Sweet protein Brazilian sweet mutant with high sweetness and preparation method thereof
Patent Information
- Application Number
- CN202380080988.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-30
- Filing Date
- 2023-12-29
- Publication Date
- 2025-07-01
AI Technical Summary
It is difficult to efficiently express high-sweetness brasilienin through genetic engineering means with the existing technology, and the traditional method has low brasilin sweetness and cannot meet the low-cost demand for industrial production.
The Rhizopus oryzae lipase leader peptide sequence is fused with the Brazilian sweet sequence, and the filamentous fungal host is used to express the fusion sequence to prepare high-sweetness Brazilian sweet and its mutants. By increasing the sweetness, the production cost is reduced, and the sweet taste is improved. performance.
The highest sweetness improvement of Brazilian sweet and its mutants has been achieved. The sweetness sensory performance is close to that of sucrose, which reduces the production cost and can be successfully used as a substitute for sucrose in yogurt drinks and sparkling water.
Smart Images

Figure CN120239707A_ABST
Abstract
Description
Sweet protein Brazilian sweet mutant with high sweetness and preparation method thereof
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to Chinese patent application number CN202211722591.4, filed December 30, 2022, which is incorporated herein by reference in its entirety. Technical Field
[0003] The present invention relates to thaumatin and its mutants, in particular to brazilian melaleuca and its mutants, and also to a preparation method of brazilian melaleuca and its mutants. Background Art
[0004] Excessive sugar intake is one of the biggest challenges to human health in the world today, with the resulting problems of obesity, overweight, and diabetes becoming increasingly prominent. With rising health awareness, low sugar and sugar reduction have become a common pursuit for consumers and businesses. Plant sweeteners are a highly sweet and low-calorie non-sugar protein sweetener. As a sucrose substitute, they do not cause hypertension, hyperlipidemia, or diabetes, and have huge market potential in the food and pharmaceutical industries (Mooradian et al., The role of artificial and natural sweeteners in reducing the consumption of table sugar: A narrative review. Clin Nutr ESPEN. 2017; 18:1-8). [1] .
[0005] Brazzein is a sweet protein extracted from the fruit of the West African climbing plant Pentadiplandra brazzeana (Baillon). The protein is composed of 54 amino acids and is characterized as a monomeric protein with a molecular weight of 6.5kDa (Faus, Recent developments in the characterization and biotechnological production of sweet-tasting proteins. Applied Microbiology & Biotechnology, 2000, 53(2):145-51). Its molecule contains four pairs of disulfide bonds (Cys4-Cys52, Cys16-Cys37, Cys22-Cys47, and Cys26-Cys49), which are the structural basis for its good stability. Calculated by weight, brazzein is 500 to 2000 times sweeter than sucrose. Its sweetness is similar to sucrose, with a clean sweetness and a long aftertaste. Compared to other sweet proteins, brazilian sweetener has the smallest molecular weight and the best water solubility. Its aqueous solution retains its sweetness even after heat treatment at 80°C for 4 hours. It also has good thermal and pH stability, making it suitable for many industrial food manufacturing processes. Therefore, brazilian sweetener is an ideal alternative to traditional sweeteners.
[0006] However, obtaining brazzein directly from plants or by chemical synthesis is difficult and expensive, which cannot meet market demand. Efficient expression of brazzein through genetic engineering is particularly meaningful. Some researchers have used the Escherichia coli system to express brazzein. After induction, brazzein exists in the form of inclusion bodies (Assadi-Porter et al., Efficient production of recombinant brazzein, a small, heat-stable, sweet-tasting protein of plant origin. Arch Biochem Biophys. 2000 Apr 15; 376(2): 252-8). Proteins need inclusion bodies to show activity after redissolution and folding, but this process is usually complicated, and the renatured samples may not necessarily have biological activity (Lt et al., Heterologous expression and protein engineering of wheat gluten proteins. Journal of Cereal Science, 2006, 43(3): 259-274). Moreover, heterologous protein expression using inclusion bodies usually requires multiple purification steps, which makes such systems less suitable for large-scale production. Meng et al. (Meng Shanshan et al., Expression and Application of Sweet Protein Brazzein in Pichia pastoris. Food and Fermentation Industries, 2020, 46(15):6) attempted to use the Pichia pastoris expression system to express brazzein. Although the protein could be secreted, its sweetness was only 40 times that of the same mass of sucrose. Obviously, the activity of brazzein expressed by Pichia pastoris is obviously insufficient. The main reason is the structural complexity of brazzein, especially the presence of numerous cysteine residues. Improper folding of proteins will lead to the loss of protein activity during secretion. Similarly, Lee et al. (Lee et al., Expression of synthetic thaumatin genes in yeast. Biochemistry, 1988, 27(14):5101) also successfully used yeast to express another sweet protein, thaumatin, but yeast cells do not have the ability to process it into a sweetening function.
[0007] Chinese patent CN102498126A uses Aspergillus oryzae as a host to express brassica oleracea. The brassica oleracea expressed thereby has a certain sweetness function, but its sweetness is only about 510 times that of sucrose of the same weight, and the protein has a significant sweetness delay.
[0008] Summary of the Invention
[0009] In light of these facts, and to meet the growing demand for low-sugar and reduced-sugar consumption, the inventors have developed a method for preparing a highly sweet Brazilian sweetener and its mutants. These products exhibit significantly higher sweetness than existing Brazilian sweeteners, while also producing a protein with no noticeable sweetness lag, resulting in a taste closer to sucrose. Furthermore, this method meets the requirements of industrial production, significantly reducing production costs due to the significantly enhanced sweetness.
[0010] In one aspect, provided herein is a method for preparing brazilian or a mutant thereof, comprising:
[0011] 1) constructing an expression vector comprising a coding sequence of the brazilian sweet or a mutant thereof and a coding sequence of a leader peptide, wherein the leader peptide is derived from Rhizopus oryzae lipase; and
[0012] 2) Introducing the expression vector into host cells.
[0013] In some embodiments, the Brazilian sweet includes the amino acid sequence shown in SEQ ID NO: 1; the mutant includes an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and has a sweet taste.
[0014] In some embodiments, the sweetness threshold of the brazilian sweet or its mutant is lower than 100 μg / mL, preferably lower than 10 μg / mL, more preferably lower than 1 μg / mL.
[0015] In some embodiments, the mutant comprises the amino acid substitutions E35D, E40A, E40D, E40K, E40R, H30R, or any combination thereof.
[0016] In some embodiments, the mutant comprises any of the following amino acid substitution combinations:
[0017] 1)E35D / E40A;
[0018] 2) E35D / E40D;
[0019] 3)E35D / E40K;
[0020] 4)E35D / E40R;
[0021] 5)H30R / E35D / E40A;
[0022] 6) H30R / E35D / E40K; and
[0023] 7)H30R / E35D / E40R.
[0024] In some embodiments, the mutant comprises the amino acid sequence shown in any one of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, and SEQ ID NO: 15.
[0025] In some embodiments, the leader peptide comprises the amino acid sequence of SEQ ID NO: 17, or an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 17.
[0026] In some embodiments, the brazilian sweet or its mutant is expressed in the form of a fusion protein with the leader peptide; preferably, the leader peptide is located at the N-terminus of the fusion protein.
[0027] In some embodiments, the expression vector further comprises a coding sequence of a short peptide that provides a protease cleavage site, and the coding sequence of the short peptide is located between the coding sequence of the leader peptide and the coding sequence of brazilian sweet or its mutant.
[0028] In some embodiments, the short peptide comprises the amino acid sequence VALEKR.
[0029] In some embodiments, the expression vector further comprises a coding sequence for a signal peptide; preferably, the signal peptide is derived from Aspergillus oryzae α-amylase.
[0030] In some embodiments, the expression vector further comprises a promoter and a terminator sequence; preferably, the promoter and the terminator are from the Aspergillus oryzae α-amylase gene.
[0031] In some embodiments, the expression vector comprises a selection gene, preferably the amdS gene.
[0032] In some embodiments, the host cell is a filamentous fungus, preferably Aspergillus oryzae, more preferably Aspergillus oryzae NBRC4177.
[0033] In another aspect, provided herein is brazilian sweet or a mutant thereof prepared by the above method.
[0034] In another aspect, provided herein is a nucleic acid molecule comprising a coding sequence for the above-mentioned brazilian sweet or a mutant thereof.
[0035] On the other hand, provided herein is an expression vector comprising a coding sequence of brazilian sweet or a mutant thereof prepared by the above method and a coding sequence of a leader peptide, wherein the leader peptide is derived from Rhizopus oryzae lipase.
[0036] In some embodiments, the expression vector further comprises a coding sequence for a short peptide providing a protease cleavage site, wherein the coding sequence for the short peptide is located 3' to the coding sequence for the leader peptide and 5' to the coding sequence for brazilian sweet or its mutant.
[0037] In some embodiments, the expression vector comprises the nucleotide sequence shown in any one of SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32 and 34, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to the nucleotide sequence shown in any one of SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32 and 34.
[0038] In some embodiments, the expression vector further comprises a coding sequence for a signal peptide; preferably, the signal peptide is derived from Aspergillus oryzae α-amylase.
[0039] In some embodiments, the expression vector further comprises a promoter and a terminator sequence; preferably, the promoter and the terminator are from the Aspergillus oryzae α-amylase gene.
[0040] In some embodiments, the expression vector further comprises a selection gene, preferably the amdS gene.
[0041] In another aspect, the present invention provides the use of the above-mentioned brazilian sweet or a mutant thereof as a food additive, a beverage additive or a pharmaceutical additive.
[0042] In another aspect, provided herein is an edible product comprising the above-described brasiliensis or a mutant thereof.
[0043] In some embodiments, the edible product is a food, a beverage, or a medicine.
[0044] In some embodiments, the edible product further comprises a sweetener other than the brazilian sweetener or a mutant thereof.
[0045] In some embodiments, the sweetener comprises sucrose.
[0046] In some embodiments, the beverage is a yogurt drink or sparkling water, such as zero sugar sparkling water. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] Figure 1: Schematic diagram of the expression elements of brazilian sweet and its mutants. PamyB and TamyB represent the amylase gene promoter and terminator, respectively; signal peptide represents the signal peptide sequence; ROLpro represents the Rhizopus oryzae lipase leader peptide sequence; Kex2 site represents the KEX2 protease cleavage site; and amdS represents the acetamidase gene coding sequence.
[0048] Figure 2: SDS-PAGE analysis of shake flask fermentation samples of brazilian sweet and its mutant proteins. In the figure, M represents marker, and lanes 1 to 16 are BXT, BXT-D1, BXT-D2, BXT-D3, BXT-D4, BXT-D5, BXT-D6, BXT-D7, ROLpro-BXT, ROLpro-BXT-D1, ROLpro-BXT-D2, ROLpro-BXT-D3, ROLpro-BXT-D4, ROLpro-BXT-D5, ROLpro-BXT-D6, and ROLpro-BXT-D7 proteins, respectively.
[0049] Figure 3: SDS-PAGE analysis of fermentation and purification samples of brazilian sweet and its mutant proteins. In the figure, M represents marker, and lanes 1 to 16 are BXT, BXT-D1, BXT-D2, BXT-D3, BXT-D4, BXT-D5, BXT-D6, BXT-D7, ROLpro-BXT, ROLpro-BXT-D1, ROLpro-BXT-D2, ROLpro-BXT-D3, ROLpro-BXT-D4, ROLpro-BXT-D5, ROLpro-BXT-D6, and ROLpro-BXT-D7 proteins, respectively. DETAILED DESCRIPTION
[0050] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0051] Sweet protein: refers to a protein with a strong sweet taste, which is suitable for sweetening food, beverages and / or pharmaceutical products for human consumption. By weight, the sweetness of the sweet protein of the present invention may be at least 1000 times, preferably at least 2000 times, more preferably at least 5000 times, and even more preferably 10000 times that of sucrose when compared to a 1% sucrose solution. For the purposes of the present invention, the comparison of sweetness can be determined by testing the human perception of the sweetness of the protein against a known control, using different concentrations of protein diluted in water or in an aqueous solution to avoid surface adsorption, such as 20% skim milk.
[0052] Sweetness threshold: Defined as the lowest concentration at which a taster identifies a sample as sweet. Sweetness potency is reported relative to sucrose.
[0053] Active ingredient: as used herein refers to the part of a product or composition that actually achieves what the product or composition is designed to achieve, i.e., the active ingredient in a sweetener is a substance that provides sweetness, such as thaumatin.
[0054] Sweetener: The term "sweetener" is used herein to refer to a product or composition in a sweetened form that can be directly applied to food, beverages and / or pharmaceutical products for human consumption. A sweetener may comprise a single active ingredient, i.e., a single substance with a sweet taste, or it may comprise several such active ingredients, i.e., a blend of substances that contribute to a sweet taste. The sweetener may be an active ingredient in its substantially pure form, such as separated from its production cells, and currently in a form that can be applied to a product intended for human consumption. Alternatively, the sweetener may also comprise other substances, such as, for example, fillers (e.g., lactose), in addition to the active ingredient. The sweetener may be further blended with other substances before being applied to a food or beverage product, or before being sold to the final consumer for sweetening of a household purpose such as tea or coffee.
[0055] Basil, also known as brazilin, bunajan, or bailon, refers to the sweet protein extracted from the fruit of the West African climbing plant Pentadiplandra brazzeana (Baillon) and described in WO9531547, or its recombinantly produced form. In nature, brazilin occurs in three different forms, with or without a Gln residue or pyroglutamic acid attached to its N-terminus. In the context of the present invention, the wild-type brazilin sequence preferably comprises the amino acid sequence of SEQ ID NO: 1, without a Gln residue or pyroglutamic acid attached to its N-terminus.
[0056] Mutant: As used herein, a “mutant” of thauma means a thauma protein having a modified amino acid sequence compared to the amino acid sequence of thauma (SEQ ID NO: 1), i.e., an amino acid sequence in which one or more (several) amino acids are substituted, deleted and / or inserted.
[0057] Coding sequence: As used herein, the term "coding sequence" means a polynucleotide sequence that directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG, and ends with a stop codon such as TAA, TAG, and TGA. The coding sequence can be a DNA, cDNA, RNA, synthetic, or recombinant nucleotide sequence.
[0058] Expression: in the context of the present invention includes any step involved in the production of the sweet protein of the present invention including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0059] Expression vector: refers to a linear or circular nucleic acid molecule construct, which comprises a polynucleotide encoding a protein such as brazilian sweet or its mutant provided herein, and the polynucleotide is operably connected to the additional nucleotides provided for its expression. The additional nucleotide sequence includes, for example, a promoter, a suitable transcription start and stop sequence. A "promoter" is a DNA sequence that RNA polymerase recognizes, binds to, and begins to transcribe. It contains the conserved sequence required for RNA polymerase specific binding and transcription initiation, most of which are located upstream of the transcription start point, and the promoter itself is not transcribed. In addition, the expression vector has the ability to replicate in the host, usually conferred by a replication origin, and / or carries a selection gene that helps to identify transformants. Usually, the expression vector utilized in recombinant DNA technology is often in the form of a "plasmid," i.e., a circular double-stranded DNA loop. Obviously, vectors derived from viruses such as retroviruses and adenoviruses can also be used.
[0060] Host cells include cells transformed, transfected, or transduced using a nucleic acid construct comprising a polynucleotide encoding thaumatin or an expression vector, and such cells can express thaumatin according to the methods of the present invention.
[0061] Signal peptide: A short (5-30 amino acids in length) peptide chain that directs newly synthesized proteins to the secretory pathway. It usually refers to the amino acid sequence at the N-terminus of a newly synthesized polypeptide chain that directs transmembrane transfer (localization) of proteins.
[0062] Leader peptide: also known as guide sequence or guide signal, refers to a sequence with a guiding function at the N-terminus of a protein synthesized on a free ribosome. It can guide the newly synthesized peptide to the correct cell area, guide the protein to pass through the membrane, and finally be processed and cut off.
[0063] KEX2 protease cleavage site: Kex2 protease specifically recognizes and cleaves double amino acid carboxyl-terminal peptide bond sites such as Arg-Arg (Arginine, Arginine, R) and Lys-Arg (Lysine, Lysine, K).
[0064] Amino acid sequence: Synonymous with and used interchangeably with the terms "polypeptide," "protein," and "peptide," using either the conventional one-letter code or the three-letter code for amino acid residues, with the amino acid sequence presented in the standard amino to carboxyl terminal orientation (i.e., N→C).
[0065] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". When aligned using the CLUSTALW algorithm with preset parameters, a specific sequence has at least a certain percentage of amino acid residues that are identical to the amino acid residues of a specified reference sequence. The preset parameters of the CLUSTALW algorithm are: deletion counts are residues that are different from the reference sequence. Deletions occurring at any end are included. For example, a variant 500 amino acid residue polypeptide lacking five amino acid residues at the C-terminus has a sequence identity percentage of 99% (495 / 500 identical residues x 100) relative to the parent polypeptide. Such variants are covered by the language "variants having at least 99% sequence identity with the parent".
[0066] As used herein, the term "about" refers to ±10%. As used herein, the term "about" means a value that may deviate from the stated value by up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to 20% higher or lower, and the deviation range includes integer values and, where applicable, non-integer values to form a continuous range.
[0067] The terms "comprising," "including," "having," and their combinations mean "including but not limited to," but also consist of only the listed elements.
[0068] The definitions provided herein are intended to facilitate understanding of certain terms frequently used herein and are not meant to limit the scope of the present disclosure.
[0069] Due to the structural complexity of brazilian sweet, especially the presence of numerous cysteine residues, brazilian sweet expressed in traditional systems such as Escherichia coli and Pichia pastoris cannot fold into the correct conformation, resulting in low sweetness of the prepared brazilian sweet. Ultimately, the method of preparing brazilian sweet using genetic engineering methods cannot meet the low cost requirements of industrial production. To address the above problems, the present invention proposes a method for preparing high-sweetness brazilian sweet. The present invention fuses a leader peptide sequence derived from Rhizopus oryzae lipase with the brazilian sweet sequence, and uses a filamentous fungal host to express the fusion sequence. The brazilian sweet and its mutant proteins finally prepared are the brazilian sweet with the highest sweetness disclosed in literature and patents to date. Compared with the brazilian sweet prepared in patent CN102498126A, the maximum sweetness of the brazilian sweet and its mutants prepared by the present invention is about 32.7 times that of the brazilian sweet. By increasing the sweetness of brazilian sweet, the present invention can achieve a good sweetness effect with extremely small addition amounts, thereby effectively reducing the production cost of brazilian sweet. In addition, due to the folding and secretion-promoting effects of the leader peptide of Rhizopus oryzae lipase, the sweetness sensory properties of the Brazilian sweet and its mutants prepared by the present invention are significantly improved. The Brazilian sweet prepared by patent CN102498126A has a significant sweetness delay, and the sweetness can only be felt after about 1.5 seconds, which greatly limits its application performance. The Brazilian sweet and its mutants prepared by the present invention have no obvious sweetness delay, and the sweetness duration is about 25 seconds on average (the sweetness duration is too long, which will cause the tongue to hang too strong, thereby reducing people’s preference for it). The sweetness sensory properties are closer to sucrose, making it easier to replace sucrose. At the same time, the present invention also applies the prepared Brazilian sweet to scenes such as yogurt drinks and sparkling water, proving that it can be a good substitute for sucrose as a sugar substitute sweetener. The present invention provides a method for producing Brazilian sweet from filamentous fungi. The Brazilian sweet obtained by this method is secreted outside the cell and can be easily separated from the host strain, thereby obtaining a very pure Brazilian sweet solution. By applying this production method in industry, Brazilian sweet can be produced at a lower cost than the previously disclosed production method.
[0070] The disclosure below provides many different embodiments or examples for realizing different embodiments of the present invention. In order to simplify the disclosure of the present invention, specific embodiments or examples are described below. Of course, they are merely examples and are not intended to limit the present invention. In addition, the examples of various specific processes and materials provided by the present invention, and those of ordinary skill in the art will be aware of the applicability of other processes and / or the use of other materials. Unless otherwise stated, the implementation of the present invention will adopt conventional techniques in the fields of chemistry, molecular biology, etc. within the scope of the capabilities of those skilled in the art. In addition, unless otherwise stated, in this article, nucleic acids are written from left to right in the direction of 5' to 3', and amino acid sequences are written from left to right in the direction of amino terminus to carboxyl terminus.
[0071] The present invention is described below by way of illustrative specific examples, which are not intended to limit the scope of the present invention in any way. It is particularly noted that the reagents used in the present invention are commercially available unless otherwise specified.
[0072] Culture media, reagents, and experimental methods
[0073] AMDS bottom medium: 342.3 g / L sucrose, 20 ml / L AMDS salt solution, 10 mM acetamide, 30 mM cesium chloride, 15 g / L agar, pH 5.5.
[0074] AMDS top layer medium: 342.3 g / L sucrose, 20 ml / L AMDS salt solution, 10 mM acetamide, 30 mM cesium chloride, 10 g / L low melting point agarose, pH 5.5.
[0075] The AMDS salt solution consisted of 26 g / L KCl, 26 g / L MgSO4·7H2O, 76 g / L KH2PO4, and 50 ml / L AMDS trace metals.
[0076] AMDS trace metal solution: 0.04 g / L Na2B4O7·10H2O, 0.4 g / L CuSO4·5H2O, 1.0 g / L FeSO4·7H2O, 1.0 g / L MnSO4·2H2O, 0.8 g, 1 g / L Na2MoO4·2H2O and 10.0 g / L ZnSO4·7H2O.
[0077] TB3 low-glucose medium: 3 g / L yeast extract, 3 g / L Casamina Acids, 30 g / L sucrose, and 15 g / L agar, pH 5.5.
[0078] YPG medium: 4 g / L yeast extract, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O and 15 g / L glucose (pH 6.0).
[0079] STC buffer was composed of 0.8 M sorbitol, 25 mM Tris (pH 8.0), and 25 mM CaCl2, and the volume was made up to 1 liter with water.
[0080] The STPC buffer solution was composed of STC buffer supplemented with 40% PEG4000.
[0081] Equilibration buffer (1 L): 20 mM sodium acetate buffer, pH 4.0
[0082] Weigh 0.246 g of anhydrous sodium acetate, add 0.97 ml of glacial acetic acid, add 800 mL of pure water, adjust the pH to 4.0, and make the volume to 1 L. The prepared buffer solution needs to be filtered through a 0.22 μm filter membrane.
[0083] Elution buffer (1 L): 20 mM sodium acetate buffer with 1 M sodium chloride, pH 4.0
[0084] Weigh 0.246 g of anhydrous sodium acetate, add 0.97 ml of glacial acetic acid, 58.44 g of sodium chloride, and 800 mL of pure water, adjust the pH to 4.0, and make the volume to 1 L. The prepared buffer solution needs to be filtered through a 0.22 μm filter membrane.
[0085] Dialysis buffer (5 L): 5 mM citrate buffer, pH 4.0
[0086] Weigh 2.48 g of sodium citrate and 3.18 g of citric acid, add 4.8 L of pure water, adjust the pH to 4.0, and adjust the volume to 5 L.
[0087] Aspergillus oryzae genome extraction
[0088] Aspergillus oryzae NBRC4177 was inoculated into TB3 low-glucose medium and cultured at 30°C for 7 days until spores matured. 7 The mycelial concentration was 4-5 g / L, and the genome was extracted according to the instructions of the Omega Fungal Genome Extraction Kit.
[0089] Conventional PCR amplification:
[0090] Fusion PCR amplification
[0091] Aspergillus oryzae transformation
[0092] 1) Inoculate spores from the Aspergillus oryzae slant into YPG liquid medium and incubate overnight at 30°C, 200 rpm (12-16 h) to form compact, small pellets (d < 2 mm). Filter the mycelium from the medium through a sterile microcloth and wash the mycelium 2-3 times with sterile water to obtain clean mycelium (approximately 200 mg).
[0093] 2) Prepare enzyme solution system (5 ml): 0.1 g cellulase, 0.1 g snail enzyme, 0.025 g lytic enzyme, add deionized water to 5 ml, and filter sterilize.
[0094] 3) Add the enzyme solution prepared in step 2) to the mycelium prepared in step 1) and perform enzymolysis at 150 rpm and 30° C. for 3 h.
[0095] 4) Filter the protoplasts through Microcloth to remove mycelial debris. Harvest the protoplasts and wash twice with STC buffer. Finally, resuspend the protoplasts in 200-1000 microliters of STC.
[0096] 5) 5 micrograms of DNA were added to 100 microlitre protoplast suspensions, and then 200 microlitre STPC buffers were added, and the mixture was incubated at room temperature for 20 minutes. The protoplasts were harvested and washed twice with 0.8 M sorbitol. Finally, the protoplasts were resuspended in 200 microlitre 0.8 M sorbitol.
[0097] 6) Pour AMDS bottom medium onto the bottom layer and allow it to solidify. Mix the suspension with AMDS top agar (at approximately 50°C) and pour over the top layer. Select transformants harboring the amdS gene using acetamide as the sole nitrogen source. After 5-7 days of growth at 30°C, stable transformants appear to be growing vigorously and forming sporulated colonies. Purify transformants twice by conidia.
[0098] Shake flask fermentation
[0099] Spores of the transformants were used to inoculate a shake flask containing 50 ml of YPMT medium (12% dextrin, 1% potassium dihydrogen phosphate, 0.25% magnesium sulfate, 2.5% yeast extract, 5% peptone, 0.05% Tween 80, and the remainder water, adjusted to pH 6.0 before digestion). To ensure the stability of the shake flasks, all shake flasks were inoculated with a uniform inoculum volume of 2 ml and a spore concentration of 2 × 10 7 The cells were cultured at 30°C, 200 rpm on the same shaking incubator for 5 days.
[0100] Aspergillus oryzae fermentation protocol
[0101] Seed culture: Spores from solid TB3 low-glucose medium culture were transferred to shake flasks (glycerol 20 g / L, yeast extract 18 g / L) and incubated at 30°C and 250 rpm for 1 day.
[0102] Fed-batch fermentation: A 50-liter tank fermentation medium (24 g / L sucrose, 10 g / L yeast extract, 5 g / L (NH₄)₂SO₄, 2 g / L MgSO₄·7H₂O, 2 g / L K₂SO₄, 1 g / L citric acid, 2 g / L KH₂PO₄, 0.5 ml / L trace metal solution) was adjusted to 30°C. Aeration was 1 vvm, and the pH was controlled at 6.0 using 10% aqueous ammonia. The tank medium was inoculated from a seed culture. When the pH reached > 6.4, feed (400 g / L maltose syrup, 1 g / L citric acid) was started at a rate of 3.33 g / L / h. The agitator speed was controlled to avoid low dissolved oxygen levels (<20%).
[0103] SDS-PAGE
[0104] The culture supernatants or purified samples were analyzed by SDS-PAGE using 16.5% Criterion SDS gels. TM Tris Tricine precast gels (Bio-Rad). 20 μl of sample (10 μl of each sample mixed with 10 μl of loading buffer) were loaded onto the gel, and 10 μl of Marker (pre-stained SDS-PAGE standard, GenScript Bio, #M00624-250) was applied. The gel was electrophoresed at a constant current of 20 mA for 80 min in 1× SDS buffer (Bio-Rad). Protein bands were stained with Bio-Safe Coomassie dye (Bio-Rad).
[0105] Gene
[0106] amdS: This gene encodes acetamidase, an enzyme involved in the metabolism of acetamide.
[0107] strain
[0108] Aspergillus oryzae NBRC4177: available from Institute for fermentation, Osaka; 17-25 Juso Hammachi 2-Chome Yodogawa-Ku, Osaka, Japan.
[0109] Example 1 Preparation of Brazilian sweet and its mutant sequences
[0110] The brazilian sweet sequence from Pentadiplandra brazzeana (Baillon) (UniProtKB / Swiss-Prot: P56552.1) can be obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). In the present invention, the sequence from amino acids 2 to 54, i.e., without a Gln residue at the N-terminus, was selected and named BXT. Its amino acid sequence is shown in SEQ ID NO: 1, and its nucleotide sequence is shown in SEQ ID NO: 2. Based on the brazilian sweet sequence, brazilian sweet variants were designed: 1) Glu at position 35 was mutated to Aspartic acid Asp, and Glu at position 40 was mutated to Alanine Ala. The resulting mutant was named BXT-D1, and its amino acid sequence is shown in SEQ ID NO: 3, and its nucleotide sequence is shown in SEQ ID NO: 4; 2) Glu at position 35 was mutated to Aspartic acid Asp, and Glu at position 40 was mutated to Aspartic acid Asp. The resulting mutant was named BXT-D2, and its amino acid sequence is shown in SEQ ID NO: 5, and its nucleotide sequence is shown in SEQ ID NO: 6; 3) Glu at position 35 was mutated to Aspartic acid Asp, and Glu at position 40 was mutated to Lysine Lys. The resulting mutant was named BXT-D3, and its amino acid sequence is shown in SEQ ID NO: 7, and its nucleotide sequence is shown in SEQ ID NO: 8. NO: 8; 4) the glutamic acid Glu at position 35 was mutated to aspartic acid Asp, and the glutamic acid Glu at position 40 was mutated to arginine Arg, resulting in a mutant named BXT-D4, whose amino acid sequence is shown in SEQ ID NO: 9 and the nucleotide sequence is shown in SEQ ID NO: 10; 5) based on the mutant BXT-D1, the histidine at position 30 was mutated to arginine Arg, resulting in a mutant named BXT-D5, whose amino acid sequence is shown in SEQ ID NO: 11 and the nucleotide sequence is shown in SEQ ID NO: 12; 6) based on the mutant BXT-D3, the histidine at position 30 was mutated to arginine Arg, resulting in a mutant named BXT-D6, whose amino acid sequence is shown in SEQ ID NO: 13 and the nucleotide sequence is shown in SEQ ID NO: 14; 7) based on the mutant BXT-D4, the histidine at position 30 was mutated to arginine Arg, resulting in a mutant named BXT-D7, whose amino acid sequence is shown in SEQ ID NO: 15 and the nucleotide sequence is shown in SEQ ID NO: 16.The leader peptide sequence ROLpro (with a kex2 restriction site added, amino acid sequence SEQ ID NO: 18: VALEKR) of Rhizopus oryzae lipase was fused to the aforementioned brazilian sweet or its mutant sequence. The amino acid sequence of the leader peptide sequence ROLpro is shown in SEQ ID NO: 17. The fused sequences were designated ROLpro-BXT, ROLpro-BXT-D1 to ROLpro-BXT-D7, respectively, with amino acid and nucleotide sequences shown in SEQ ID NO: 19 to SEQ ID NO: 34. Codon optimization and gene synthesis of the fused sequences were performed by Nanjing GenScript Biotechnology Co., Ltd. The amino acid and nucleotide sequences of the leader peptide sequence of Rhizopus oryzae lipase, brazilian sweet and its mutants, and the fused sequences are shown in Table 1 below.
[0111] Table 1 Amino acid and nucleotide sequences of brazilian sweet and its mutants, leader peptide sequences and fusion sequences
[0112] Example 2 Preparation of expression elements of brazilian sweet and its mutants
[0113] 2.1 Isolation of the Aspergillus oryzae α-amylase promoter (PamyB) and its signal peptide sequence
[0114] Based on the amyB promoter sequence published in GeneBank (GenBank: AP007157.1), the amyB promoter and signal peptide sequences were specifically amplified by PCR using the previously extracted Aspergillus oryzae genomic DNA as a template using the upstream primer PasF and the downstream primers PasR1 or PasR2. These sequences were designated PaS1 or PaS2 (PamyB + signal peptide). The PCR products were subjected to agarose gel electrophoresis to recover the desired fragments, which were then purified according to the Axygen kit instructions. Here,
[0115] The sequence of the upstream primer PasF is: TAAATTTTTATATGGCGGGTGGTGG (5'-3') (this primer was synthesized by Nanjing GenScript Biotechnology Co., Ltd., the same below) (SEQ ID NO: 35).
[0116] The sequence of the downstream primer PasR1 is: GACGAGGTTATCATCAGCCAAAGCAGGTGCCGC (5'-3') (SEQ ID NO: 36).
[0117] The sequence of the downstream primer PasR2 is: CTTCTTGCACTTGTCAGCCAAAGCAGGTGCCGC (5'-3') (SEQ ID NO: 37)
[0118] 2.2 Isolation of Aspergillus oryzae α-amylase terminator (TamyB)
[0119] Based on the amyB terminator sequence published in GeneBank (GenBank: AP007157.1), the amyB terminator sequence was specifically amplified and isolated by PCR using the extracted Aspergillus oryzae genomic DNA as a template with the upstream primer TayF and the downstream primer TayR. The PCR product was subjected to agarose gel electrophoresis to recover the target fragment. Here,
[0120] The sequence of the upstream primer TayF is: TACTGCGAGTACTAGAGGGTGGAGAGTATATGATGGTA (5'-3') (SEQ ID NO: 38).
[0121] The sequence of the downstream primer TayR is: CTTCGAAGAGATACAAGTAAGTGATGGATCGCACT (5'-3') (SEQ ID NO: 39).
[0122] 2.3 Isolation of the Aspergillus oryzae acetamidase-encoding gene (amds) element
[0123] Based on the amds gene sequence published on GeneBank (Gene ID: 5997229), the amds gene sequence (including the promoter, gene sequence, and terminator elements) was isolated by specific PCR amplification using the previously extracted Aspergillus oryzae genomic DNA as a template using the upstream primer AmsF and the downstream primer AmsR. The PCR product was subjected to agarose gel electrophoresis to recover the target fragment. Here,
[0124] The sequence of the upstream primer AmsF is: GATCCATCACTTACTTGTATCTCTTCGAAGATGCCGA (5'-3') (SEQ ID NO: 40).
[0125] The sequence of the downstream primer AmsR is: GGGTGCGCCATGATAAAC (5'-3') (SEQ ID NO: 41).
[0126] 2.4 Preparation of expression elements for brazilian sweet and its mutants by fusion of sequence elements
[0127] Using the synthesized ROLpro-BXT, ROLpro-BXT-D1 to ROLpro-BXT-D7 sequences as templates, upstream primer BxF1 and downstream primer BxR were used to perform specific PCR amplification to isolate the ROLpro-BXT, ROLpro-BXT-D1 to ROLpro-BXT-D7 gene sequences. Upstream primer BxF2 and downstream primer BxR were used to perform specific PCR amplification to isolate the Brazilian sweet BXT and its variant BXT-D1-D7 gene sequences without the lipase leader peptide sequence ROLpro. The PCR products were subjected to agarose gel electrophoresis to recover the target fragments.
[0128] The sequence of the upstream primer BxF1 is: GCACCTGCTTTGGCTGATGATAACCTCGTCGGC (5'-3') (SEQ ID NO: 42).
[0129] The sequence of the upstream primer BxF2 is: GCACCTGCTTTGGCTGACAAGTGCAAGAAGGTCTAC (5'-3') (SEQ ID NO: 43).
[0130] The sequence of the downstream primer BxR is: TATACTCTCCACCCTCTAGTACTCGCAGTAGTCGCA (5'-3') (SEQ ID NO: 44).
[0131] The three sequences of PaS1, ROLpro-BXT or ROLpro-BXT-D1 to ROLpro-BXT-D7, and TamyB recovered by gel were used as a mixed template, and specific fusion PCR amplification was performed with the upstream primer PasF and the downstream primer TayR. The PCR products were subjected to agarose gel electrophoresis, and the fusion fragments PaS1-ROLpro-BXT-TamyB or PaS1-ROLpro-BXT-D1-TamyB to PaS1-ROLpro-BXT-D7-TamyB were separated by gel recovery.
[0132] The three sequences of PaS2, BXT or BXT-D1 to BXT-D7, and TamyB recovered from gel were used as a mixed template, and specific fusion PCR amplification was performed with the upstream primer PasF and the downstream primer TayR. The PCR products were subjected to agarose gel electrophoresis, and the fusion fragments PaS2-BXT-TamyB or PaS2-BXT-D1-TamyB to PaS2-D7-TamyB were separated by gel recovery.
[0133] The gel-recovered PaS1-ROLpro-BXT-TamyB or PaS1-ROLpro-BXT-D1-TamyB ~ PaS1-ROLpro-BXT-D7-TamyB and amdS sequences were used as a mixed template, and specific fusion PCR amplification was performed with the upstream primer PasF and the downstream primer AmsR. The PCR products were subjected to agarose gel electrophoresis, and the fusion fragments PaS-ROLpro-BXT-TamyB-amdS or PaS-ROLpro-BXT-D1-TamyB-amdS ~ PaS-ROLpro-BXT-D7-TamyB-amdS were recovered and separated by gel recovery, thereby completing the construction of the expression elements of Brazilian sweet BXT and its mutant BXT-D1-D7 with the lipase leader peptide sequence ROLpro. The recovered fragments were sent for sequencing verification. The schematic diagram of the expression element map is shown in Figure 1.
[0134] The gel-recovered PaS2-BXT-TamyB or PaS2-BXT-D1-TamyB ~ PaS2-BXT-D7-TamyB, amdS sequences were used as a mixed template, and specific fusion PCR amplification was performed with the upstream primer PasF and the downstream primer AmsR. The PCR products were subjected to agarose gel electrophoresis, and the fusion fragments PaS-BXT-TamyB-amdS or PaS-BXT-D1-TamyB-amdS ~ PaS-D7-TamyB-amdS were recovered and separated by gel recovery, thereby completing the construction of the Brazilian sweet BXT and its mutant BXT-D1-D7 expression elements without the lipase leader peptide sequence ROLpro. The recovered fragments were sent for sequencing verification. The schematic diagram of the expression element map is shown in Figure 1.
[0135] Example 3 Recombinant expression of brazilian sweet and its mutant in Aspergillus oryzae
[0136] The brazilian sweet and its mutant expression element fragments described in Example 2 were transformed into Aspergillus oryzae strain NBRC4177, and transformants containing the amdS gene were selected using the ability to use acetamide as a sole nitrogen source. After 5 days of growth at 30°C, stable transformants appeared to be growing vigorously and forming sporulated colonies. Twenty transformants were re-purified twice by conidia. Spores of the transformant strains were inoculated into shake flasks containing 50 ml of YPMT medium (12% dextrin, 1% potassium dihydrogen phosphate, 0.25% magnesium sulfate, 2.5% yeast extract, 5% peptone, 0.05% Tween 800, and the remainder water, adjusted to pH 6.0 before digestion) and cultured at 30°C, 200 rpm for 5 days. The culture supernatant was analyzed by SDS-PAGE to determine whether the target protein was expressed and correctly cleaved (see Figure 2 for details). Results showed that both brazilian sweet and its mutants were expressed in Aspergillus oryzae. The molecular weights of brazilian sweet and its mutants carrying the lipase leader peptide sequence ROLpro and those without it were similar (~6.5 kD), indicating that the lipase leader peptide sequence ROLpro was properly cleaved and removed. Furthermore, the expression levels of brazilian sweet and its mutants carrying the lipase leader peptide sequence ROLpro were significantly higher than those without it, suggesting that the lipase leader peptide sequence ROLpro facilitates the secretory expression of brazilian sweet. The best transformants were selected for fermentation in 50-liter tanks using the same method as described above. The fermentation was continued at 30°C for 150 hours, and the fermentation broths were collected at different stages for protein analysis. The results showed that the protein expression in the final fermentation broth averaged approximately 10 g / L.
[0137] Example 4 Purification of fermentation samples of brazilian sweet and its mutants
[0138] The fermentation broth from Example 3 was filtered through a 0.22 μm filter and loaded onto an ion exchange chromatography column SP Seplife XL (Suzhou Lanxiao Biotechnology Co., Ltd.). The column was balanced with 20 mM sodium acetate buffer (pH 4.0) and the target protein was eluted with 20 mM sodium acetate buffer (pH 4.0) containing 1 M sodium chloride. The collected target protein was placed in a dialysis bag with a molecular weight cutoff of 3500 and dialyzed at 4°C for 24 hours. It was dialyzed with deionized water and the liquid was changed 3 times during the period. The purified sample was dried and concentrated by freeze-drying, and the powder obtained was weighed and sealed and stored in a 4°C refrigerator. The purified protein was subjected to SDS-PAGE detection, and the results are shown in Figure 3. The concentration of the target protein was determined by the Coomassie Brilliant Blue method and the sweetness activity of the protein was preliminarily determined by tasting the dialyzed solution. The purity of this batch of purified protein was measured to be about 95%.
[0139] Example 5 Determination of the Sweetness Threshold of Brazilian Sweet and Its Mutant Proteins
[0140] Since the recombinant brazilian tartrate of the present invention is not a glycosylated compound, its sweetness cannot be measured using a saccharimeter. Therefore, human sensory evaluation was used to measure the sweetness threshold. For most people, the sweetness threshold of sugar in soft drinks is between 0.32% and 1.0%. To evaluate the sweetness threshold of each solution, a 1% sucrose solution was used as the minimum concentration for perceiving sweetness, resulting in a sweetness threshold of 10,000 μg / mL. The sweetness potency of the brazilian tartrate described herein relative to sucrose generally ranged from 1:500 to 1:16,000. The samples tested included naturally extracted brazilian tartrate (homemade, approximately 95% purity), recombinant brazilian tartrate and its mutants, sucrose, and mineral water. The protein powder was diluted with mineral water (pH 6.9) to a gradient of 0.5 to 20 μg / mL. Ten healthy assessors participated in the evaluation: five men and five women, aged between 30 and 50 years old, five of whom were trained wine tasters. Tasting began with the lowest concentration, increasing the concentration by 1 μg / ml each time. When sweetness was felt, this concentration was used as a baseline, and the concentration was subsequently reduced by 0.1 μg / ml each time until no sweetness was felt. This method was used to gradually reduce the concentration gradient to determine the sweetness threshold of the sample. 20 ml of the sample was randomly tested compared to the sugar solution. Before each analysis, the assessors were asked to rinse their mouths with water and eat neutral-tasting crackers until no residual taste remained. The test solution was held in the mouth for at least 10 seconds. The assessors then scored the samples based on their responses on a scale of 0 to 10; 0 - no sweetness felt, 10 - very sweet. The final result for each protein was the average of the tasting results of 10 people. The sweetness multiple of Brazilian sweet and its variants relative to 1% sucrose = 10,000 / (sweetness threshold of the sample). The results are shown in Table 2.
[0141] The results show that the sweetness of brazilian sweet and its mutants prepared by adding the lipase leader peptide sequence ROLpro was significantly improved. For BXT, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by approximately 4.7 times. For BXT-D1, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by approximately 11.6 times. For BXT-D2, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by approximately 10 times. For BXT-D3, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by approximately 13.6 times. For BXT-D4, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by approximately 12 times. For BXT-D5, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by approximately 9.7 times. For BXT-D6, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by approximately 14.5 times. For BXT-D7, the addition of the lipase leader peptide sequence ROLpro increased its sweetness by about 13.2 times. From the above examples, we can conclude that the addition of the lipase leader peptide sequence ROLpro significantly improved the expression and sweetness of Brazilian sweet and its variant proteins. The sweetness of Brazilian sweet expressed by Aspergillus oryzae host in patent CN102498126A is only 510 times that of sucrose of the same weight, while the highest sweetness of Brazilian sweet and its variants prepared by the present invention is about 32.7 times that of sucrose. The Brazilian sweet and its variant proteins prepared by the present invention are the Brazilian sweet with the highest sweetness disclosed in the literature and patents to date. The present invention also attempted fermentation on a 50L tank scale, proving that the preparation of Brazilian sweet and its variants of the present invention is industrially feasible.
[0142] In order to further test the sweet sensory characteristics of Brazilian sweet and its mutants, the present invention diluted Brazilian sweet and its mutants into an aqueous solution corresponding to the sweetness of a 6% sucrose aqueous solution according to their sweetness multiples, and evaluated their sweetness characteristics. The evaluation was conducted based on two indicators: sweetness delay and sweetness duration. The results showed that for Brazilian sweet and its mutants prepared without the addition of the lipase leader peptide sequence ROLpro, the average sweetness delay of these proteins was about 1.5 seconds, and the average sweetness duration was about 40 seconds. However, Brazilian sweet and its mutants prepared by adding the lipase leader peptide sequence ROLpro had no obvious sweetness delay, and the average sweetness duration was about 25 seconds (sweetness duration that is too long will cause a strong tongue-hanging feeling, thereby reducing people's preference for it), which is close to the sensory characteristics of sucrose. This shows that adding the lipase leader peptide sequence ROLpro can eliminate the sweetness delay and shorten the sweetness duration, making these proteins sensory closer to sucrose.
[0143] Table 2 Determination results of sweetness threshold of Brazilian sweet and its variants
[0144] Example 6: Substituting sucrose in yogurt drinks
[0145] A 10-person sensory panel evaluated the taste liking of Brazilian sweets BXT-D6 and BXT-D7, prepared by adding the lipase leader peptide sequence ROLpro to yogurt. A yogurt product containing 4.6 g of milk fat and 4.0 g of milk protein per 100 g (Jane Eyre 0 Added Sugar - Plain) was diluted to a yogurt containing 3.2 g of milk protein per 100 g. 4% sucrose was then added to each diluted yogurt to form a standard sample. The sweetness of Brazilian sweets BXT-D6 and BXT-D7 at concentrations of 0.27 to 6.67 mg / 100 g in the yogurt corresponded to the sweetness of 4% ± 1% sucrose, with overall liking scores comparable to those of the standard sample. Therefore, under the current conditions (80% Jane Eyre 0 Added Sugar - Plain yogurt), this batch of Brazilian sweets can replace 4% sucrose without a significant decrease in taste liking.
[0146] Example 7: Use of sugar substitute in white peach zero sugar sparkling water
[0147] A 10-person sensory evaluation panel evaluated the preference for sparkling water. Accurately weigh 3.8g of erythritol, 0.04g of white peach essence, 0.1g of citric acid, 2.5-62.5ppm of Brazilian sweet BXT-D6 and BXT-D7 (prepared by adding the lipase leader peptide sequence ROLpro) and dissolve them in 15g of sugar-free soda water. After complete dissolution, add 85g of sugar-free soda water and mix evenly to complete the production of white peach 0-sugar sparkling water. It was found that the sweetness preference score of the white peach 0-sugar sparkling water with added Brazilian sweet was comparable to that of the commercially available white peach 0-sugar sparkling water. Therefore, in the white peach 0-sugar sparkling water under these conditions, Brazilian sweet can be used as a sugar substitute sweetener.
[0148] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic expressions of the above terms should not be understood as necessarily referring to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification.
[0149] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.
Claims
1. A method for preparing brazilian sweet or a mutant thereof, comprising: 1) constructing an expression vector, wherein the expression vector comprises a coding sequence of the brazilian sweet or a mutant thereof and a coding sequence of a leader peptide, wherein the leader peptide is derived from Rhizopus oryzae lipase; and 2) Introducing the expression vector into host cells.
2. The method of claim 1, wherein the Brazilian sweet comprises the amino acid sequence shown in SEQ ID NO: 1; and the mutant comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and has a sweet taste. 3 . The method according to claim 1 , wherein the sweetness threshold of the brazilian sweet or its mutant is lower than 100 μg / mL, preferably lower than 10 μg / mL, more preferably lower than 1 μg / mL.
4. The method of any one of claims 1-3, wherein the mutant comprises the amino acid substitutions E35D, E40A, E40D, E40K, E40R, H30R or any combination thereof.
5. The method according to any one of claims 1 to 4, wherein the mutant comprises any of the following amino acid substitution combinations: 1)E35D / E40A; 2) E35D / E40D; 3)E35D / E40K; 4) E35D / E40R; 5)H30R / E35D / E40A; 6) H30R / E35D / E40K; and 7)H30R / E35D / E40R.
6. The method according to any one of claims 1 to 5, wherein the mutant comprises the amino acid sequence shown in any one of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, and SEQ ID NO:
15.
7. The method of any one of claims 1-6, wherein the leader peptide comprises the amino acid sequence shown in SEQ ID NO: 17, or an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO:
17.
8. The method according to any one of claims 1 to 7, wherein the brazilian sweet or its mutant and the leader peptide are expressed in the form of a fusion protein; preferably, the leader peptide is located at the N-terminus of the fusion protein.
9. The method according to any one of claims 1 to 8, wherein the expression vector further comprises a coding sequence for a short peptide providing a protease cleavage site, the coding sequence for the short peptide being located between the coding sequence for the leader peptide and the coding sequence for the brazilian sweet or a mutant thereof.
10. The method of any one of claims 1 to 9, wherein the short peptide comprises the amino acid sequence VALEKR.
11. The method according to any one of claims 1 to 10, wherein the expression vector further comprises a coding sequence for a signal peptide; preferably, the signal peptide is derived from Aspergillus oryzae α-amylase.
12. The method according to any one of claims 1 to 11, wherein the expression vector further comprises a promoter and a terminator sequence; preferably, the promoter and the terminator are from an Aspergillus oryzae α-amylase gene.
13. The method according to any one of claims 1 to 12, wherein the expression vector comprises a selection gene, preferably the amdS gene.
14. The method according to any one of claims 1 to 13, wherein the host cell is a filamentous fungus, preferably Aspergillus oryzae, more preferably Aspergillus oryzae NBRC4177.
15. Brazilian sweet or a mutant thereof prepared by the method according to any one of claims 1 to 14.
16. A nucleic acid molecule comprising a coding sequence of the brazilian sweet or a mutant thereof according to claim 15.
17. An expression vector comprising a coding sequence of brazilian sweet or a mutant thereof prepared by the method according to any one of claims 1 to 14 and a coding sequence of a leader peptide, wherein the leader peptide is derived from Rhizopus oryzae lipase.
18. The expression vector according to claim 17, further comprising a coding sequence of a short peptide providing a protease cleavage site, wherein the coding sequence of the short peptide is located in the 3' direction of the coding sequence of the leader peptide and in the 5' direction of the coding sequence of the brazilian sweet or its mutant.
19. The expression vector of claim 17 or 18, comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32 and 34, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with the nucleotide sequence shown in any one of SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32 and 34.
20. The expression vector according to any one of claims 17 to 19, further comprising a coding sequence for a signal peptide; preferably, the signal peptide is derived from Aspergillus oryzae α-amylase.
21. The expression vector according to any one of claims 17 to 20, wherein the expression vector further comprises a promoter and a terminator sequence; preferably, the promoter and the terminator are from an Aspergillus oryzae α-amylase gene.
22. The expression vector according to any one of claims 17 to 21, further comprising a selection gene, preferably the amdS gene.
23. Use of the brazilian sweetener or its mutant according to claim 15 as a food additive, beverage additive or drug additive.
24. An edible product comprising the Brazilian sweet or a mutant thereof according to claim 15.
25. An edible product according to claim 24, which is a food, a beverage or a medicine.
26. The edible product of claim 24 or 25, further comprising a sweetener different from the brazilian sweet or a mutant thereof.
27. An edible product as claimed in any one of claims 24 to 26, wherein the sweetener comprises sucrose.
28. An edible product according to any one of claims 24 to 27, wherein the beverage is a yoghurt drink or sparkling water, such as zero sugar sparkling water.
Citation Information
Cited By
Brazilin mutants, polynucleotides, recombinant vectors, transgenic cells, compositions, and uses
CN122772077A
Brazilin mutants, polynucleotides, recombinant vectors, transgenic cells, compositions, and uses
CN122832063A