and Basha et al. (2011)).

[0136] Non-viral vectors, such as transposon-based systems, such as the recombinant Sleeping Beauty transposon system or the recombinant PiggyBac transposon system, can also be delivered to target cells and used for transposition of a polynucleotide sequence of a composition molecule or a polynucleotide sequence encoding a composition molecule in the target cells.

[0137] Other exemplary nucleic acid delivery systems include those provided by Amaxa.RTM. Biosystems (Cologne, Germany), Maxyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics, Inc. (See, e.g., U.S. Patent No. 6,008,336). Lipofection is described, for example, in U.S. Patent No. 5,049,386, U.S. Patent No. 4,946,787; and U.S. Patent No. 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam.TM., Lipofectin.TM., and Lipofectamine.TM. RNAiMAX). Cationic and neutral lipids suitable for efficient receptor recognition of polynucleotide lipofection include those disclosed in PCT International Publication Nos. WO / 1991 / 017424 and WO / 1991 / 016024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).

[0138] Preparation of Lipids: Nucleic acid complexes, including targeted liposomes such as immunolipid complexes, are well known to those skilled in the art (see, e.g., Crystal, Science (1995); Blaese et al., (1995); Behr et al., (1994); Remy et al., (1994); Gao and Huang (1995); Ahmad and Allen (1992); U.S. Patent Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028; and 4,946,787).

[0139] Other delivery methods include using an EnGeneIC delivery vehicle (EDV) to package the nucleic acid to be delivered. A bispecific antibody is used to specifically deliver these EDVs to the target tissue, where one arm of the antibody is specific for the target tissue and the other arm is specific for the EDV. The antibody brings the EDV to the surface of the target cell, and then the EDV is taken into the cell by endocytosis. Once inside the cell, the contents are released (see MacDiarmid et al., 2009).

[0140] Delivery vehicles include but are not limited to bacteria (preferably non-pathogenic), vectors, nanoparticles, exosomes, microvesicles, gene gun delivery (e.g., by attaching the composition to gold particles, which are fired into the cell using a "gene gun"), viral vehicles (including but not limited to lentiviruses, AAVs, and retroviruses), virus-like particles (VLPs), large VLPs (LVLPs), lentivirus-like particles, transposons, viral vectors, naked vectors, DNA or RNA, and other delivery vehicles known in the art.

[0141] Delivery of CRISPR nucleases and / or polynucleotides encoding CRISPR nucleases and optionally additional nucleotide molecules and / or additional proteins or peptides can be carried out by utilizing a single delivery mediator or method or a combination of different delivery mediators or methods. For example, CRISPR nucleases can be delivered to cells using LNPs, and crRNA molecules and tracrRNA molecules can be delivered to cells using AAVs. Alternatively, CRISPR nucleases can be delivered to cells using AAV particles, and crRNA molecules and tracrRNA molecules can be delivered to cells using separate AAV particles, which may be advantageous due to size limitations.

[0142] The use of RNA- or DNA-virus-based systems for virus-mediated nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. Viral vectors can be administered directly to a patient (in vivo), or they can be used to treat cells ex vivo and the modified cells are administered to the patient (ex vivo). Conventional virus-based systems for delivering nucleic acids include, but are not limited to, retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, vaccinia, and herpes simplex virus vectors for gene transfer. RNA viruses can be used to deliver the compositions described herein. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues. The nucleic acids of the invention can be delivered by non-integrating lentiviruses. Optionally, RNA is delivered using lentiviruses. Optionally, the lentivirus comprises mRNA of a nuclease and a guide RNA molecule. Optionally, the lentivirus comprises a nuclease protein and a guide RNA molecule. Optionally, the lentivirus comprises mRNA of a nuclease, a guide RNA molecule, and a tracrRNA molecule. Optionally, the lentivirus comprises a nuclease protein, a guide RNA molecule, and a tracrRNA molecule.

[0143] The tropism of retroviruses can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors capable of transducing or infecting non-dividing cells and generally producing high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats with the packaging capacity for exogenous sequences up to 6-10 kb. The minimal cis-acting LTR is sufficient for replication and packaging of the vector, which is then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchschacher et al. (1992); Johann et al. (1992); Sommerfelt et al. (1990); Wilson et al. (1989); Miller et al. (1991); PCT International Publication No. WO / 1994 / 026877A1).

[0144] Currently, at least six viral vector methods are available for gene transfer in clinical trials, which utilize methods involving complementing defective vectors by inserting genes into helper cell lines to produce transducing agents.

[0145] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (see Dunbar et al., 1995; Kohn et al., 1995; Malech et al., 1997). PA317 / pLASN was the first therapeutic vector used in a gene therapy trial (Blaese et al., 1995). For the MFG-S packaged vector, transduction efficiencies of 50% or higher have been observed. (Ellem et al., (1997); Dranoff et al., 1997).

[0146] Packaging cells are used to form virus particles capable of infecting host cells. These cells include 293 cells, which package adenovirus, AAV, and Psi-2 cells or PA317 cells, which package retroviruses. Viral vectors for gene therapy are usually produced by a producer cell line that packages the nucleic acid vector into virus particles. The vector typically contains the minimal viral sequences required for packaging and subsequent integration into the host (if applicable), and other viral sequences are replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are provided in trans by the packaging cell line. For example, AAV vectors for gene therapy usually only have the inverted terminal repeat (ITR) sequences from the AAV genome, which are necessary for packaging and integration into the host genome. The viral DNA is packaged in a cell line that contains a helper plasmid encoding the other AAV genes, rep and cap, but lacking the ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus facilitates the replication of the AAV vector and the expression of the AAV genes in the helper plasmid. Since the helper plasmid lacks the ITR sequences, it cannot be packaged in large amounts. Adenovirus contamination can be reduced by, for example, heat treatment to which adenovirus is more sensitive than AAV. In addition, AAV can be produced at a clinical scale using a baculovirus system (see U.S. Patent 7,479,554).

[0147] In many gene therapy applications, it is desirable for gene therapy vectors to be delivered with a high degree of specificity to a particular tissue type. Thus, viral vectors can be modified to be specific for a given cell type by expressing, on the outer surface of the virus, a ligand as a fusion protein with a viral coat protein. A ligand is selected that has an affinity for a receptor known to be present on the target cell type. For example, Han et al. (1995) reported that Moloney murine leukemia virus can be modified to express heregulin fused to gp70, and that this recombinant virus infects certain human breast cancer cells that express the human epidermal growth factor receptor. This principle can be extended to other virus - target cell pairs, where the target cell expresses a receptor and the virus expresses a fusion protein that includes a ligand for the cell surface receptor. For example, filamentous bacteriophages can be engineered to display antibody fragments (e.g., FAB or Fv) that have specific binding affinity for almost any selected cell receptor. Although the foregoing description applies primarily to viral vectors, the same principle can be applied to non - viral vectors. Such vectors can be engineered to include specific uptake sequences that facilitate uptake by a particular target cell.

[0148] Gene therapy vectors can be delivered in vivo by administration to an individual patient, for example, by systemic administration (e.g., intravitreal, intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or local administration.

[0149] Alternatively, the vector can be delivered ex vivo to cells, such as cells transplanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsies) or universal donor hematopoietic stem cells, and then, optionally, after selecting the cells that have incorporated the vector, the cells are re - implanted into the patient. Non - limiting exemplary ex vivo methods can include removing tissue (e.g., peripheral blood, bone marrow, and spleen) from a patient for culture, transferring the nucleic acid to the cultured cells (e.g., hematopoietic stem cells), and then transplanting the cells into the target tissue of the patient (e.g., bone marrow and spleen). In some embodiments, the stem cells or hematopoietic stem cells can be further treated with a viability enhancer.

[0150] Ex vivo transfection of cells for diagnostic, research, or for gene therapy (e.g., by re - infusing the transfected cells into the host organism) is well known to those skilled in the art. In a preferred embodiment, cells are isolated from a subject organism, transfected with a nucleic acid composition, and re - infused back into the subject organism (e.g., a patient). A variety of cell types suitable for ex vivo transfection are well known to those skilled in the art (see, e.g., Freshney, “Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications” (6th ed., 2010) and the references cited therein regarding how to isolate and culture cells from a patient).

[0151] Vectors containing therapeutic nucleic acid compositions (e.g., retroviruses, liposomes, etc.) can also be administered directly to an organism for in vivo cell transduction. Administration is by any route commonly used to introduce molecules into contact with blood or tissue cells ultimately, including but not limited to injection, infusion, topical application (such as eye drops and eye creams), and electroporation. Suitable methods of administering such nucleic acids are available to and well known to those of skill in the art, and although more than one route can be used to administer a particular composition, a particular route generally can provide a more direct and more effective response than another route. According to some embodiments, the composition is delivered by IV injection.

[0152] Vectors suitable for introducing transgenes into immune cells (e.g., T cells) include non-integrating lentiviral vectors. See, e.g., U.S. Patent Publication No. 2009 / 0117617.

[0153] As described above, the compositions described herein can be delivered to target cells using non-integrating lentiviral particle methods, such as the systems described. This method can be used to deliver mRNA or other types of RNA into target cells such that delivery of the RNA into the target cells results in the assembly of the compositions described herein within the target cells. See also PCT International Publication Nos. WO / 2013 / 014537, WO / 2014 / 016690, WO / 2016 / 185125, WO / 2017 / 194902, and WO / 2017 / 194903.

[0154] The pharmaceutically acceptable carrier is determined in part by the particular composition being administered and the particular method for administering that composition. Thus, as described below, a variety of suitable pharmaceutical composition formulations are available (see, e.g., Remington's Pharmaceutical Sciences, 17th Edition, 1989). Examples of RNA Guide Sequences Specifically Targeting Alleles of the HLA-E Gene

[0155] Although a large number of guide sequences can be designed to target the HLA-E gene, the nucleotide sequences described in Table 1 and identified by SEQ ID NO: 1-7830 were specifically selected to effectively implement the methods described herein.

[0156] Table 1 lists guide sequences designed for the uses described in the above embodiments to associate with specific sequences within HLA-E alleles. Each engineered guide molecule is further designed to associate with a target genomic DNA sequence that is adjacent to a protospacer adjacent motif (PAM), such as a PAM that matches the sequence NGG or NAG, where "N" is any nucleobase. The guide sequences are designed to act in concert with one or more different CRISPR nucleases, including but not limited to, for example, SpCas9WT (PAM SEQ: NGG), SpCas9.VQR.1 (PAM SEQ: NGAN), SpCas9.VQR.2 (PAM SEQ: NGNG), SpCas9.EQR (PAM SEQ: NGAG), SpCas9.VRER (PAM SEQ: NGCG), SaCas9WT (PAM SEQ: NNGGRT), SpRY (PAM SEQ: NRN or NYN), NmCas9WT (PAM SEQ: NNNNGATT), Cpf1 (PAM SEQ: TTTV), JeCas9WT (PAM SEQ: NNNVRYM), OMNI-50 (PAM SEQ: NGG), OMNI-79 (PAM SEQ: NGG), OMNI-103 (PAM SEQ: NNRACT), OMNI-159 (NNNNCMAN) or OMNI-124 (PAM SEQ: NNGNRMNN).

[0157] Additional descriptions of the OMNI CRISPR nucleases are provided in PCT International Application Publication No. WO 2023 / 019269 A2, PCT International Application Publication No. WO 2022 / 170199A2 and WO 2023 / 107946 A2, U.S. Patent No. 11,666,641B2 and PCT International Application Publication No. WO 2020 / 223514A2, WO 2022 / 098693A1 and WO 2023 / 019263A1, U.S. Application Publication No. 2023 / 0122086A1 and PCT International Application Publication No. WO 2021 / 248016 A2 and WO 2023 / 102407 A2, PCT International Application Publication No. WO 2022 / 087135 A1 and PCT International Application Publication No. WO 2022 / 226215 A1, the respective contents of which are incorporated herein by reference.

[0158] Each of the RNA molecules of the present invention is designed to bind to one or more different CRISPR nucleases to form a complex and is designed to target a target polynucleotide sequence using one or more different PAM sequences associated with the CRISPR nuclease used.

[0159] As used herein, the following nucleotide identifiers are used to denote the referenced nucleobases: Table 1: Guide sequences designed to associate with specific HLA-E gene targets The indicated positions listed in column 1 of Table 1 are based on the gnomAD v3 database and the UCSC Genome Browser assembly ID: hg38, sequencing / assembly provider ID: Genome Reference Consortium Human GRCh38.p12 (GCA_000001405.27). Assembly date: Initial release in December 2013; Patch release 12 in December 2017.

[0160] Examples are provided below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary modes of making and practicing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only. Experimental Details Example 1: HLA-E Modification Analysis

[0161] Guide sequences comprising 17 - 50 consecutive nucleotides, which contain the nucleotides in any of the sequences shown in SEQ ID NO: 1 - 7830, were screened using CRISPR nucleases in T cells to obtain high on-target activity. The on-target activity was determined by DNA capillary electrophoresis analysis. Example 2: HLA-E Editing in HeLa and Primary T Cells

[0162] Editing of HLA-E in HeLa cells and primary T cells using a subgroup of the publicly available CTL4-targeting guide sequence portion is shown in Figure 1 and Figure 2 .

[0163] A summary table of HLA-E editing data is shown below:

[0164] The OMNI-103 related sequences are provided in the table below: References 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20. 2. Anderson (1992) “Human gene therapy”, Science 256:808-13. 3. Anzalone et al. (2019) “Search-and-replace genomme editing without double-strand brakes or donor DNA”, Nature 576, 149-157. 4. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200. 5. Behr (1994) Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89. 6. Blaese (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97. 7. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80. 8. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731 - 39. 9. Burstein et al. (2017) “New CRISPR - Cas systems from uncultivated microbes”, Nature 542:237 - 41. 10. Chang and Wilson (1987) “Modification of DNA ends can decrease end - joining relative to homologous recombination in mammalian cells”, Proc. Natl. Acad. Sci. USA 84:4959 - 4963. 11. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11(1):1 - 4. 12. Coelho et al. (2013) “Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N. Engl. J. Med. 369, 819 - 829. 13. Collias and Beisel (2021) “CRISPR technologies and the search for the PAM - free nuclease”, Nature Communications 12, 555. 14. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404 - 10. 15. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167 - 173. 16. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1):111 - 23. 17. Dunbar et al. (1995) “Retrovirally marked CD34 - enriched peripheral blood and bone marrow cells contribute to long - term engraftment after autologous transplantation”, Blood 85:3048 - 57. 18. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte / macrophage - colony - stimulating - factor - tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10 - 20. 19. Gao and Huang (1995) “Cationic liposome - mediated gene transfer” Gene Ther. 2(10):710 - 22. 20.Haddada et al.(1995)“Gene Therapy Using Adenovirus Vectors”,in:TheMolecularRepertoire of Adenoviruses III:Biology and Pathogenesis,ed.Doerflerand pp.297-306. 21.Han et al.(1995)“Ligand-directed retro-viral targeting of humanbreast cancer cells”, Proc Natl Acad Sci U.S.A.92(21):9747-51. 22.Hu et al.(2018)“Evolved Cas9 variants with broad PAM compatibilityand high DNAspecificity”,Nature 556(7699):57-63. 23.Jinek et al.(2012)“A programmable dual-RNA-guided DNA endonucleasein adaptivebacterial immunity,”Science 337(6096):816-21. 24.Johan et al.(1992)“GLVR1,a receptor for gibbon ape leukemia virus,is homologousto a phosphate permease of Neurospora crassa and is expressed athigh levels in thebrain and thymus”,J Virol 66(3):1635-40. 25.Judge et al.(2006)“Design of noninflammatory synthetic siRNAmediating potent genesilencing in vivo”,Mol Ther.13(3):494-505. 26. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency”, Nature Medicine 1:1017-23. 27. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31-44. 28. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol. 27(7):643-51. 29. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocytes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38. 30. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220-24. 31. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60. 32. Mitani and Caskey (1993) “Delivering therapeutic genes–matching approach and application”, Trends in Biotechnology 11(5):162-66. 33. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211 - 15. 34. Nishimasu et al. (2018) “Engineered CRISPR - Cas9 nuclease with expanded targeting space”, Science 361(6408):1259 - 1262. 35. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA - Binding Molecules”, Bioconjugate Chem. 5(6):647 - 54. 36. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR - Cas9 Editing”, Scientific Reports 8:888, doi:10.1038 / s41598 - 018 - 19441 - 8. 37. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J.Virol. 64(12):6214 - 20. 38. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149 - 54. 39. Vigne et al. (1995) “Third - generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2):35 - 36. 40. Walton et al. (2020) “Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants”, Science 368(6488):290-296. 41. Weissman and Kariko (2015) “mRNA: Fulfilling the promise of gene therapy”, Molecular Therapy(9):1416-7. 42. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78. 43. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26. 44. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR- Cas system” Cell 163(3):759-71. 45. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80.

Claims

1. A method for inactivating alleles of the major histocompatibility complex, class I, E (HLA-E) gene in a cell, the method comprising introducing into the cell a composition comprising: at least one CRISPR nuclease, or a polynucleotide molecule encoding a CRISPR nuclease; and an RNA molecule comprising a guide sequence portion, or a polynucleotide molecule encoding the RNA molecule, wherein the complex of the CRISPR nuclease and the RNA molecule affects a double-strand break in the alleles of the HLA-E gene, and wherein the guide sequence portion of the RNA molecule comprises 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in any one of the sequences shown in SEQ ID NO: 1-7830.

2. The method according to claim 1, wherein the composition is introduced into cells of a subject or cultured cells.

3. The method according to any one of claims 1-2, wherein the cell is a lymphocyte, T cell, T regulatory cell, B cell, natural killer (NK) cell, macrophage, stem cell or fibroblast, blood cell, hepatocyte, keratinocyte or any other cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC).

4. The method according to any one of claims 1-2, wherein the cell is a hematopoietic stem cell (HSC), induced pluripotent stem cell (iPS cell), iPSC-derived cell, natural killer cell (NK), iPS-derived NK cell (iNK), T cell, innate-like T cell (iT), natural killer T cell (NKT), γδ T cell, iPSC-derived T cell, invariant NKT cell (iNKT), iPSC-derived NKT, monocyte or macrophage.

5. The method according to any one of claims 1-4, wherein the CRISPR nuclease and the RNA molecule are introduced into the cell at substantially the same time or at different times.

6. The method according to any one of claims 1-5, wherein an insertion or deletion mutation occurs in the alleles of the HLA-E gene in the cell.

7. The method according to claim 6, wherein the insertion or deletion mutation generates an early termination codon.

8. The method according to any one of claims 1-7, wherein the inactivation results in a truncated protein encoded by the mutated allele.

9. The method according to any one of claims 1-8, wherein the composition introduced into the cell further comprises a second RNA molecule comprising a guide sequence portion, wherein the guide sequence portion of the second RNA molecule comprises 17-50 consecutive nucleotides, and the 17-50 consecutive nucleotides contain nucleotides in any one of the sequences shown in SEQ ID NO: 1-7830, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

10. A method for inactivating alleles of the major histocompatibility complex, class I, E (HLA-E) gene in a cell, the method comprising Introducing a composition into the cell, the composition comprising: at least one CRISPR nuclease, or a polynucleotide molecule encoding a CRISPR nuclease; and an RNA molecule comprising a guide sequence portion, or a polynucleotide molecule encoding the RNA molecule, wherein the complex of the CRISPR nuclease and the RNA molecule affects a double-strand break in an allele of the HLA-E gene, wherein the guide sequence portion of the RNA molecule comprises 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in any one of the sequences shown in SEQ ID NOs: 1-7830, which are modified to contain 1, 2, 3, 4, or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion.

11. The method according to claim 10, wherein the guide sequence portion of the RNA molecule comprises 1, 2, 3, 4, or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion.

12. The method according to any one of claims 10 or 11, wherein the guide sequence portion provides higher targeting specificity for the complex of the CRISPR nuclease and the RNA molecule relative to a guide sequence portion having higher complementarity to an allele of the HLA-E gene.

13. The method according to any one of claims 10-12, wherein the composition introduced into the cell further comprises a second RNA molecule comprising a guide sequence portion, wherein the guide sequence portion of the RNA molecule comprises 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in any one of the sequences shown in SEQ ID NOs: 1-7830, or any one of SEQ ID NOs: 1-7830, which are modified to contain 1, 2, 3, 4, or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

14. A composition comprising an RNA molecule, the RNA molecule comprising a guide sequence portion comprising 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in any one of the sequences shown in SEQ ID NOs: 1-7830.

15. The composition according to claim 14, which further comprises a second RNA molecule comprising a guide sequence portion, wherein the guide sequence portion comprises 17-50 consecutive nucleotides, the 17-50 consecutive nucleotides containing nucleotides in any one of the sequences shown in SEQ ID NOs: 1-7830, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

16. A composition comprising an RNA molecule, the RNA molecule comprising a guide sequence portion comprising 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides comprising nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830, or any one of SEQ ID NOs: 1-7830, which is modified to contain 1, 2, 3, 4, or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion.

17. The composition of claim 16, further comprising a second RNA molecule comprising a guide sequence portion comprising 17-50 contiguous nucleotides, the 17-50 contiguous nucleotides comprising nucleotides in the sequence shown in any one of SEQ ID NOs: 1-7830, or any one of SEQ ID NOs: 1-7830, which is modified to contain 1, 2, 3, 4, or 5 nucleotide mismatches relative to the fully complementary target sequence of the guide sequence portion, preferably wherein the guide sequence portion of the second RNA molecule is different from the guide sequence portion of the first RNA molecule.

18. The composition of any one of claims 14-17, further comprising a CRISPR nuclease.

19. The composition of any one of claims 14-18, further comprising a tracrRNA molecule.

20. A cell modified by the method of any one of claims 1-13 or modified using the composition of any one of claims 14-19.

21. The modified cell of claim 20, wherein the cell is any one of the following, wherein the cell is a lymphocyte, T cell, T regulatory cell, B cell, natural killer (NK) cell, macrophage, stem cell or fibroblast, blood cell, hepatocyte, keratinocyte or any other cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC).

22. The modified cell of claim 20, wherein the cell is a hematopoietic stem cell (HSC), induced pluripotent stem cell (iPS cell), iPSC-derived cell, natural killer cell (NK), iPS-derived NK cell (iNK), T cell, innate-like T cell (iT), natural killer T cell (NKT), γδ T cell, iPSC-derived T cell, invariant NKT cell (iNKT), iPSC-derived NKT, monocyte or macrophage.

23. The modified cell of claim 20, wherein the cell is a stem cell or any cell type capable of being reprogrammed into an induced pluripotent stem cell (iPSC).

24. The modified cell of claim 23, wherein the stem cell differentiates after modification.

25. The modified cell of claim 24, wherein the stem cell differentiates into any one of a lymphocyte, T cell, T regulatory cell, B cell, natural killer (NK) cell, innate-like T cell (iT), natural killer T cell (NKT), γδ T cell, invariant NKT cell (iNKT), monocyte or macrophage.

26. A medicament comprising a composition according to any one of claims 14 - 19, for use in inactivating the HLA - E allele in cells, wherein the medicament is administered by delivering a composition according to any one of claims 14 - 19 to the cells.

27. Use of a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 for treating, ameliorating or preventing host - versus - graft rejection (HvG), comprising delivering a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 to a subject experiencing or at risk of experiencing host - versus - graft rejection (HvG).

28. A medicament comprising a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25, for use in treating, ameliorating or preventing host - versus - graft rejection (HvG), wherein the medicament is administered by delivering a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 to a subject experiencing host - versus - graft rejection (HvG) or at risk of experiencing host - versus - graft rejection.

29. A kit for inactivating the HLA - E allele in cells, comprising a composition according to any one of claims 14 - 19 and instructions for delivering the composition to the cells.

30. The kit according to claim 29, wherein the composition is delivered ex vivo to the cells.

31. A kit for treating or preventing host - versus - graft rejection (HvG) in a subject, comprising a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 and instructions for delivering the composition or modified cell to a subject experiencing host - versus - graft rejection (HvG) or at risk of experiencing host - versus - graft rejection (HvG).

32. Use of a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 for treating, ameliorating or preventing host - versus - graft rejection (HvG), comprising delivering a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 to a subject experiencing host - versus - graft rejection (HvG) or at risk of experiencing host - versus - graft rejection.

33. Use of a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 for adoptive immunotherapy, comprising delivering a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 to a subject in need of adoptive immunotherapy.

34. A medicament comprising a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25, for use in adoptive immunotherapy, wherein the medicament is administered by delivering the composition according to any one of claims 14 - 19 or the modified cell according to any one of claims 20 - 25 to a subject in need of adoptive immunotherapy.

35. A kit for administering adoptive immunotherapy to a subject, comprising a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25, and instructions for delivering the composition or modified cell to a subject in need of adoptive immunotherapy.

36. A composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25, for use in adoptive immunotherapy, the adoptive immunotherapy comprising delivering the composition according to any one of claims 14 - 19 or the modified cell according to any one of claims 20 - 25 to a subject in need of adoptive immunotherapy.

37. A method of treating a disease or disorder, the method comprising delivering a composition according to any one of claims 14 - 19 or a modified cell according to any one of claims 20 - 25 to the subject, preferably wherein the disease or disorder is cancer.

38. A composition, method, process, kit or use, characterized in that One or more elements disclosed herein.

Images